CLIP‐seq to Identify KSHV ORF57‐Binding RNA in Host B Cells

Yanping Ma1, Poching Liu2, Vladimir Majerciak3, Jun Zhu2, Zhi‐Ming Zheng4

1 Virus laboratory, Affiliated Shengjing Hospital of China Medical University, Shenyang, China, 2 Systems Biology Center, Division of Intramural Research, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, Maryland, 3 Tumor Virus RNA Biology Section, Gene Regulation and Chromosome Biology Laboratory, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Frederick, Maryland, 4 Corresponding author
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 1E.11
DOI:  10.1002/cpmc.3
Online Posting Date:  May, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Kaposi's sarcoma‐associated herpesvirus (KSHV), a human gamma‐herpesvirus, is etiologically linked to the development of several malignancies, mainly Kaposi's sarcoma. Expressed as an early viral protein, KSHV ORF57 is essential for lytic replication and virion production. ORF57 selectively binds to a subset of viral RNA and affects nearly all aspects of viral RNA processing. To globally identify all viral and host RNA associated with KSHV ORF57 in the infected cells, we have utilized UV cross‐linking and immunoprecipitation (CLIP) of KSHV ORF57 combined with high‐throughput RNA sequencing (CLIP‐seq) to identify ORF57‐binding RNA in BCBL‐1 cells at genome‐wide level. This unit provides step‐by‐step details on this new method that is applicable for any pathogen or host RNA‐binding proteins by slight modification. © 2016 by John Wiley & Sons, Inc.

Keywords: high throughput sequencing; KSHV; ORF57; RNA; UV cross‐linking

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Covalently Linked Immunoprecipitation (CLIP) Assay to Obtain Kshv ORF57‐Binding RNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Covalently Linked Immunoprecipitation (CLIP) Assay to Obtain Kshv ORF57‐Binding RNA

  Materials
  • BCBL‐1 cells (Renne et al., , NIH AIDS Reagent program, cat. no. 3233)
  • Complete RPMI 1640 medium
  • Trypan Blue Solution, 0.4% (Thermo Fisher Scientific, cat. no. 15250‐061)
  • 100mM sodium salt of valproic acid (VA) (Sigma, cat. no. P4543)
  • Phosphate‐buffered saline (PBS; Thermo Fisher Scientific, cat. no. 10010‐0023)
  • Ice
  • RIPA buffer (50 mM Tris·Cl, pH 7.4, 150 mM NaCl, 1% NP‐40, 0.5% sodium deoxycholate, and 0.1% SDS; Boston BioProducts, cat. no. BP‐115)
  • Complete EDTA‐free mini protease inhibitor cocktail tablets (Roche, cat. no. 04 693 159 001): The 10× solution is prepared by dissolving 1 tablet in 1 ml of DEPC‐treated water; the tablet could be also directly dissolved in 10 ml lysis buffer
  • Protein A beads (EMD Millipore, cat. no. 16‐125)
  • IP buffer (see recipe)
  • A custom polyclonal anti‐ORF57 antibody prepared by rabbit immunization with KLH‐linked synthetic peptide corresponding to aa 119‐132 of ORF57 protein and followed by on‐column affinity purification (Majerciak et al., ; Kang et al., , ) is used for this protocol, together with rabbit IgG isotype (Thermo Fisher Scientific, cat. no. 02‐6102) used in parallel as an antibody negative control
  • RNase A/T1 mix (2 mg/ml of RNase A and 5000 U/ml of RNase T1, Thermo Fisher Scientific, cat. no. EN0551)
  • Recombinant Shrimp Alkaline Phosphatase (rSAP; 1000 U/ml, New England Biolabs, cat. no. M0371S)
  • Proteinase K buffer (1× IP buffer supplemented with 1% SDS)
  • Proteinase K (600 mAU/ml, EMD Millipore, cat. no. 71049)
  • UltraPure 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol (Thermo Fisher Scientific, cat. no. 15593‐031)
  • 3 M sodium acetate, pH 5.2 (Quality Biological, cat. no. 351‐035‐721EA)
  • GlycoBlue Coprecipitant (15 mg/ml; Ambion, cat. no. AM9516)
  • 100% (v/v) ethanol
  • 70% to 75% (v/v) ethanol
  • DEPC‐treated ultrapure water (K.D Medical, cat. no. RGF‐3050)
  • Agilent RNA 6000 Pico Kit (Agilent Technologies, cat. no. 5067‐1513)
  • Universal miRNA Cloning Linker (New England BioLabs, cat. no. S1315S)
  • T4 RNA Ligase 2, truncated KQ (200,000 U/ml; New England Biolabs, cat. no. M0373L) containing:
  • T4 RNA ligase buffer
  • 50% PEG8000
  • RNaseOUT (Thermo Fisher Scientific, cat. no. 10777‐019)
  • Agencourt RNAClean beads (Beckman Coulter, cat. no. A29168)
  • RNase‐free water
  • Reverse transcription primer (IDT custom synthesis):
  • [5′‐(Phos)‐AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTC GGTGGTCGC‐(SpC18)‐CACTCA‐(SpC18)‐TTCAGACGTGTGCTCTTCC GATCTATTGATGGTGCCTACAG‐3′]
  • 5× first‐strand buffer (Thermo Fisher Scientific)
  • SuperScript III First‐Strand Synthesis System (Thermo Fisher Scientific, cat. no. 18080‐051) containing:
  • dNTP mix
  • 0.1 M DTT
  • RNaseOUT
  • SuperScript III
  • 1 N NaOH
  • Agencourt AMPure XP ‐ PCR Purification beads (Beckman Coulter, cat. no. A63880)
  • CircLigase ssDNA ligase (Epicentre, cat. no. CL4111K) containing:
  • ATP
  • MnCl 2
  • 5 M NaCl
  • Isopropanol (Sigma‐Aldrich, cat. no. I9516)
  • Phusion DNA polymerase kit (New England BioLabs, cat. no. M0530S)
  • riboPCR_F primer (5′‐AATGATACGGCGACCACCGAGATCTACAC‐3′, IDT custom synthesis)
  • Indexed primers:
  • (5′‐CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGA‐CGTGTGCTC TTCCG‐3′) (‘NNNNNN’ denotes the index, of which each index has a unique sequence. Index 1 = CGTGAT; index 2 = ACATCG; index 3 = GCCTAA; IDT custom synthesis)
  • E‐Gel EX Agarose Gels, 2% (Thermo Fisher Scientific, cat. no. G4020‐02)
  • DNA Clean & Concentrator‐5 Kit (Zymo Research, cat. no. D4003)
  • Novex TBE Gels, 10%, 12 well (Thermo Fisher Scientific, cat. no. EC62752BOX)
  • 6× DNA loading buffer (Thermo Fisher Scientific, cat. no. R0611)
  • TrackIt 10‐bp DNA Ladder (Thermo Fisher Scientific, cat. no. 10488‐019)
  • SYBR Gold Nucleic Acid Gel Stain (10,000 × Concentrate in DMSO; Thermo Fisher Scientific, cat. no. S‐11494)
  • Gel elution buffer (0.3 M sodium acetate, pH 5.2, 0.1% SDS)
  • DNase‐free water
  • Hyb buffer (5× SSC + 0.05% Tween‐20)
  • 5× SSC (0.75 M NaCl, 0.075 M sodium citrate, Denhardts solution [0.1% Ficoll, 0.1% polyvinylpyrrolidone, 0.l% BSA])
  • TRIzol reagent (Life Technologies, cat. no. 15596‐026)
  • Vented 175‐cm2 tissue culture flasks (Sarstedt, cat. no. 83.3912.002)
  • Herracell CO 2 incubator (Thermo Fisher Scientific)
  • Conical 15‐ml polypropylene centrifuge tubes (Sarstedt, cat. no. 62.554.002)
  • Universal 320R centrifuge (Hettich)
  • 100‐mm tissue culture dishes (Sarstedt, cat. no. 83.3902)
  • UV Cross‐linker (VWR)
  • Nuclease‐free 1.7‐ml microcentrifuge tubes (GeneMates, cat. no. C‐3262‐1)
  • Sonic Dismembrator (Model 100, Thermo Fisher Scientific)
  • Microcentrifuge 5424R (Eppendorf)
  • Thermomixer R (Eppendorf)
  • VortexGenie2 (Scientific Industries)
  • Phase Lock Gel Light, 1.5‐ml tubes (VWR, cat. no. 10052‐164)
  • Agilent Bioanalyzer 2100 (Agilent Technologies)
  • Magnetic stand (MPC‐S, Thermo Fisher Scientific)
  • Veriti 96‐Well Thermal Cycler (Thermo Fisher Scientific)
  • Razor blades
  • Costar Spin‐X Centrifuge Tube Filters (Cole‐Parmer, cat. no. WU‐01937‐38)
  • Qubit Fluorometer (Thermo Fisher Scientific)
  • MiSeq and HiSeq 2500 Ultra‐High‐Throughput Sequencing Systems (Illumina)
  • IX70 inverted phase‐contrast microscope (Olympus)
  • Additional reagents and equipment for trypan blue exclusion (Stevenson, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Arvanitakis, L., Mesri, E.A., Nador, R.G., Said, J.W., Asch, A.S., Knowles, D.M., and Cesarman, E. 1996. Establishment and characterization of a primary effusion (body cavity‐based) lymphoma cell line (BC‐3) harboring kaposi's sarcoma‐associated herpesvirus (KSHV/HHV‐8) in the absence of Epstein‐Barr virus. Blood 88:2648‐2654.
  Bello, L.J., Davison, A.J., Glenn, M.A., Whitehouse, A., Rethmeier, N., Schulz, T.F., and Barklie, C.J. 1999. The human herpesvirus‐8 ORF 57 gene and its properties. J. Gen. Virol. 80:3207‐3215. doi: 10.1099/0022‐1317‐80‐12‐3207.
  Boyne, J.R., Jackson, B.R., Taylor, A., Macnab, S.A., and Whitehouse, A. 2010. Kaposi's sarcoma‐associated herpesvirus ORF57 protein interacts with PYM to enhance translation of viral intronless mRNAs. EMBO J. 29:1851‐1864. doi: 10.1038/emboj.2010.77.
  Cannon, J.S., Ciufo, D., Hawkins, A.L., Griffin, C.A., Borowitz, M.J., Hayward, G.S., and Ambinder, R.F. 2000. A new primary effusion lymphoma‐derived cell line yields a highly infectious Kaposi's sarcoma herpesvirus‐containing supernatant. J. Virol. 74:10187‐10193. doi: 10.1128/JVI.74.21.10187‐10193.2000.
  Cesarman, E., Chang, Y., Moore, P.S., Said, J.W., and Knowles, D.M. 1995a. Kaposi's sarcoma‐associated herpesvirus‐like DNA sequences in AIDS‐related body‐cavity‐based lymphomas. N. Engl. J. Med. 332:1186‐1191. doi: 10.1056/NEJM199505043321802.
  Cesarman, E., Moore, P.S., Rao, P.H., Inghirami, G., Knowles, D.M., and Chang, Y. 1995b. In vitro establishment and characterization of two acquired immunodeficiency syndrome‐related lymphoma cell lines (BC‐1 and BC‐2) containing Kaposi's sarcoma‐associated herpesvirus‐like (KSHV) DNA sequences. Blood 86:2708‐2714.
  Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., and Moore, P.S. 1994b. Identification of herpesvirus‐like DNA sequences in AIDS‐associated Kaposi's sarcoma. Science 266:1865‐1869. doi: 10.1126/science.7997879.
  Darnell, R.B. 2010. HITS‐CLIP: Panoramic views of protein‐RNA regulation in living cells. Wiley. Interdiscip. Rev. RNA 1:266‐286. doi: 10.1002/wrna.31.
  Dupin, N., Diss, T.L., Kellam, P., Tulliez, M., Du, M.Q., Sicard, D., Weiss, R.A., Isaacson, P.G., and Boshoff, C. 2000. HHV‐8 is associated with a plasmablastic variant of Castleman disease that is linked to HHV‐8‐positive plasmablastic lymphoma. Blood 95:1406‐1412.
  Gerstberger, S., Hafner, M., and Tuschl, T. 2014. A census of human RNA‐binding proteins. Nat. Rev. Genet. 15:829‐845. doi: 10.1038/nrg3813.
  Hafner, M., Landthaler, M., Burger, L., Khorshid, M., Hausser, J., Berninger, P., Rothballer, A., Ascano, M., Jr., Jungkamp, A.C., Munschauer, M., Ulrich, A., Wardle, G.S., Dewell, S., Zavolan, M., and Tuschl, T. 2010. Transcriptome‐wide identification of RNA‐binding protein and microRNA target sites by PAR‐CLIP. Cell 141:129‐141. doi: 10.1016/j.cell.2010.03.009.
  Jensen, K.B. and Darnell, R.B. 2008. CLIP: Crosslinking and immunoprecipitation of in vivo RNA targets of RNA‐binding proteins. Methods Mol. Biol. 488:85‐98. doi: 10.1007/978‐1‐60327‐475‐3_6.
  Kang, J.G., Pripuzova, N., Majerciak, V., Kruhlak, M., Le, S.Y., and Zheng, Z.M. 2011b. Kaposi's sarcoma‐associated herpesvirus ORF57 promotes escape of viral and human Interleukin‐6 from MicroRNA‐mediated suppression. J. Virol. 85:2620‐2630. doi: 10.1128/JVI.02144‐10.
  Kang, J.G., Majerciak, V., Uldrick, T.S., Wang, X., Kruhlak, M., Yarchoan, R., and Zheng, Z.M. 2011a. Kaposi's sarcoma‐associated herpesviral IL‐6 and human IL‐6 open reading frames contain miRNA binding sites and are subject to cellular miRNA regulation. J. Pathol. 225:378‐389. doi: 10.1002/path.2962.
  Li, H. and Durbin, R. 2009. Fast and accurate short read alignment with Burrows‐Wheeler transform. Bioinformatics 25:1754‐1760. doi: 10.1093/bioinformatics/btp324.
  Li, D.J., Verma, D., and Swaminathan, S. 2012. Binding of cellular export factor REF/Aly by Kaposi's sarcoma‐associated herpesvirus (KSHV) ORF57 protein is not required for efficient KSHV lytic replication. J. Virol. 86:9866‐9874. doi: 10.1128/JVI.01190‐12.
  Majerciak, V. and Zheng, Z.M. 2009. Kaposi's sarcoma‐associated herpesvirus ORF57 in viral RNA processing. Front. Biosci. 14:1516‐1528. doi: 10.2741/3322.
  Majerciak, V. and Zheng, Z.M. 2015. KSHV ORF57, a protein of many faces. Viruses 7:604‐633. doi: 10.3390/v7020604.
  Majerciak, V., Yamanegi, K., Nie, S.H., and Zheng, Z.M. 2006. Structural and functional analyses of Kaposi sarcoma‐associated herpesvirus ORF57 nuclear localization signals in living cells. J. Biol. Chem. 281:28365‐28378. doi: 10.1074/jbc.M603095200.
  Majerciak, V., Lu, M., Li, X., and Zheng, Z.M. 2014. Attenuation of the suppressive activity of cellular splicing factor SRSF3 by Kaposi sarcoma‐associated herpesvirus ORF57 protein is required for RNA splicing. RNA 20:1747‐1758. doi: 10.1261/rna.045500.114.
  Majerciak, V., Yamanegi, K., Allemand, E., Kruhlak, M., Krainer, A.R., and Zheng, Z.M. 2008. Kaposi's sarcoma‐associated herpesvirus ORF57 functions as a viral splicing factor and promotes expression of intron‐containing viral lytic genes in spliceosome‐mediated RNA splicing. J. Virol. 82:2792‐2801. doi: 10.1128/JVI.01856‐07.
  Majerciak, V., Uranishi, H., Kruhlak, M., Pilkington, G.R., Massimelli, M.J., Bear, J., Pavlakis, G.N., Felber, B.K., and Zheng, Z.M. 2011. Kaposi's sarcoma‐associated herpesvirus ORF57 interacts with cellular RNA export cofactors RBM15 and OTT3 to promote expression of viral ORF59. J. Virol. 85:1528‐1540. doi: 10.1128/JVI.01709‐10.
  Massimelli, M.J., Majerciak, V., Kruhlak, M., and Zheng, Z.M. 2013. Interplay between polyadenylate‐binding protein 1 and Kaposi's sarcoma‐associated herpesvirus ORF57 in accumulation of polyadenylated nuclear RNA, a viral long noncoding RNA. J. Virol. 87:243‐256. doi: 10.1128/JVI.01693‐12.
  Massimelli, M.J., Kang, J.G., Majerciak, V., Le, S.Y., Liewehr, D.J., Steinberg, S.M., and Zheng, Z.M. 2011. Stability of a long noncoding viral RNA depends on a 9‐nt core element at the RNA 5′ end to interact with viral ORF57 and cellular PABPC1. Int. J. Biol. Sci. 7:1145‐1160. doi: 10.7150/ijbs.7.1145.
  Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S.L., and Jung, J.U. 2003. Global changes in Kaposi's sarcoma‐associated virus gene expression patterns following expression of a tetracycline‐inducible Rta transactivator. J. Virol. 77:4205‐4220. doi: 10.1128/JVI.77.7.4205‐4220.2003.
  Nekorchuk, M., Han, Z., Hsieh, T.T., and Swaminathan, S. 2007. Kaposi's sarcoma‐associated herpesvirus ORF57 Protein enhances mRNA accumulation independently of effects on nuclear RNA. Export J. Virol. 81:9990‐9998. doi: 10.1128/JVI.00896‐07.
  Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D., and Ganem, D. 1996. Lytic growth of Kaposi's sarcoma‐associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342‐346. doi: 10.1038/nm0396‐342.
  Sahin, B.B., Patel, D., and Conrad, N.K. 2010. Kaposi's sarcoma‐associated herpesvirus ORF57 protein binds and protects a nuclear noncoding RNA from cellular RNA decay pathways. PLoS Pathog. 6:e1000799. doi: 10.1371/journal.ppat.1000799.
  Sei, E. and Conrad, N.K. 2011. Delineation of a core RNA element required for Kaposi's sarcoma‐associated herpesvirus ORF57 binding and activity. Virology 419:107‐116. doi: 10.1016/j.virol.2011.08.006.
  Stevenson, B. 2006. Common bacterial culture techniques and media. Curr. Protoc. Microbio. 00:4 A:A.4 A.1‐A.4 A.8.
  Tunnicliffe, R.B., Hautbergue, G.M., Wilson, S.A., Kalra, P., and Golovanov, A.P. 2014. Competitive and cooperative interactions mediate RNA transfer from herpesvirus saimiri ORF57 to the mammalian export adaptor ALYREF. PLoS Pathog. 10:e1003907. doi: 10.1371/journal.ppat.1003907.
  Ule, J., Jensen, K.B., Ruggiu, M., Mele, A., Ule, A., and Darnell, R.B. 2003. CLIP identifies Nova‐regulated RNA networks in the brain. Science 302:1212‐1215. doi: 10.1126/science.1090095.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library