Genotyping Escherichia coli O157:H7 for Its Ability to Cause Disease in Humans

James L. Bono1

1 USDA, ARS, U.S. Meat Animal Research Center, Clay Center, Nebraska
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 5A.3
DOI:  10.1002/9780471729259.mc05a03s14
Online Posting Date:  August, 2009
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Escherichia coli are ubiquitous in the world, and for the most part are non‐pathogenic and part of the normal lower gastrointestinal tract in mammals. However, some pathogenic isolates can cause severe disease that range from meningitis to hemorrhagic colitis (HC). In recent years, Shiga toxin‐containing E. coli (STEC) have been a major cause of food borne and environmental cases of HC and hemolytic uremic syndrome. One STEC serotype, O157:H7, has been responsible for numerous food‐associated outbreaks and recalls worldwide. The protocols in this unit will allow the reader to use real‐time polymerase chain reaction genotyping to identify isolates that are more likely to cause disease in humans. The genotyping assay targets a single‐nucleotide polymorphism (SNP) in the tir gene. The tir gene is located in a virulence operon called the locus for enterocyte effacement and functions as a receptor for the tight adherence of E. coli O157:H7 to epithelial cells. As more genomes are sequenced, informative SNPs that associate with phenotypes will be identified. Identifying isolates not only by their genus and species, but also by using other informative genomic traits will increase the general knowledge about their genetic diversity. Curr. Protoc. Microbiol. 14:5A.3.1‐5A.3.10. © 2009 by John Wiley & Sons, Inc.

Keywords: Escherichia coli; O157:H7; real‐time PCR; genotyping; disease

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Real‐Time PCR Genotyping Assay for Disease‐Causing Allele in E. coli O157:H7
  • Support Protocol 1: Extraction of DNA from E. coli O157:H7 Cultures Using the QIAGEN Genomic DNA Purification Procedure
  • Support Protocol 2: DNA Extraction from E. coli O157:H7 by Boiling
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Real‐Time PCR Genotyping Assay for Disease‐Causing Allele in E. coli O157:H7

  Materials
  • TaqMan Universal PCR Master Mix with UNG AmpErase
  • Sense primer: 5′‐ TGGCGGCGTCTGAGATAAC ‐3′
  • Antisense primer: 5′‐ GAGTATCGAGCGGACCATGATC ‐3′
  • tir 255 T allele probe: VIC‐ACTGAATGATGGATTTG‐MGB/NFQ
  • tir 255 A allele probe: FAM‐CTGAATGAAGGATTTG‐MGB/NFQ
  • Molecular‐grade water
  • Genomic DNA extracts ( protocol 2 or protocol 3)
  • Optical PCR tube, strip, or plate
  • Optical caps or optical adhesive cover for plates
  • Vortex
  • Real‐time thermal cycler with the ability to detect amplified DNA after or during each thermal cycling period
  • Additional reagents and equipment for preparing genomic DNA extracts ( protocol 2 or protocol 3)

Support Protocol 1: Extraction of DNA from E. coli O157:H7 Cultures Using the QIAGEN Genomic DNA Purification Procedure

  Materials
  • LB medium containing 10 g NaCl per liter (see recipe)
  • E. coli O157:H7 (ATCC)
  • Ice
  • Qiagen Genomic DNA Buffer set containing:
    • Buffer B1
    • Buffer B2
    • Buffer QBT
    • Buffer QC
    • Buffer QF
  • 100 mg/ml RNase A (Qiagen)
  • 100 mg/ml lysozyme (Qiagen)
  • 50 mg/ml Proteinase K
  • Isopropanol, room temperature
  • 70% (v/v) ethanol
  • 95% (v/v) ethanol
  • TE buffer ( appendix 2A)
  • 10 mM Tris⋅Cl, pH 8.0 ( appendix 2A)
  • Shaking incubator set at 37°C
  • Centrifuge tubes
  • Centrifuge (1.5‐ and 5‐ml samples)
  • Vortex
  • 37°C, 50°C, and 70°C water baths
  • Genomic‐tip 100/G (Qiagen)
  • Bunsen burner
  • Glass Pasteur pipets
  • Spectrophotometer (260 and 280 nm absorbance)
  • Additional reagents and equipment for streaking E. coli cultures on a plate and growing colonies ( appendix 4A)

Support Protocol 2: DNA Extraction from E. coli O157:H7 by Boiling

  Materials
  • LB medium containing 5 g NaCl per liter (see recipe)
  • E. coli O157:H7 (ATCC)
  • TE buffer ( appendix 2A) or 10 mM Tris·Cl, pH 8.0 ( appendix 2A)
  • Ice
  • Shaking incubator set at 37°C
  • 1.5‐ or 2.0‐ml microcentrifuge tubes
  • Centrifuge (1.5‐ml samples)
  • Boiling water bath
  • Additional reagents and equipment for streaking E. coli cultures on a plate and growing colonies ( appendix 4A)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Bono, J.L., Keen, J.E., Clawson, M.L., Durso, L.M., Heaton, M.P., and Laegreid, W.W. 2007. Association of Escherichia coli O157:H7 tir polymorphisms with human infection. BMC Infect. Dis. 7:98.
   CDC report. 2001. Outbreaks of Escherichia coli O157:H7 infections among children associated with farm visits—Pennsylvania and Washington, 2000. MMWR Morb. Mortal. Wkly. Rep. 50:293‐297.
   CDC report. 2002. Multistate outbreak of Escherichia coli O157:H7 infections associated with eating ground beef—United States, June‐July 2002. MMWR Morb. Mortal. Wkly. Rep. 51:637‐639.
   Corrigan, J.J. Jr. and Boineau, F.G. 2001. Hemolytic‐uremic syndrome. Pediatr. Rev. 22:365‐369.
   Crump, J.A., Sulka, A.C., Langer, A.J., Schaben, C., Crielly, A.S., Gage, R., Baysinger, M., Moll, M., Withers, G., Toney, D.M., Hunter, S.B., Hoekstra, R.M., Wong, S.K., Griffin, P.M., and Van Gilder, T.J. 2002. An outbreak of Escherichia coli O157:H7 infections among visitors to a dairy farm. N. Engl. J. Med. 347:555‐560.
   Elder, R.O., Keen, J.E., Siragusa, G.R., Barkocy‐Gallagher, G.A., Koohmaraie, M., and Laegreid, W.W. 2000. Correlation of enterohemorrhagic Escherichia coli O157 prevalence in feces, hides, and carcasses of beef cattle during processing. Proc. Natl. Acad. Sci. U.S.A. 97:2999‐3003.
   Frankel, G., Phillips, A.D., Rosenshine, I., Dougan, G., Kaper, J.B., and Knutton, S. 1998. Enteropathogenic and enterohaemorrhagic Escherichia coli: More subversive elements. Mol. Microbiol. 30:911‐921.
   Heuvelink, A.E., van Heerwaarden, C., Zwartkruis‐Nahuis, J.T., van Oosterom, R., Edink, K., van Duynhoven, Y.T., and de Boer, E. 2002. Escherichia coli O157 infection associated with a petting zoo. Epidemiol. Infect. 129:295‐302.
   Kenny, B., DeVinney, R., Stein, M., Reinscheid, D.J., Frey, E.A., and Finlay, B.B. 1997. Enteropathogenic E. coli (EPEC) transfers its receptor for intimate adherence into mammalian cells. Cell 91:511‐520.
   Lee, L.G., Connell, C.R., and Bloch, W. 1993. Allelic discrimination by nick‐translation PCR with fluorogenic probes. Nucleic Acids Res. 21:3761‐3766.
   Livak, K.J., Flood, S.J., Marmaro, J., Giusti, W., and Deetz, K. 1995. Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl. 4:357‐362.
   Mardis, E.R. 2008. Next‐generation DNA sequencing methods. Annu. Rev. Genomics Hum. Genet. 9:387‐402.
   McDaniel, T.K. and Kaper, J.B. 1997. A cloned pathogenicity island from enteropathogenic Escherichia coli confers the attaching and effacing phenotype on E. coli K‐12. Mol. Microbiol. 23:399‐407.
   Nataro, J.P. and Kaper, J.B. 1998. Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11:142‐201.
   Paton, J.C. and Paton, A.W. 1998. Pathogenesis and diagnosis of Shiga toxin‐producing Escherichia coli infections. Clin. Microbiol. Rev. 11:450‐479.
   Rangel, J.M., Sparling, P.H., Crowe, C., Griffin, P.M., and Swerdlow, D.L. 2005. Epidemiology of Escherichia coli O157:H7 outbreaks, United States, 1982‐2002. Emerg. Infect. Dis. 11:603‐609.
   Schuster, S.C. 2008. Next‐generation sequencing transforms today's biology. Nat. Methods 5:16‐18.
   Shipley, G.L. 2006. An introduction to real‐time PCR. In Real‐Time PCR (M.T. Dorak, ed.) pp. 1‐37. Taylor & Frances Group, London.
Internet Resources
  http://ecoli.cas.psu.edu/
  Gastroenteric Disease Center is one of the largest repositories of Escherichia coli strains in America and performs serotyping and diagnostics for E. coli.
  http://www.shigatox.net/cgi‐bin/stec/index
  The STEC Center is designed to facilitate research on the Shiga toxin‐producing E. coli by providing a standard reference collection of well‐characterized strains and central online accessible databases.
  http://www.dorak.info/genetics/realtime.html
  A good reference for learning about real‐time PCR and the different applications associated with this technique.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library