Pooled Lentiviral‐Delivery Genetic Screens

Federica Piccioni1, Scott T. Younger1, David E. Root1

1 Genetic Perturbation Platform, Broad Institute of MIT and Harvard, Cambridge, Massachusetts
Publication Name:  Current Protocols in Molecular Biology
Unit Number:  Unit 32.1
DOI:  10.1002/cpmb.52
Online Posting Date:  January, 2018
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Pooled cell‐based screens of mammalian genetic perturbations enable systematic large‐scale, even genome‐scale, evaluation of gene function. Pooled screens introduce genetic perturbations into a cell population through viral transduction such that each cell integrates into its DNA a single or small number of library perturbations with barcodes identifying the perturbations. One then selects and physically isolates the subset of cells that exhibit the phenotype of interest. Sequencing the barcodes in the hit cells reveals which genes favored or inhibited the hit phenotype. Various genetic perturbations are possible, including CRISPR gene knockout, ectopic gene expression, and RNA interference. Regardless of the type of library being screened or the type of cell model being tested, such screens involve many common steps and procedures. This unit describes detailed experimental protocols for the key steps, and also highlights some of the key factors to achieving a well‐powered, reproducible screen result. © 2018 by John Wiley & Sons, Inc.

Keywords: CRISPR screens; functional genomics; large‐scale genetic screens; pooled screens

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Large‐Scale Pooled Lentivirus Screening
  • Support Protocol 1: CRISPR Pooled Screen
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Large‐Scale Pooled Lentivirus Screening

  Materials
  • Cultured cells of interest
  • Complete growth medium: e.g., DMEM containing 10% (v/v) fetal bovine serum and pen/strep
  • 0.25% trypsin (VWR, cat. no. 45000‐664)
  • 8 mg/ml Polybrene solution (Sigma‐Aldrich, cat. no. H9268)
  • Pooled lentiviral library for desired perturbation (prepared as virus)
    • For CRISPR‐Cas9 screens, a few examples of available libraries include:
    • Brunello human genome‐wide library 1 plasmid (to be added to Cas9‐expressing cells, Addgene, plasmid ID 73179)
    • Brie mouse genome‐wide library 1 plasmid (to be added to Cas9‐expressing cells, Addgene, plasmid ID 75317)
    • Brunello human genome‐wide library 2 plasmid (Cas9 delivered along with sgRNA, Addgene, plasmid ID 73178)
    • Brie mouse genome‐wide library 2 plasmid (Cas9 delivered along with sgRNA, Addgene, plasmid ID 75316)
  • PBS (Sigma‐Aldrich, cat. no. D8537)
  • 10 mg/ml puromycin (Sigma‐Aldrich, cat. no. P9620)
  • Proteinase K (Macherey‐Nagel, cat. no. 740506)
  • RNase A (Macherey‐Nagel, cat. no. 740505)
  • 100% ethanol (Fisher Scientific, cat. no. 04‐355‐222)
  • NucleoSpin Blood XL Kit (Macherey‐Nagel, cat. no. 740950), including Buffers BQ1 and BE
  • Indexed P7 PCR Primer (5 μM) (see Table 32.1.1)
  • P5 PCR Primer Mix (100 μM each) (see Table 32.1.2)
  • dNTP mix (2.5 mM each)
  • Ex Taq DNA Polymerase (5 U/μl) and 10× buffer (Takara, cat. no. RR001A)
  • Nuclease‐free water (Thermo Fisher Scientific, cat. no. 10977015)
  • Agencourt AMPure XP (SPRI) beads (Beckman Coulter, cat. no. A63881)
  • TE buffer ( appendix 22)
  • T175 and T225 tissue culture flasks (VWR, cat. no. 353138) and other sizes dictated by the needs of the experiment
  • 37°C, 5% CO 2 incubator
  • Cell counter or hemocytometer
  • 6‐ and 12‐well plates (VWR, cat. nos. B3505 and B3512)
  • Plate centrifuge with bucket and lid (to hold two plates)
  • 50‐ and 250‐ml conical tubes
  • Sterile containers (>400 ml volume)
  • 2‐ml freezing vials (VWR, cat. no. 66021‐974)
  • NanoDrop 2000 spectrophotometer
  • 96‐well round‐bottom plates (Costar 3795, cat. no. 07‐200‐103)
  • Adhesive PCR plate cover (Fisher Scientific, cat. no. 14‐222‐342)
  • Thermocycler
  • Microcentrifuge tubes
  • 96‐well ring magnet plate (Alpaqua, cat. no. A001322)
  • Additional reagents and equipment for agarose gel electrophoresis (unit 2.5; Voytas, )
Table 2.1.1   MaterialsIndexed P7 Primers for the lentiGuide‐Puro VectorP5 Primers for the lentiGuide‐Puro Vector

Name Sequence (* indicates phosphorothioate backbone modifications)
P7 Primer #1 CAAGCAGAAGACGGCATACGAGATCGGTTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #2 CAAGCAGAAGACGGCATACGAGATGCTGGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #3 CAAGCAGAAGACGGCATACGAGATTAACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #4 CAAGCAGAAGACGGCATACGAGATTAACAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #5 CAAGCAGAAGACGGCATACGAGATATACTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #6 CAAGCAGAAGACGGCATACGAGATGCTGAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #7 CAAGCAGAAGACGGCATACGAGATATTGGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #8 CAAGCAGAAGACGGCATACGAGATTAGTCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #9 CAAGCAGAAGACGGCATACGAGATCGGTGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #10 CAAGCAGAAGACGGCATACGAGATTACAGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #11 CAAGCAGAAGACGGCATACGAGATATTGTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #12 CAAGCAGAAGACGGCATACGAGATTATGTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #13 CAAGCAGAAGACGGCATACGAGATATTGGATTGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #14 CAAGCAGAAGACGGCATACGAGATATACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #15 CAAGCAGAAGACGGCATACGAGATTATGAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #16 CAAGCAGAAGACGGCATACGAGATGCACAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #17 CAAGCAGAAGACGGCATACGAGATCGTGGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #18 CAAGCAGAAGACGGCATACGAGATTAGTAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #19 CAAGCAGAAGACGGCATACGAGATGCACGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #20 CAAGCAGAAGACGGCATACGAGATCGGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #21 CAAGCAGAAGACGGCATACGAGATTAGTTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #22 CAAGCAGAAGACGGCATACGAGATTACAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #23 CAAGCAGAAGACGGCATACGAGATATCACTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #24 CAAGCAGAAGACGGCATACGAGATCGCATCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #25 CAAGCAGAAGACGGCATACGAGATGCACGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #26 CAAGCAGAAGACGGCATACGAGATTACACTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #27 CAAGCAGAAGACGGCATACGAGATCGGTCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #28 CAAGCAGAAGACGGCATACGAGATATGTTCGGGTGACTGGAGTTCAGACGTGTGCTC TTCCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #29 CAAGCAGAAGACGGCATACGAGATCGTGGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #30 CAAGCAGAAGACGGCATACGAGATATTGAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #31 CAAGCAGAAGACGGCATACGAGATTAGTTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #32 CAAGCAGAAGACGGCATACGAGATCGGTGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #33 CAAGCAGAAGACGGCATACGAGATCGTGAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #34 CAAGCAGAAGACGGCATACGAGATATCAGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #35 CAAGCAGAAGACGGCATACGAGATTAGTGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #36 CAAGCAGAAGACGGCATACGAGATCGGTTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #37 CAAGCAGAAGACGGCATACGAGATTATGGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #38 CAAGCAGAAGACGGCATACGAGATGCCAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #39 CAAGCAGAAGACGGCATACGAGATCGCAGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #40 CAAGCAGAAGACGGCATACGAGATCGACCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #41 CAAGCAGAAGACGGCATACGAGATGCCACTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #42 CAAGCAGAAGACGGCATACGAGATGCGTAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #43 CAAGCAGAAGACGGCATACGAGATCGCAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #44 CAAGCAGAAGACGGCATACGAGATCGACAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #45 CAAGCAGAAGACGGCATACGAGATCGCATCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #46 CAAGCAGAAGACGGCATACGAGATATGTTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #47 CAAGCAGAAGACGGCATACGAGATGCGTAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #48 CAAGCAGAAGACGGCATACGAGATATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #49 CAAGCAGAAGACGGCATACGAGATTAACTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #50 CAAGCAGAAGACGGCATACGAGATCGTGAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #51 CAAGCAGAAGACGGCATACGAGATATCAGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #52 CAAGCAGAAGACGGCATACGAGATTATGGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #53 CAAGCAGAAGACGGCATACGAGATGCGTTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #54 CAAGCAGAAGACGGCATACGAGATCGCAAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #55 CAAGCAGAAGACGGCATACGAGATCGACAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #56 CAAGCAGAAGACGGCATACGAGATCGACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #57 CAAGCAGAAGACGGCATACGAGATTACAAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #58 CAAGCAGAAGACGGCATACGAGATCGCAGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #59 CAAGCAGAAGACGGCATACGAGATATTGCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #60 CAAGCAGAAGACGGCATACGAGATGCACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #61 CAAGCAGAAGACGGCATACGAGATATGTTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #62 CAAGCAGAAGACGGCATACGAGATATGTCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #63 CAAGCAGAAGACGGCATACGAGATGCACTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #64 CAAGCAGAAGACGGCATACGAGATTAGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #65 CAAGCAGAAGACGGCATACGAGATCGTGTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #66 CAAGCAGAAGACGGCATACGAGATGCGTTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #67 CAAGCAGAAGACGGCATACGAGATGCCAAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #68 CAAGCAGAAGACGGCATACGAGATGCACCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #69 CAAGCAGAAGACGGCATACGAGATGCACCTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #70 CAAGCAGAAGACGGCATACGAGATGCCAGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #71 CAAGCAGAAGACGGCATACGAGATCGCAAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #72 CAAGCAGAAGACGGCATACGAGATTACATCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #73 CAAGCAGAAGACGGCATACGAGATGCGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #74 CAAGCAGAAGACGGCATACGAGATCGACAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #75 CAAGCAGAAGACGGCATACGAGATTAGTCTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #76 CAAGCAGAAGACGGCATACGAGATATCAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #77 CAAGCAGAAGACGGCATACGAGATTAGTAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #78 CAAGCAGAAGACGGCATACGAGATATACTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #79 CAAGCAGAAGACGGCATACGAGATCGGTAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #80 CAAGCAGAAGACGGCATACGAGATATACGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #81 CAAGCAGAAGACGGCATACGAGATCGCACTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #82 CAAGCAGAAGACGGCATACGAGATTACAGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #83 CAAGCAGAAGACGGCATACGAGATGCGTGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #84 CAAGCAGAAGACGGCATACGAGATTATGTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #85 CAAGCAGAAGACGGCATACGAGATCGACTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #86 CAAGCAGAAGACGGCATACGAGATGCGTTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #87 CAAGCAGAAGACGGCATACGAGATATACCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #88 CAAGCAGAAGACGGCATACGAGATCGGTGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #89 CAAGCAGAAGACGGCATACGAGATTAACGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #90 CAAGCAGAAGACGGCATACGAGATATACAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #91 CAAGCAGAAGACGGCATACGAGATCGACGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #92 CAAGCAGAAGACGGCATACGAGATATCACTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #93 CAAGCAGAAGACGGCATACGAGATCGACCTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #94 CAAGCAGAAGACGGCATACGAGATTATGTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #95 CAAGCAGAAGACGGCATACGAGATTAACCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #96 CAAGCAGAAGACGGCATACGAGATGCCATCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
Name Sequence (* indicates phosphorothioate backbone modifications)
P5 Primer #1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #3 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTGCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #4 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTAGCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTCAACTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #6 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTTGCACCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #7 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTACGCAACTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #8 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTGAAGACCCTTGTGGAAAGGACGAAAC*A*C*C*G

Table 2.1.2   MaterialsIndexed P7 Primers for the lentiGuide‐Puro VectorP5 Primers for the lentiGuide‐Puro Vector

Name Sequence (* indicates phosphorothioate backbone modifications)
P7 Primer #1 CAAGCAGAAGACGGCATACGAGATCGGTTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #2 CAAGCAGAAGACGGCATACGAGATGCTGGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #3 CAAGCAGAAGACGGCATACGAGATTAACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #4 CAAGCAGAAGACGGCATACGAGATTAACAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #5 CAAGCAGAAGACGGCATACGAGATATACTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #6 CAAGCAGAAGACGGCATACGAGATGCTGAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #7 CAAGCAGAAGACGGCATACGAGATATTGGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #8 CAAGCAGAAGACGGCATACGAGATTAGTCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #9 CAAGCAGAAGACGGCATACGAGATCGGTGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #10 CAAGCAGAAGACGGCATACGAGATTACAGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #11 CAAGCAGAAGACGGCATACGAGATATTGTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #12 CAAGCAGAAGACGGCATACGAGATTATGTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #13 CAAGCAGAAGACGGCATACGAGATATTGGATTGTGACTGGAGTTCAGACGTGTGCTCTTC CGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #14 CAAGCAGAAGACGGCATACGAGATATACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #15 CAAGCAGAAGACGGCATACGAGATTATGAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #16 CAAGCAGAAGACGGCATACGAGATGCACAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #17 CAAGCAGAAGACGGCATACGAGATCGTGGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #18 CAAGCAGAAGACGGCATACGAGATTAGTAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #19 CAAGCAGAAGACGGCATACGAGATGCACGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #20 CAAGCAGAAGACGGCATACGAGATCGGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #21 CAAGCAGAAGACGGCATACGAGATTAGTTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #22 CAAGCAGAAGACGGCATACGAGATTACAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #23 CAAGCAGAAGACGGCATACGAGATATCACTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #24 CAAGCAGAAGACGGCATACGAGATCGCATCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #25 CAAGCAGAAGACGGCATACGAGATGCACGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #26 CAAGCAGAAGACGGCATACGAGATTACACTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #27 CAAGCAGAAGACGGCATACGAGATCGGTCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #28 CAAGCAGAAGACGGCATACGAGATATGTTCGGGTGACTGGAGTTCAGACGTGTGCTC TTCCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #29 CAAGCAGAAGACGGCATACGAGATCGTGGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #30 CAAGCAGAAGACGGCATACGAGATATTGAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #31 CAAGCAGAAGACGGCATACGAGATTAGTTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #32 CAAGCAGAAGACGGCATACGAGATCGGTGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #33 CAAGCAGAAGACGGCATACGAGATCGTGAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #34 CAAGCAGAAGACGGCATACGAGATATCAGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #35 CAAGCAGAAGACGGCATACGAGATTAGTGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #36 CAAGCAGAAGACGGCATACGAGATCGGTTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #37 CAAGCAGAAGACGGCATACGAGATTATGGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #38 CAAGCAGAAGACGGCATACGAGATGCCAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #39 CAAGCAGAAGACGGCATACGAGATCGCAGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #40 CAAGCAGAAGACGGCATACGAGATCGACCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #41 CAAGCAGAAGACGGCATACGAGATGCCACTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #42 CAAGCAGAAGACGGCATACGAGATGCGTAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #43 CAAGCAGAAGACGGCATACGAGATCGCAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #44 CAAGCAGAAGACGGCATACGAGATCGACAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #45 CAAGCAGAAGACGGCATACGAGATCGCATCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #46 CAAGCAGAAGACGGCATACGAGATATGTTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #47 CAAGCAGAAGACGGCATACGAGATGCGTAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #48 CAAGCAGAAGACGGCATACGAGATATGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #49 CAAGCAGAAGACGGCATACGAGATTAACTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #50 CAAGCAGAAGACGGCATACGAGATCGTGAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #51 CAAGCAGAAGACGGCATACGAGATATCAGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #52 CAAGCAGAAGACGGCATACGAGATTATGGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #53 CAAGCAGAAGACGGCATACGAGATGCGTTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #54 CAAGCAGAAGACGGCATACGAGATCGCAAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #55 CAAGCAGAAGACGGCATACGAGATCGACAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #56 CAAGCAGAAGACGGCATACGAGATCGACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #57 CAAGCAGAAGACGGCATACGAGATTACAAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #58 CAAGCAGAAGACGGCATACGAGATCGCAGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #59 CAAGCAGAAGACGGCATACGAGATATTGCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #60 CAAGCAGAAGACGGCATACGAGATGCACTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #61 CAAGCAGAAGACGGCATACGAGATATGTTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #62 CAAGCAGAAGACGGCATACGAGATATGTCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #63 CAAGCAGAAGACGGCATACGAGATGCACTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #64 CAAGCAGAAGACGGCATACGAGATTAGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #65 CAAGCAGAAGACGGCATACGAGATCGTGTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #66 CAAGCAGAAGACGGCATACGAGATGCGTTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #67 CAAGCAGAAGACGGCATACGAGATGCCAAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #68 CAAGCAGAAGACGGCATACGAGATGCACCTCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #69 CAAGCAGAAGACGGCATACGAGATGCACCTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #70 CAAGCAGAAGACGGCATACGAGATGCCAGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #71 CAAGCAGAAGACGGCATACGAGATCGCAAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #72 CAAGCAGAAGACGGCATACGAGATTACATCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #73 CAAGCAGAAGACGGCATACGAGATGCGTAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #74 CAAGCAGAAGACGGCATACGAGATCGACAGAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #75 CAAGCAGAAGACGGCATACGAGATTAGTCTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #76 CAAGCAGAAGACGGCATACGAGATATCAAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #77 CAAGCAGAAGACGGCATACGAGATTAGTAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #78 CAAGCAGAAGACGGCATACGAGATATACTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #79 CAAGCAGAAGACGGCATACGAGATCGGTAGTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #80 CAAGCAGAAGACGGCATACGAGATATACGAGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #81 CAAGCAGAAGACGGCATACGAGATCGCACTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #82 CAAGCAGAAGACGGCATACGAGATTACAGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #83 CAAGCAGAAGACGGCATACGAGATGCGTGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #84 CAAGCAGAAGACGGCATACGAGATTATGTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #85 CAAGCAGAAGACGGCATACGAGATCGACTCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #86 CAAGCAGAAGACGGCATACGAGATGCGTTCGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #87 CAAGCAGAAGACGGCATACGAGATATACCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #88 CAAGCAGAAGACGGCATACGAGATCGGTGATTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #89 CAAGCAGAAGACGGCATACGAGATTAACGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #90 CAAGCAGAAGACGGCATACGAGATATACAGCCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #91 CAAGCAGAAGACGGCATACGAGATCGACGACCGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #92 CAAGCAGAAGACGGCATACGAGATATCACTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #93 CAAGCAGAAGACGGCATACGAGATCGACCTGGGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #94 CAAGCAGAAGACGGCATACGAGATTATGTCAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #95 CAAGCAGAAGACGGCATACGAGATTAACCTAAGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
P7 Primer #96 CAAGCAGAAGACGGCATACGAGATGCCATCTTGTGACTGGAGTTCAGACGTGTGCTCTT CCGATCTTCTACTATTCTTTCCCCTGCA*C*T*G*T
Name Sequence (* indicates phosphorothioate backbone modifications)
P5 Primer #1 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #2 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #3 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTGCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #4 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTAGCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #5 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTCAACTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #6 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTTGCACCTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #7 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTACGCAACTTGTGGAAAGGACGAAAC*A*C*C*G
P5 Primer #8 AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACG CTCTTCCGATCTGAAGACCCTTGTGGAAAGGACGAAAC*A*C*C*G

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Doench, J. G., Fusi, N., Sullender, M., Hegde, M., Vaimberg, E. W., Donovan, K. F., … Root, D. E. (2016). Optimized sgRNA design to maximize activity and minimize off‐target effects of CRISPR‐Cas9. Nature Biotechnology, 34, 184–191. doi: 10.1038/nbt.3437.
  Graham, D. B., & Root, D. E. (2015). Resources for the design of CRISPR gene editing experiments. Genome Biology, 16, 260. doi: 10.1186/s13059‐015‐0823‐x.
  Hartenian, E., & Doench, J. G. (2015). Genetic screens and functional genomics using CRISPR/Cas9 technology. The FEBS Journal, 282, 1383–1393. doi: 10.1111/febs.13248.
  Joung, J., Konermann, S., Gootenberg, J. S., Abudayyeh, O. O., Platt, R. J., Brigham, M. D., … Zhang, F. (2017). Genome‐scale CRISPR‐Cas9 knockout and transcriptional activation screening. Nature Protocols, 12, 828–863. doi: 10.1038/nprot.2017.016.
  Li, W., Xu, H., Xiao, T., Cong, L., Love, M. I., Zhang, F., … Liu, X. S. (2014). MAGeCK enables robust identification of essential genes from genome‐scale CRISPR/Cas9 knockout screens. Genome Biology, 15, 554. doi: 10.1186/s13059‐014‐0554‐4.
  Luo, B., Cheung, H. W., Subramanian, A., Sharifnia, T., Okamoto, M., Yang, X., … Root, D. E. (2008). Highly parallel identification of essential genes in cancer cells. Proceedings of the National Academy of Sciences of the United States of America, 105, 20380–20385. doi: 10.1073/pnas.0810485105.
  Miles, L. A., Garippa, R. J., & Poirier, J. T. (2016). Design, execution, and analysis of pooled in vitro CRISPR/Cas9 screens. The FEBS Journal, 283, 3170–3180. doi: 10.1111/febs.13770.
  Shema, R., Kulicke, R., Cowley, G. S., Stein, R., Root, D. E., & Heiman, M. (2015). Synthetic lethal screening in the mammalian central nervous system identifies Gpx6 as a modulator of Huntington's disease. Proceedings of the National Academy of Sciences of the United States of America, 112, 268–272. doi: 10.1073/pnas.1417231112.
  Voytas, D. (2001). Agarose gel electrophoresis. Current Protocols in Molecular Biology, 51, 2.5A.1‐2.5A.9. doi: 10.1002/0471142727.mb0205as51.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library