Isolation and Classification of Bdellovibrio and Like Organisms

Edouard Jurkevitch1

1 Plant Pathology and Microbiology, The Hebrew University of Jerusalem, Rehovot, Israel
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 7B.1
DOI:  10.1002/9780471729259.mc07b01s26
Online Posting Date:  August, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Bdellovibrio and like organisms (BALOs) are obligate predators of Gram‐negative bacteria. BALOs are isolated as plaques growing at the expense of their prey and are cultivated as two‐member cultures. The growth cycle is composed of an extracellular attack phase and an intraperiplasmic elongation and replication phase. However, there are methods for obtaining host‐independent (HI) mutants that grow without prey on rich media. BALOs are commonly found in the environment but generally constitute small populations; therefore, their isolation may require enrichment steps. Contamination by other bacteria during isolation necessitates efficient separation between the smaller BALO cells from the majority of larger bacteria. BALOs can also be directly detected and quantified in environmental samples using specific PCR. Synchronous cultures of both wild‐type and HI derivatives can be obtained to study the different growth phases. These can be further separated by centrifugation. Classification is based on 16S rDNA analysis. Protocols relevant to these aspects of BALO detection, isolation, growth, classification, and quantitation are presented in this unit. Curr. Protoc. Microbiol. 26:7B.1.1‐7B.1.20. © 2012 by John Wiley & Sons, Inc.

Keywords: predatory bacteria; Bdellovibrio; BALO; plaques; host‐independent mutants; synchronous growth; two‐member cultures

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Isolation of BALOs from Environmental Samples by Differential Centrifugation and Filtration
  • Alternate Protocol 1: Isolation of BALOs Using a Ficoll Gradient
  • Alternate Protocol 2: Isolation of BALOs from the Marine Environment
  • Alternate Protocol 3: Enrichment for BALOs in Environmental Samples
  • Basic Protocol 2: Growth and Storage of Pure BALO Cultures
  • Basic Protocol 3: Isolation and Culture of Host‐Independent Mutants
  • Basic Protocol 4: Synchronous Growth of Wild‐Type BALOs
  • Basic Protocol 5: Synchronous Growth of Host‐Independent BALOs
  • Basic Protocol 6: Separation of Growth Phases
  • Support Protocol 1: Prey Preparation
  • Basic Protocol 7: Classification of BALOs
  • Basic Protocol 8: Diagnostic PCR Reactions for BALOs
  • Basic Protocol 9: Quantitative PCR for Bdellovibrionaceae and for Bacteriovorax/Bacteriolyticum
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation of BALOs from Environmental Samples by Differential Centrifugation and Filtration

  Materials
  • Soil or water sample suspected of containing BALOs
  • H 2O, sterile (for soil samples)
  • HM buffer, 4°C (see recipe)
  • Potential prey ( protocol 10)
  • HM top agar, molten (see recipe)
  • HM plates (see recipe)
  • Platform shaker
  • Centrifuge
  • 1.2‐µm Nucleopore filter
  • Vortex mixer
  • 10‐ml test tubes
  • Parafilm
  • 28°C incubator
  • 1‐ml pipettor tips
  • Sterile scalpel
  • Glass slides
  • Coverslips
  • Phase‐contrast microscope
  • 0.45‐µm syringe filters (Supor Acrodisc, Pall Corp.; Minisart, Sartorius)

Alternate Protocol 1: Isolation of BALOs Using a Ficoll Gradient

  • 15% (w/v) Ficoll in HM buffer (see recipe): store up to 1 day at 4°C
  • 1.5 × 9.5–cm centrifugation tubes
  • Gradient maker or peristaltic pump
  • Benchtop centrifuge with swinging‐bucket rotor

Alternate Protocol 2: Isolation of BALOs from the Marine Environment

  • SWYE plates (see recipe)
  • Vibrio parahaemolyticus P‐5 (Shoeffield and Williams, )
  • Sterile ocean water (see recipe)
  • Polypeptone 20 (Pp) medium (see recipe)
  • Pp top agar, molten (see recipe)
  • Pp plates (see recipe)
  • 28° and 25°C incubators
  • Cell spreader, sterile

Alternate Protocol 3: Enrichment for BALOs in Environmental Samples

  Materials
  • Pure culture of BALO in double‐layered agar plate ( protocol 1 and Alternate Protocols protocol 21 to protocol 43)
  • Diluted nutrient broth (DNB; see recipe)
  • Potential prey ( protocol 10; optional)
  • 80% glycerol, sterile
  • Liquid nitrogen
  • 1‐ml pipettor tips
  • Scalpel, sterile
  • 125‐ml Erlenmeyer flasks
  • 28°C shaking incubator
  • Phase‐contrast microscope
  • Centrifuge

Basic Protocol 2: Growth and Storage of Pure BALO Cultures

  Materials
  • Wild‐type, host‐dependent BALO strain
  • Streptomycin‐resistant (Smr) and ‐sensitive (Sms) prey ( protocol 10)
  • 50 mg/ml streptomycin
  • Dilute nutrient broth (DNB; see recipe) with and without 50 µg/ml streptomycin
  • PYE medium (see recipe) containing 50 µg/ml streptomycin
  • PYE plates with and without host extract (see recipe)
  • HM buffer (see recipe; optional)
  • Glycerol, sterile
  • 28° and 30°C incubators
  • Centrifuge
  • 0.45‐µm syringe filter (Supor Acrodisc, Pall Corp.; Minisart, Sartorius)
  • Additional reagents and equipment for preparing double‐layered HM plates (see protocol 1; optional)

Basic Protocol 3: Isolation and Culture of Host‐Independent Mutants

  Materials
  • Prey ( protocol 10)
  • HM buffer (see recipe), 4°C
  • Pure BALOs ( protocol 1 or Alternate Protocols protocol 21 to protocol 43)
  • Centrifuge
  • 0.45‐µm syringe filter (Supor Acrodisc; Pall Corp.; Minisort, Sartorius)
  • 28°C shaking incubator

Basic Protocol 4: Synchronous Growth of Wild‐Type BALOs

  Materials
  • Host‐independent (HI) mutant ( protocol 6)
  • PYE medium with 7% (v/v) host extract (see recipe)
  • 28°C incubator
  • Centrifuge

Basic Protocol 5: Synchronous Growth of Host‐Independent BALOs

  Materials
  • Synchronous BALO culture (Basic Protocols protocol 74 and protocol 85)
  • 0.05 M potassium phosphate buffer, pH 7.2 ( appendix 2A)
  • Percoll
  • 0.25 M sucrose (85.5 g/liter)
  • 14.5 mM NaCl
  • 70‐ml ultracentrifuge tubes
  • Sorvall Centricon T‐1170 ultracentrifuge and A‐641 rotor (or equivalent)

Basic Protocol 6: Separation of Growth Phases

  Materials
  • BALO suspension to be analyzed
  • H 2O, sterile
  • Liquid nitrogen
  • Ice
  • Dimethyl sulfoxide (DMSO)
  • 3 M MgCl 2
  • 2 mM dNTPs ( appendix 2A): dATP, dCTP, dGTP, and dTTP
  • 1× PCR reaction buffer: 500 mM KCl/100 mM Tris⋅Cl, pH 9 ( appendix 2A)/1% (v/v) Triton X‐100
  • Taq DNA polymerase
  • Primers (Table 7.1.1)
  • BSA
  • PCR‐grade double‐distilled water (DDW)
  • 1% agarose gel TAE ( appendix 2A)
  • Ethidium bromide staining solution ( appendix 2A)
  • 0.45‐µm filter (Supor Acrodisc, Pall Corp.; Minisort, Sartorius)
  • Centrifuge
  • Thermal cycler
  • 80°C water bath (optional)
  • Additional reagents and equipment for purification of DNA (Moore and Dowhan, ) and agarose gel electrophoresis (Voytas, )
    Table 7.0.1   MaterialsPrimers Utilized for Classifying, Detecting, and Quantifying BALOs with PCR and qPCR

    Name a Sequence (5′‐3′) Target populations Reference
    BbsF216 TTTCGCTCTAAGATGAGTCCGCGT Bdellovibrionaceae Van Essche et al. ( )
    BbsR707 TTCGCCTCCGGTATTCCTGTTGAT Bdellovibrionaceae Van Essche et al. ( )
    Bd347F GGAGGCAGCAGTAGGGAATA Bdellovibrionaceae Van Essche et al. ( )
    PCR and qPCR
    Bd549R GCTAGGATCCCTCGTCTTACC Bdellovibrionaceae Van Essche et al. ( )
    Bb396P TTCATCACTCACGCGGCGTC 5′FAM, 3′TAMRA Bdellovibrionaceae Van Essche et al. ( )
    Bd529F GGTAAGACGAGGGATCCT Bdellovibrionaceae Davidov et al. ( )
    Bd1007R TCTTCCAGTACATGTCAAG Bdellovibrionaceae Davidov et al. ( )
    BacF69 TGGCGCACGGGCTGAGTAAC Bacteriovorax Kandel, unpub. observ.
    BacR1049 AGCCATGCAGCGCCTGTCAC Bacteriovorax Kandel, unpub. observ.
    BacF519 CAGCAGCCGCGGTAATAC Bacteriovorax Zheng et al. ( )
    BacR677 CGGATTTTACCCCTACATGC Bacteriovorax Zheng et al. ( )
    Bac676F ATTTCGCATGTAGGGGTA Bacteriovorax Davidov et al. ( )
    Bac1442R GCCACGGCTTCAGGTAAG Bacteriovorax Davidov et al. ( )
    Per676F ATTTCACGTGTAGGGGTA Peridibacter Davidov et al. ( )
    Per1443Rd AGTCACGTCTTAAAATGAAA Peridibacter Davidov et al. ( )
    Mic431F AAGCTCTTTTAGGTGTGAAA Micavibrio Davidov et al. ( )
    Mic996R TGAAAGTCAAAAGGAGGAT Micavibrio Davidov et al. ( )
    63F CAGGCCTAACACATGCAAGTC Bacteria Marchesi et al. ( )
    1378R CGGTGTGTACAAGGCCCGGGAACG Bacteria Heuer et al. ( )

     aPairs of primers are either underlined or in italics. Oligonucleotide Bb396P is a “taqman” probe.

Support Protocol 1: Prey Preparation

  Materials
  • DNA from environmental samples or from an isolated strain
  • Kit for the isolation of environmental DNA (e.g., Powersoil DNA Isolation kit, Mo Bio Laboratories) or genomic DNA extraction kit (Promega)
  • BALO‐specific 16S rDNA primers (Table 7.1.1)
  • PCR master mix (Lambda Biotech, cat. no. D123P)
  • PCR‐grade DDW
  • 1% agarose gel TAE ( appendix 2A)
  • Ethidium bromide staining solution

Basic Protocol 7: Classification of BALOs

  Materials
  • BALO DNA from a standard culture (see protocol 11)
  • 25 mM MgCl 2
  • 5× reaction buffer (Lambda Biotech)
  • dNTPs
  • Taq DNA polymerase
  • Primers BbsF216 and BbsR707 for Bdellovibrionaceae (Table 7.1.1)
  • Primers BacF69 and BacR1049 for Bacteriovorax/Bacteriolyticum (Table 7.1.1)
  • PCR‐grade DDW
  • PCR purification kit (e.g., PCR Cleanup kit, Qiagen)
  • Cloning vector (e.g., pGEM‐T, Promega)
  • Plasmid purification kit (e.g., GeneElute Plasmid Miniprep kit, Sigma‐Aldrich)
  • pGEM Easy Vector System (Promega)
  • Environmental DNA (PowerSoil Kit, MoBio)
  • Primers Bd347F and Bd549R (Table 7.1.1)
  • Probe Bb396P (see Table 7.1.1)
  • Jumpstart Taq Readymix for high‐throughput quantitative PCR (Sigma‐Aldrich, cat. no. D6442)
  • BacF519 and BacR677 (see Table 7.1.1)
  • qPCR SYBRGreen mix (ABsolute Blue qPCR SYBR Green ROX mix; Thermo Scientific, cat. no. AB‐4136/A)
  • Thermal cycler
  • Stratagene‐MX 3000P Real‐time PCR System 7300 or Real‐Time PCR System
  • SDSv1.4 software (Applied Biosystems)
  • Additional reagents and equipment for agarose gel electrophoresis ( appendix 2A) and transforming E. coli competent cells ( appendix 3L)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Baer, M.L., Ravel, J., Chun, J., Hill, R.T., and Williams, H.N. 2000. A proposal for the reclassification of Bdellovibrio stolpii and Bdellovibrio starrii into a new genus, Bacteriovorax stolpii comb. nov. and Bacteriovorax starrii comb. nov., respectively. Int. J. Syst. Environ. Microbiol. 50:219‐224.
   Barel, G. and Jurkevitch, E. 2001. Analysis of phenotypic diversity among host‐independent mutants of Bdellovibrio bacteriovorus 109J. Arch. Microbiol. 176:211‐216.
   Chauhan, A., Cherrier, J., and Williams, H.N. 2009. Impact of sideways and bottom‐up control factors on bacterial community succession over a tidal cycle. Proc. Natl. Acad. Sci. U.S.A. 106:4301‐4306.
   Davidov, Y. and Jurkevitch, E. 2004. Diversity and evolution of Bdellovibrio‐and‐like organisms (BALOs), reclassification of Bacteriovorax starrii as Peredibacter starrii gen. nov., comb. nov., and description of the BacteriovoraxPeredibacter clade as Bacteriovoracaceae fam. nov. Int. J. Syst. Evol. Microbiol. 54:1439‐1452.
   Davidov, Y., Friedjung, A., and Jurkevitch, E. 2006. Structure analysis of a soil community of predatory bacteria using culture‐dependent and culture‐independent methods reveals a hitherto undetected diversity of Bdellovibrio‐and‐like organisms. Environ. Microbiol. 8:1667‐1673.
   Heuer, H., Krsek, M., Baker, P., Smalla, K., and Wellington, E.M.H. 1997. Analysis of actinomycete communities by specific amplification of genes encoding 16S rRNA and gel‐electrophoretic separation in denaturing gradients. Appl. Environ. Microbiol. 63:3233‐3241.
   Marchesi, J.R., Sato, T., Weightman, A.J., Martin, T.A., Fry, J.C., Hiom, S.J., and Wade, W.G. 1998. Design and evaluation of useful bacterium‐specific PCR primers that amplify genes coding for bacterial 16S rRNA. Appl. Environ. Microbiol. 64:3869‐3877.
   Martin, M.O. 2002. Predatory prokaryotes: An emerging research opportunity. J. Microbiol. Biotechnol. 4:467‐477.
   Moore, D. and Dowhan, D. 2002. Purification and concentration of DNA from aqueous solutions. Curr. Protoc. Mol. Biol. 59:2.1.1‐2.1.10.
   Pineiro, S.A., Williams, H.N., and Stine, C.O. 2008. Phylogenetic relationships amongst the saltwater members of the genus Bacteriovorax using rpoB sequences and reclassification of Bacteriovorax stolpii as Bacteriolyticum stolpii gen. nov., comb. nov. Int. J. Syst. Evol. Microbiol. 58:1203‐1209.
   Seidler, R.J. and Starr, M.P. 1969. Isolation and characterization of host‐independent bdellovibrios. J. Bacteriol. 100:769‐785.
   Shoeffield, A.J. and Williams, H.N. 1990. Efficiencies of recovery of Bdellovibrios from brackish‐water environments by using various bacterial species as prey. Appl. Environ. Microbiol. 56:230‐236.
   Stolp, H. and Pertzold, H. 1962. Untersuchungen uber einen obligat parasitischen Mikroorganismus mit lytischer Aktivitat fur Pseudomonas‐Bakterien. Phytopathol. Z. 45:364‐390.
   Van Essche, M., Sliepen, I, Loozen, G., Van Eldere, J., Quirynen, M., Davidov, Y., Jurkevitch, E., and Teughels, W. 2009. Development and performance of a quantitative PCR for the enumeration of Bdellovibrionaceae. Environ. Microbiol. Rep. 4:228‐233.
   Varon, M. and Shilo, M. 1970. Method for separation of Bdellovibrio from mixed bacterial population by filtration through millipore or by gradient differential. Rev. Int. Ocean. 18‐19:144‐151.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Zheng, G., Wang, C., Williams, H.N., and Pineiro, S.A. 2008. Development and evaluation of a quantitative real‐time PCR assay for the detection of saltwater Bacteriovorax. Environ. Microbiol. 10:2515‐2526.
Key References
   Davidov and Jurkevitch, 2004. See above.
  A comprehensive presentation of BALO classification.
   Martin, 2002. See above.
  A review of various predatory bacteria and of their modes of action. The first in‐depth report on Bdellovibrio. A classic.
   Jurkevitch, E. 2005. The genus Bdellovibrio. In The Prokaryotes, Release 3.19 (M. Dworkin, S. Flakow, E. Rosenberg, K.H. Schleifer, and E. Stackebrandt, eds.). Springer‐Verlag, New York. (available online at http://141.150.157.117:8080/prokPUB/index.htm.)
  A review on BALOs.
   Kelley, J.I., Turng, B.F., Williams, H.N., and Baer, M.L. 1997. Effects of temperature, salinity, and substrate on the colonization of surfaces in situ by aquatic bdellovibrios. Appl. Environ. Microbiol. 63:84‐90.
  Describes the tracking of BALO populations in the marine environment.
   Stolp, H., and Starr, M.P. 1963. Bdellovibrio bacteriovorus gen. et sp., a predatory, ectoparasitic, and bacteriolytic microorganism. Anton. van Leeuwen. 29:217‐248.
  The first independent report on Bdellovibrio: a classic.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library