Simultaneous Isolation of Ixodidae and Bacterial (Borrelia spp.) Genomic DNA

Brandon L. Jutras1, Zhiwei Liu2, Catherine A. Brissette1

1 College of Medicine, University of Kentucky, Lexington, Kentucky, 2 Eastern Illinois University, Charleston, Illinois
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 1E.2
DOI:  10.1002/9780471729259.mc01e02s19
Online Posting Date:  November, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Tick and tick‐borne diseases have become widely distributed throughout the United States. As a result, the interest associated with tick allocation and the potential threat they may pose has increased. Efforts have expanded to understand biotic and abiotic factors which may influence tick/pathogen distribution. Thus, we have developed a procedure which allows the simultaneous isolation of both tick and bacterial DNA. Downstream applications are diverse; however, we describe the use of multiplex PCR to confirm the presence of spirochete DNA from tick samples. We suspect that this procedure is not limited to tick‐bacteria systems and may be applied to a variety of arthropod‐related endeavors. Curr. Protoc. Microbiol. 19:1E.2.1‐1E.2.11. © 2010 by John Wiley & Sons, Inc.

Keywords: DNA extraction; DNA purification; arthropod‐borne disease; spirochete

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Simultaneous DNA Extraction and Purification
  • Basic Protocol 2: PCR Amplification of Ixodidae and Borrelia Genes
  • Basic Protocol 3: PCR Reaction for Amblyomma americanum 5.8S and Borrelia lonestari glpQ Amplification
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Simultaneous DNA Extraction and Purification

  Materials
  • Ticks collected from the field or experimentally infected
  • 70% and 95% ethanol
  • Liquid nitrogen (∼1 ml/tick)
  • DNA extraction buffer (see recipe)
  • 40 mg/ml proteinase K
  • Promega Wizard SV Genomic DNA System for animal tissue or Qiagen DNeasy Blood & Tissue purification System for animal tissue
  • Nuclease‐free H 2O (e.g., DEPC‐treated; see appendix 2A) or TE buffer (see recipe in appendix 2A)
  • 5 M NaCl
  • 23° humidified incubator for live ticks (or 70% to 95% ethanol for preservation)
  • 200‐µl pipet tips
  • Bunsen burner
  • Plastic weighing boats
  • Forceps
  • 37°C incubator
  • Heating blocks: 37°, 56°, and 94°C
  • Centrifuge

Basic Protocol 2: PCR Amplification of Ixodidae and Borrelia Genes

  Materials
  • Nuclease‐free H 2O (e.g., DEPC‐treated; see appendix 2A)
  • 10× PCR buffer (see recipe)
  • 2.5 mM dNTPs: dATP, dCTP, dGTP, dTTP
  • Primers for Ixodes/Borrelia multiplex PCR (see Table 1.2.1)
  • rTaq polymerase (Takara Bio. Inc.)
  • DNA template ( protocol 1)
  • Positive control: DNA extracted from a Borrelia sp. grown in culture
  • 10× gel loading dye (Voytas, )
  • Thin‐walled 0.2‐ml PCR tubes
  • Thermal cycler
  • UV light box
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) or polyacrylamide gel electrophoresis (Chory and Pollard, )
    Table 1.0.1   MaterialsOligonucleotide Primers Used for Ixodes scapularis 16S rRNA and Borrelia burgdorferiflaB Gene Amplification by Multiplex PCR

    Iscap16sF a 5′CGGTCTGAACTCAGATCAAG′3
    Iscap16SR a 5′GGGACAAGAAGACCCTATG′3
    Fla‐3 b 5′GGGTCTCAAGCGTCTTGG′3
    Fla‐4 b 5′GAACCGGTGCAGCCTGAG′3

     aFor Ixodes scapularis 16S rRNA.
     bFor Borrelia burgdorferiflaB gene.

Basic Protocol 3: PCR Reaction for Amblyomma americanum 5.8S and Borrelia lonestari glpQ Amplification

  Materials
  • Nuclease‐free H 2O (e.g., DEPC‐treated; see appendix 2A)
  • GoTaq Green Master Mix (Promega, cat. no. M7123)
  • Primers for Amblyomma/Borrelia multiplex PCR (Table 1.2.2)
  • DNA template ( protocol 1)
  • Positive control: DNA extracted from a Borrelia sp. grown in culture
  • 10× gel loading dye (Voytas, )
  • Thin‐walled 0.2‐ml PCR tubes
  • Thermal cycler
  • UV light box
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) or polyacrylamide gel electrophoresis (Chory and Pollard, )
    Table 1.0.2   MaterialsOligonucleotide Primers Used for Amblyomma ITS2 region and Borrelia glpQ Gene Amplification by Multiplex PCR

    FITS2 5′CGGGATCCTTCACTCGCCGTTACT′3
    RITS2 5′CCATCGATGTGAACTGCAGGAC′3
    glpQ F‐5 5′GTGCTAGCGGATACCTCCCAGGACATACT′3
    glpQR‐6 5′GTTGGGGACTCATTCCAGTTATTTTCT CC′3

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Anderson, B.E., Sims, K.G., Olson, J.G., Childs, J.E., Piesman, J.F., Happ, C.M., Maupin, G.O., and Johnson, B.J. 1993. Amblyomma americanum: A potential vector of human ehrlichiosis. Am. J. Trop. Med. Hyg. 49:239–244.
   Bacon, R.M., Pilgard, M.A., Johnson, B.J., Raffel, S.J., and Schwan, T.G. 2004. Glycerophosphodiester phosphodiesterase gene (glpQ) of Borrelia lonestari identified as a target for differentiating Borrelia species associated with hard ticks (Acari:Ixodidae). J. Clin. Microbiol. 42:2326‐2328.
   Bacon, R.M., Pilgard, M.A., Johnson, B.J., Piesman, J., Biggerstaff, B.J., and Quintana, M. 2005. Rapid detection methods and prevalence estimation for Borrelia lonestari glpQ in Amblyomma americanum (Acari: Ixodidae) pools of unequal size. Vector Borne Zoonot. Dis. 5:146‐156.
   Barbour, A. 1998. Fall and rise of Lyme disease and other Ixodes tick‐borne infections in North America and Europe. Br. Med. Bull. 54:647‐658.
   Barbour, A.G., Maupin, G.O., Teltow, G.J., Carter, C.J., and Piesman, J. 1996. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: Possible agent of a Lyme disease–like illness. J. Infect. Dis. 173:403‐409.
   Brownstein, J.S., Holford, T.R., and Fish, D. 2005. Effect of climate change on Lyme disease risk in North America. Ecohealth 2:38‐46.
   Calhoun, E.L. 1954. Natural occurrence of Tularemia in the lone star tick, Amblyomma americanum (Linn.), and in dogs in Arkansas. Am. J. Trop. Med. Hyg. 3:360‐366.
   Childs, J.E. and Paddock, C.D. 2003. The ascendancy of Amblyomma americanum as a vector of pathogens affecting humans in the United States. Ann. Rev. Entomol. 48:307‐337.
   Chory, J. and Pollard, J.D. 1999. Separation of small DNA fragments by conventional gel electrophoresis. Curr. Protoc. Mol. Biol. 47:2.7.1‐2.7.8.
   Cumming, G.S. and Van Vuuren, D.P. 2006. Will climate change affect ectoparasite species ranges? Global Ecol. Biogeogr. 15:486‐497.
   Danielová, V., Kliegrová, S., Daniel, M., and Benes, C. 2008. Influence of climate warming on tickborne encephalitis expansion to higher altitudes over the last decade (1997‐2006) in the Highland Region (Czech Republic). Central Eur. J. Public Health 16:4‐11.
   Fukunaga, M., Sohnaka, M., and Yanagihara, Y. 1993. Analysis of Borrelia species associated with Lyme disease by rRNA gene restriction fragment length polymorphism. J. Gen. Microbiol. 139:1141–1146.
   Kriz, B., Benes, C., Danielová, V., and Daniel, M. 2004. Socio‐economic conditions and other anthropogenic factors influencing tick‐borne encephalitis incidence in the Czech Republic. Int. J. Med. Microbiol. 37:63‐68.
   Liveris, D., Wang, G., Girao, G., Byrne, D.W., Nowakowski, J., McKenna, D., Nadelman, R., Wormser, G.P., and Schwartz, I. 2002. Quantitative detection of Borrelia burgdorferi in 2‐millimeter skin samples of erythema migrans lesions: Correlation of results with clinical and laboratory findings. J. Clin. Microbiol. 40:1249‐1253.
   Masters, E.J., Grigeryb, C.N., and Masters, R.W. 2008. STARI, or Masters disease: Lone star tick‐vectored Lyme‐like illness. Infect. Dis. Clinics N. Am. 22:361‐376.
   Means, R.G. and White D.J. 1997. New distribution records of Amblyomma americanum (L.) (Acari: Ixodidae) in New York State. J. Vector Ecol. 22:133‐145.
   Miller, J.C. 2005. Example of real‐time quantitative reverse transcription–PCR (Q‐RT‐PCR) analysis of bacterial gene expression during mammalian infection: Borrelia burgdorferi in mouse tissues, Curr. Protoc. Microbiol. 00:1D.3.1‐1D.3.28.
   Moore, V.A., Varela, A.S., Yabsley, M.J., Davidson, W.R., and Little, S.E. 2003. Detection of Borrelia lonestari, putative agent of southern tick‐associated rash illness, in white‐tailed deer (Odocoileus virginianus) from the southeastern United States. J. Clin. Microbiol. 41:424‐427.
   Ostfeld, R.S., Canham, C.D., Oggenfuss, K., Winchcombe, R.J., and Keesing, F. 2006. Climate, deer, rodents, and acorns as determinants of variation in Lyme‐disease risk. PLoS‐Biol. 4:1058‐1068.
   Riehle, M. and Paskewitz, S.M. 1996. Ixodes scapularis (Acari:Ixodidae): Status and changes in prevalence and distribution in Wisconsin between 1981 and 1994 measured by deer surveillance. J. Med. Entomol. 33:933‐938.
   Varela, A.S., Luttrell, M.P., Howerth, E.W., Moore, V.A., Davidson, W.R., Stallknecht, D.E., and Little, S.E. 2004. First culture isolation of Borrelia lonestari, putative agent of southern tick‐associated rash illness. J. Clin. Microbiol. 42:1163‐1169.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Walk, S.T., Xu, G., Stull, J.W., and Rich, S.M. 2009. Correlation between tick density and pathogen endemicity, New Hampshire. Emerging Infect. Dis. 15:585‐587.
   Walker, D.H. 1998. Tick‐transmitted infectious diseases in the United States. Ann. Rev. Public Health 19:237‐269.
   White, D.J., Chang, H.G., Benach, J.L., Bosler, E.M., Meldrum, S.C., Means, R.G., Debbie, J.G., Birkhead, G.S., and Morse, D.L. 1991. The geographic spread and temporal increase of the Lyme disease epidemic. J. Amer. Med. Assoc. 266:1230‐1236.
   Zeman, P. and Bene, C. 2004. A tick‐borne encephalitis ceiling in Central Europe has moved upwards during the last 30 years: Possible impact of global warming? Int. J. Med. Microbiol. 37:48‐54.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library