Isolation and Cultivation of Agrobacterium Species from Natural Sources

Elise Rebecca Morton1, Clay Fuqua1

1 Department of Biology, Indiana University, Bloomington, Indiana
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 3D.4
DOI:  10.1002/9780471729259.mc03d04s27
Online Posting Date:  November, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Selected species of the genus Agrobacterium have been extensively studied in the laboratory, but far less is known regarding their natural distribution. Agrobacterium can be isolated from a variety of environments, but identifying the bacteria is challenging and involves physiological assays as well as molecular diagnostics. Curr. Protoc. Microbiol. 27:3D.4.1‐3D.4.11. © 2012 by John Wiley & Sons, Inc.

Keywords: Agrobacterium; natural isolate; physiology; molecular diagnostics

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Isolation of Agrobacterium from Soil
  • Basic Protocol 2: Isolation of Agrobacterium from Crown Galls
  • Basic Protocol 3: Biovar 1 Test for 3‐Ketolactose Production
  • Basic Protocol 4: Biovar 1 Ferric Ammonium Citrate Test
  • Basic Protocol 5: Biovar 2 Acid Clearing Test
  • Basic Protocol 6: Biovar 3 Test for Pectate Degradation
  • Basic Protocol 7: Strain Determination by Diagnostic Sequencing
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation of Agrobacterium from Soil

  Materials
  • Soil sample
  • 1× AT buffer (unit 3.1)
  • Medium 1A, Medium 2E, or Roy and Sasser medium agar plates (for selection of biovar 1, biovar 2, or biovar 3 strains, respectively; see reciperecipes)
  • Agrobacterium strains
  • 1.5‐ml microcentrifuge tubes
  • Scale
  • Vortex
  • 28°C incubator

Basic Protocol 2: Isolation of Agrobacterium from Crown Galls

  Materials
  • 20% bleach (any commercial brand, diluted in water)
  • 1× AT buffer
  • Scale
  • Sterile mortar and pestle
  • 1.5‐ml microcentrifuge tubes, sterile

Basic Protocol 3: Biovar 1 Test for 3‐Ketolactose Production

  Materials
  • Streak‐purified strains of interest
  • Positive and negative control strains (A. tumefaciens C58, biovar 1, and A. vitis S4, biovar 3, respectively)
  • Yeast extract plates (see recipe recipe)
  • Benedict's reagent (see recipe)
  • 28°C incubator

Basic Protocol 4: Biovar 1 Ferric Ammonium Citrate Test

  Materials
  • Ferric ammonium citrate broth (see recipe)
  • Strains of interest and positive and negative controls
  • 2‐ml glass culture tubes
  • 28°C incubator

Basic Protocol 5: Biovar 2 Acid Clearing Test

  Materials
  • Purified strains of interest
  • Potato dextrose agar (PDA) plates supplemented with CaCO 3 (see recipe)
  • 28°C incubator

Basic Protocol 6: Biovar 3 Test for Pectate Degradation

  Materials
  • Hildebrand's medium plates (see recipe)
  • Colonies of bacterial strains to be tested
  • 28°C incubator

Basic Protocol 7: Strain Determination by Diagnostic Sequencing

  Materials
  • Genomic DNA preps from natural isolates (e.g., prepared with Promega Wizard Genomic DNA purification kit)
  • Appropriate primers (see Table 3.4.1)
  • PCR reagents and equipment (e.g., high‐fidelity DNA polymerase, buffer, thermal cycler, dNTPs)
  • Standard DNA gel extraction kit (e.g., Omega E.Z.N.A., cat. no. 101318‐972)
  • Electrophoresis apparatus
    Table 3.0.1   MaterialsPrimers

    Primer Forward Reverse Melting temperature a Product length
    recA (Costechareyre et al., ) TAA TAC GAC TCA CTA TAG GGC TGA TGT CGC CAY TGA CCG AYC ATT AAC CCT CAC TAA AGG GAT GCA GGA AGC GGT CGG CRA TSA F = 66.7°C R = 69.1°C Product from C58 = 1028 bp
    virC (Sawada et al., ) ATC ATT TGT AGC GAC T AGC TCA AAC CTG CTT C F = 44.2°C R = 49.2°C 730 bp
    virD2 (Haas et al., ) b ATG CCC GAT CGA GCT CAA GT TCG TCT GGC TGA CTT TCG TCA TAA Reverse 2: CCT GAC CCA AAC ATC TCG GCT GCC CA F = 58.9°C R1 = 58.0°C R2 = 66.5°C Amplified products using F and R1 is 338 bp and F and R2 is 224 bp
    repC specific for A. tumefaciens C58 replicons At plasmid CGGCAGATTGCCACGACCAAG TCCCGTGGCTTTCACCTGGTG F = 61.3°C R = 62.2°C Amplified product is 1148 bp
    Ti plasmid GCCCACAAATGGCAGCTCTTC GATCTGACCGGCCCGCTGTA F = 57.1°C R = 61.8°C Amplified product is 997 bp
    Linear chromosome ACTCAGTTTGCCGCGCAGAAG GTCTTGACGCCCACGCAGCTG F = 60.7°C R = 63.5°C Amplified product is 1188 bp
    6b specific for the Ti plasmid of biovar 3 (Kaufmann et al., ) GACTTTACTGCTGCTGCCCCGGCGAACTATGCCGAAAGACGGCT GAAGTAAATACAAAGCTATCCCGGGCTTAAGATGACGGTAGCC F = 72.3°C R = 65.3°C Amplified product is 693 bp

     aF, forward; R, reverse.
     bPrimers are specific to the highly conserved endonuclease‐encoding region of the gene. They will amplify in multiple Ti plasmid–harboring species and biovars of Agrobacterium, including A. rhizogenes and A. tumefaciens.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bernaerts, M.J. and Deley, J. 1963. A biochemical test for crown gall bacteria. Nature 197:406‐407.
   Cevallos, M.A., Cervantes‐Rivera, R., and Gutiérrez‐Ríos, R.M. 2008. The repABC plasmid family. Plasmid 60:19‐37.
   Costechareyre, D., Rhouma, A., Lavire, C., Portier, P., Chapulliot, D., Bertolla, F., Boubaker, A., Dessaux, Y., and Nesme, X. 2010. Rapid and efficient identification of Agrobacterium species by recA allele analysis. Microb. Ecol. 60:862‐872.
   Haas, J.H., Moore, L.W., Ream, W., and Manulis, S. 1995. Universal PCR primers for detection of phytopathogenic Agrobacterium strains. Appl. Environ. Microbiol. 61:2879‐2884.
   Kaufmann, M., Kassemeyer, H.H., and Otten, L. 1996. Isolation of Agrobacterium vitis from grapevine propagating material by means of PCR after immunocapture cultivation. Vitis 35:151‐153.
   Krimi, Z., Petit, A., Mougel, C., Dessaux, Y., and Nesme, X. 2002. Seasonal fluctuations and long‐term persistence of pathogenic populations of Agrobacterium spp. in soils. Appl. Environ. Microbiol. 68:3358‐3365.
   Moore, L.W., Bouzar, H., and Burr, T. 2001. Laboratory Guide for Identification of Plant Pathogenic Bacteria. Am. Phytopathological Press, St. Paul, Minnesota.
   Sawada, H., Ieki, H., and Matsuda, I. 1995. PCR detection of Ti and Ri plasmids from phytopathogenic Agrobacterium strains. Appl. Environ. Microbiol. 61:828‐831.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library