Isolation and Molecular Detection of Ehrlichia from Vertebrate Animals

Chuanmin Cheng1, Kamesh R. Sirigireddy1, Roman R. Ganta1

1 Department of Diagnostic Medicine/Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, Kansas
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 3A.3
DOI:  10.1002/9780471729259.mc03a03s9
Online Posting Date:  May, 2008
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Human monocytic ehrlichiosis (HME), caused by Ehrlichia chaffeensis, was first recognized in 1986. Infection with this pathogen can be fatal in immune compromised and elderly humans. E. chaffeensis can also infect dogs and several wild animals. The clinical symptoms of HME include fever, headache, malaise, myalgia, confusion, rash, lymphadenopathy, and nausea. White-tailed deer serve as the major reservoir host for the natural maintenance of E. chaffeensis. E. canis is primarily responsible for the canine monocytic ehrlichiosis and is endemic throughout the world. It has a significant impact on the health of dogs. The isolation and growth of Ehrlichia species from vertebrate host samples is difficult and time consuming. In this unit, methods to recover E. chaffeensis and E. canis from infected blood samples collected from dogs, deer, and human patients are described. PCR and RT-PCR methods for sensitive detection of Ehrlichia infection are also discussed. Curr. Protoc. Microbiol. 9:3A.3.1-3A.3.16. © 2008 by John Wiley & Sons, Inc.

Keywords: Ehrlichia isolation; animal blood; PCR; RT-PCR; real-time RT-PCR; DNA isolation; RNA isolation

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Isolation and Cultivation of E. chaffeensis from Human Blood Samples
  • Basic Protocol 2: Isolation and Cultivation of E. chaffeensis from Deer Blood Samples
  • Basic Protocol 3: Culture Isolation of E. chaffeensis or E. canis from Canine Blood
  • Basic Protocol 4: Recovery of Ehrlichia from Experimentally Infected Mouse Peritoneal Cells
  • Basic Protocol 5: Detect for the Presence of Ehrlichia by PCR
  • Support Protocol 1: Ehrlichia DNA Isolation by SDS/Proteinase K Method
  • Basic Protocol 6: RT-PCR Assay for Detection of Ehrlichia
  • Basic Protocol 7: Triplex Real-Time RT-PCR for Quantitation of Ehrlichia
  • Support Protocol 2: Ehrlichia RNA Isolation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation and Cultivation of E. chaffeensis from Human Blood Samples

 Materials
  • Human blood sample in sterile blood collection tube containing EDTA
  • Hanks’ balanced salt solution (HBSS; without CaCl2, MgCl2, MgSO4, or phenol red; appendix 2A)
  • Histopaque-1083 (Sigma-Aldrich)
  • Complete MEM medium (see recipe)
  • DH82 monolayer (~60% confluent) in a 25-cm2 tissue culture flask (unit 3A.1)
  • 15- and 50-ml centrifuge tubes
  • Pasteur pipets
  • 37°C, 5% CO2 incubator
  • Additional reagents and equipment for DH82 monolayer culture and Cytospin slide preparation (unit 3A.1)

Basic Protocol 2: Isolation and Cultivation of E. chaffeensis from Deer Blood Samples

 Materials
  • Heparinized deer blood samples infected with Ehrlichia chaffeensis
  • ACE lysing solution (see recipe)
  • Complete MEM medium (see recipe)
  • DH82 cells (~60% confluent) in 25-cm2 tissue culture flask (unit 3A.1)
  • 50-ml tubes
  • 37°C, 5% CO2 incubator
  • Additional reagents and equipment for DH82 monolayer culture and Cytospin slide preparation (unit 3A.1)

Basic Protocol 3: Culture Isolation of E. chaffeensis or E. canis from Canine Blood

 Materials
  • Ehrlichia-infected dog blood in a sterile blood collection tube containing EDTA
  • Serofuge centrifuge (Becton Dickinson)
  • 37°C, 5% CO2 incubator
  • Additional reagents and equipment for DH82 monolayer culture and Cytospin slide preparation (unit 3A.1)

Basic Protocol 4: Recovery of Ehrlichia from Experimentally Infected Mouse Peritoneal Cells

 Materials
  • E. chaffeensis-infected mice
  • Sterile PBS (see recipe), ice cold
  • 24-well sterile culture plates
  • 37°C, 5% CO2 incubator
  • Additional reagents and equipment for DH82 monolayer culture and Cytospin slide preparation (unit 3A.1)

Basic Protocol 5: Detect for the Presence of Ehrlichia by PCR

 Materials
  • PCR kit (Invitrogen cat. no. 10966-034) containing:
    • Platinum Taq DNA polymerase
    • 10× PCR buffer
    • 50 mM MgCl2
  • PCR/RT-PCR primers for E. chaffeensis and E. canis (Table 3A.3.1)
  • 10 mM dNTPs
  • Nuclease-free water
  • DNA template
  • 1% agarose gel containing 0.1 µg/ml ethidium bromide
  • 1-kb plus DNA ladder (or any other comparable molecular weight DNA standards)
  • 0.2-ml thin-walled PCR/RT-PCR tubes
  • GenAmp9700 PCR thermal cycler (Applied Biosystems)
     
    Table 3A.3.1 Primers and Probes Used in PCR/RT-PCR and Multiplex Ehrlichia Real-Time RT-PCR
    Primers and probesSequence
    Primers for PCR/RT-PCR 
    E. chaffeensis-forward primer5¢gcatacttggttataaata
    E. chaffeensis-reverse primer5¢gtattaccgcggctgctggcac
    E. canis-forward primer5¢cctctggctataggaaattg
    E. canis-reverse primer5¢gtattaccgcggctgctggcac
    Primers and TaqMan probes 
    Ehrlichia-common forward primer5¢ctcagaacgaacgctgg
    Ehrlichia-common reverse primer5¢catttctaatggctattcc
    E. chaffeensis TaqMan probe5¢TET/cttataaccttttggttataaataatgttag/TAMRA
    E. canis TaqMan probe5¢FAM/tatagcctctggctataggaaattgttag/TAMRA
    E. ewingii TaqMan probe5¢ROX/ctaaatagtctctgactatttagatagttgttag/BQH2

Support Protocol 1: Ehrlichia DNA Isolation by SDS/Proteinase K Method

 Materials
  • ACE lysing solution (see recipe)
  • Whole blood
  • DNA extraction buffer (see recipe)
  • 20 mg/ml proteinase K in 50 mM Tris·Cl, pH 7.5
  • Phenol, pH 8.0
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 70% and 100% ethanol, ice cold
  • TE buffer (see recipe)
  • 1.7-ml microcentrifuge tubes
  • Table top high-speed microcentrifuge
  • 65°C water bath

Basic Protocol 6: RT-PCR Assay for Detection of Ehrlichia

 Materials
  • SuperScript III, one-step RT-PCR system with Platinum Taq DNA polymerase and 2× buffer (Invitrogen cat. no. 11732-020)
  • PCR/RT-PCR primers for E. chaffeensis and E. canis (Table 3A.3.1)
  • RNAsin (RNase inhibitor; Promega cat. no. N2515)
  • Nuclease-free water
  • RNA template
  • 1.5% agarose gel containing 0.1 µg/ml ethidium bromide (Voytas, 2000)
  • 1-kb plus DNA ladder (or any other comparable molecular weight DNA standards)
  • 0.2-ml thin-walled PCR/RT-PCR tubes
  • GenAmp9700 PCR thermal cycler (Applied Biosystems)

Basic Protocol 7: Triplex Real-Time RT-PCR for Quantitation of Ehrlichia

 Materials
  • SuperScript III, one step RT-PCR system with Platinum Taq DNA polymerase and 2× buffer (Invitrogen cat. no. 11732-020)
  • 10 mM dNTPs
  • Real-time RT-PCR primers and TaqMan probes for E. chaffeensis, E. canis, and E. ewingii (Table 3A.3.1)
  • Nuclease-free water
  • RNA (see Support Protocol 2)
  • 1.7-ml microcentrifuge tubes
  • PCR tubes for Smart Cycler (Cepheid cat. no. 11-400-3)
  • Smart Cycler real-time PRC machine (Cepheid)

Support Protocol 2: Ehrlichia RNA Isolation

 Materials
  • Ehrlichia-infected blood, tissue samples, or culture organisms
  • Tri-reagent and Tri-reagent BD (Sigma-Aldrich) or similar reagents (available from other manufacturers)
  • TE buffer (see recipe) or nuclease-free water
  • RNAsin (RNase inhibitor; Promega cat. no. N2515)
  • 1.7-ml microcentrifuge tubes
  • Table-top high-speed microcentrifuge
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •  FigureFigure 3A.3.1 Schematic drawing of the different layers of blood sample before and after centrifugation with Histopaque-1083.
    View Image
  •  FigureFigure 3A.3.2 PCR product analysis of E. chaffeensis and E. canis. Lanes 1 and 3 have the PCR products in the reactions containing E. chaffeensis-specific PCR primers with and without the templates, respectively. Similarly, lanes 2 and 4 included PCR products with E. canis primers with and without the DNA template, respectively. A molecular weight marker (1-kb plus DNA ladder from Promega) is included in lane M. Predicted molecular sizes for the PCR products of E. chaffeensis and E. canis are 0.44 and 0.42 kb, respectively.
    View Image
  •  FigureFigure 3A.3.3 Real-time data generated for Ehrlichia triplex real-time RT-PCR using a Smart Cycler system is presented. Equal molar concentrations of in vitro–synthesized templates of E. chaffeensis, E. canis, and E. ewingii are used to demonstrate the detection by real-time assay (Sirigireddy and Ganta, 2005). Negative controls contained all components of a real-time RT-PCR mixture with the exception of the templates (template volume replaced with water). The Ct values generated by the Smart Cycler are presented as a table format generated by the machine.
    View Image

Videos

Literature Cited

Literature Cited
    Breitschwerdt, E.B., Hegarty, B.C., and Hancock, S.I. 1998. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J Clin. Microbiol. 36: 2645-2651.
    Buhles, W.C., Huxsoll, D.L., and Ristic, M. 1974. Tropical canine pancytopenia: Clinical, hematologic, and serologic response of dogs to Ehrlichia canis infection, tetracycline therapy, and challenge inoculation. J. Infect. Dis. 130: 357-367.
    Caspersen, K., Park, J.H., Patil, S., and Dumler, J.S. 2002. Genetic variability and stability of Anaplasma phagocytophila msp2 (p44). Infect. Immun. 70: 1230-1234.
    Chen, S.M., Dumler, J.S., Bakken, J.S., and Walker, D.H. 1994. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 32: 589-595.
    Cheng, C., Paddock, C.D., and Ganta, R.R. 2003. Molecular heterogeneity of Ehrlichia chaffeensis isolates determined by sequence analysis of the 28-kilodalton outer membrane protein genes and other regions of the genome. Infect. Immun. 71: 187-195.
    Dawson, J.E., Anderson, B.E., Fishbein, D.B., Sanchez, C.Y., Goldsmith, C.Y., Wilson, K.H., and Duntley, C.W. 1991a. Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis. J. Clin. Microbiol. 29: 2741-2745.
    Dawson, J.E., Rikihisa, Y., Ewing, S.A., and Fishbein, D.B. 1991b. Serologic diagnosis of human Ehrlichiosis using two Ehrlichia canis isolates. J. Infect. Dis. 163: 564-567.
    Dawson, J.E., Stallknecht, D.E., Howerth, E.W., Warner, C., Biggie, K., Davidson, W.R., Lockhart, J.M., Nettles, V.F., Olson, J.G., and Childs, J.E. 1994. Susceptibility of white-tailed deer (Odocoileus virginanus) to infection with Ehrlichia chaffeensis, the etiologic agent of human ehrlichiosis. J. Clin. Microbiol. 32: 2725-2728.
    Dawson, J.E., Biggie, K.L., Warner, C.K., Cookson, K., Jenkins, S., Levine, J.F., and Olson, J.G. 1996. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human ehrlichiosis, in dogs from south-east Virginia. Am. J. Vet. Res. 57: 1175-1179.
    De Silva, A.M., Telford, S.R., Brunet, L.R., Barthold, S.W., and Fikrig, E. 1996. Borrelia burgdorferi OspA is an arthropod-specific transmission-blocking Lyme disease vaccine. J. Exp. Med. 183: 271-275.
    Dumler, J.S., Barbet, A.F., Bekker, C.P., Dasch, G.A., Palmer, G.H., Ray, S.C., Rikihisa, Y., and Rurangirwa, F.R. 2001. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: Unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia, and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 51: 2145-2165.
    Dumler, J.S., Madigan, J.E., Pusterla, N., and Bakken, J.S. 2007. Ehrlichiosis in humans: Epidemiology, clinical presentation, diagnosis, and treatment. Clin. Infect. Dis. 15: S45-S51.
    Felek, S., Unver, A., Stich, R.W., and Rikihisa, Y. 2001. Sensitive detection of Ehrlichia chaffeensis in cell culture, blood, and tick specimens by reverse transcription-PCR. J. Clin. Microbiol. 39: 460-463.
    Ganta, R.R., Wilkerson, M.J., Cheng, C., Rokey, A.M., and Chapes, S.K. 2002. Persistent Ehrlichia chaffeensis infection occurs in the absence of functional major histocompatibility complex class II genes. Infect. Immun. 70: 380-388.
    Ganta, R.R., Cheng, C., Wilkerson, M.J., and Chapes, S.K. 2004. Delayed clearance of Ehrlichia chaffeensis infection in CD4+ T-cell knockout mice. Infect. Immun. 72: 159-167.
    Ganta, R.R., Cheng, C., Miller, E.C., McGuire, B.L., Peddireddi, L., Sirigireddy, K.R., and Chapes, S.K. 2007. Differential clearance and immune responses to tick cell–derived versus macrophage culture–derived Ehrlichia chaffeensis in mice. Infect. Immun. 75: 135-145.
    Haas, R. and Meyer, T.F. 1986. The repertoire of silent Pilus genes in Neisseria gonorrhoeae: Evidence for gene conversion. Cell 44: 107-115.
    Lockhart, J.M., Davidson, W.R., Stallknecht, D.E., Dawson, J.E., and Howerth, E.W. 1997. Isolation of Ehrlichia chaffeensis from wild white-tailed deer (Odocoileus virginianus) confirms their role as natural reservoir hosts. J. Clin. Microbiol. 35: 1681-1686.
    Lovering, S.L., Pierce, K.R., and Adams. L.G. 1980. Serum complement and blood platelet adhesiveness in acute canine ehrlichiosis. Am J. Vet. Res. 41: 1266-1271.
    Magnarelli, L.A., Anderson, J.F., Stafford, K.C. III, and Dumler, J.S. 1997. Antibodies to multiple tick-borne pathogens of babesiosis, ehrlichiosis, and lyme borreliosis in white-footed mice. J. Wildl. Dis. 33: 466-473.
    Murphy, G.L., Ewing, S.A., Whitworth, L.C., Fox, J.C., and Kocan, A.A. 1998. A molecular and serologic survey of Ehrlichia canis, E. chaffeensis, and E. ewingii in dogs and ticks from Oklahoma. Vet. Parasitol. 79: 325-339.
    Paddock, C.D. and Childs, J.E. 2003. Ehrlichia chaffeensis: A prototypical emerging pathogen. Clin. Microbiol. Rev. 16: 37-64.
    Paddock, C.D., Suchard, D.P., Grumbach, K.L., Hadley, W.K., Kerschmann, R.L., Abbey, N.W., Dawson, J.E., Anderson, B.E., Sims, K.G., Dumler, J.S., and Herndier, B.G. 1993. Brief report: Fatal seronegative ehrlichiosis in a patient with HIV infection. N. Engl. J. Med. 329: 1164-1167.
    Paddock, C.D., Sumner, J.W., Shore, G.M., Bartley, D.C., Elie, R.C., McQuade, J.G., Martin, C.R., Goldsmith, C.S., and Childs, J.E. 1997. Isolation and characterization of Ehrlichia chaffeensis strains from patients with fatal ehrlichiosis. J. Clin. Microbiol. 35: 2496-2502.
    Pollard, J., Bell, S.D., and Ellington, A.D. 2000. Design, synthesis, and amplification of DNA pools for construction of combinatorial pools and libraries. Curr. Protoc. Mol. Bio. 52: 24.2.1-24.2.24.
    Rikihisa, Y. 1999. Clinical and biological aspects of infection caused by Ehrlichia chaffeensis. Microbes infect. 1: 367-376.
    Sambrook, J. and Russell, D.W. 2001. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
    Sirigireddy, K.R. and Ganta, R.R. 2005. Multiplex detection of Ehrlichia and anaplasma species pathogens in peripheral blood by real-time reverse transcriptase-polymerase chain reaction. J. Mol. Diagn. 7: 308-316.
    Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51: 2.5A.1-2.5A.9.
    Winslow, G.M., Yager, E., Shilo, K., Collins, D.N., and Chu, F.K. 1998. Infection of the laboratory mouse with the intracellular pathogen Ehrlichia chaffeensis. Infect. Immun. 66: 3892-3899.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library