Genetic Manipulation of Streptococcus pyogenes (The Group A Streptococcus, GAS)

Yoann Le Breton1, Kevin S. McIver1

1 University of Maryland, College Park, Maryland
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 9D.3
DOI:  10.1002/9780471729259.mc09d03s30
Online Posting Date:  October, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Streptococcus pyogenes (the Group A Streptococcus, GAS) is a Gram‐positive bacterium responsible for a wide spectrum of diseases ranging from mild superficial infections (pharyngitis, impetigo) to severe, often life‐threatening invasive diseases (necrotizing fasciitis, streptococcal toxic shock syndrome) in humans. This unit describes molecular techniques for the genetic manipulation of S. pyogenes with detailed protocols for transformation, gene disruption, allelic exchange, transposon mutagenesis, and genetic complementation. Curr. Protoc. Microbiol. 30:9D.3.1‐9D.3.29. © 2013 by John Wiley & Sons, Inc.

Keywords: Streptococcus pyogenes; plasmid; genomic DNA; transformation; transposon mutagenesis; genetic complementation; mariner

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Large‐Scale Extraction of Genomic DNA from S. pyogenes (GAS)
  • Alternate Protocol 1: Moderate Yield Extraction of Genomic DNA from S. pyogenes (GAS)
  • Alternate Protocol 2: Quick Extraction of Genomic DNA from S. pyogenes (GAS)
  • Basic Protocol 2: Transformation of S. pyogenes (GAS) Cells
  • Basic Protocol 3: Gene Disruption Using Conditional Replicative Plasmids
  • Basic Protocol 4: Gene Disruption Using Suicide Plasmids
  • Basic Protocol 5: Gene Replacement by Allelic Exchange
  • Basic Protocol 6: Tn4001 Transposition in S. pyogenes (GAS)
  • Basic Protocol 7: Mariner Transposition in S. pyogenes (GAS)
  • Alternate Protocol 3: Mariner Transposition in Easily Transformable S. pyogenes (GAS)
  • Basic Protocol 8: Identification of Oskar Transposon Junctions by AP‐PCR
  • Basic Protocol 9: Mutation Complementation in S. pyogenes (GAS)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Large‐Scale Extraction of Genomic DNA from S. pyogenes (GAS)

  Materials
  • Todd‐Hewitt yeast (THY) broth (see recipe)
  • 2 M glycine solution (see recipe)
  • Antibiotics (see reciperecipes)
  • Viable GAS isolated colony on appropriate agar plate (unit 9.2)
  • 10 mM Tris·Cl, pH 8 (see recipe)
  • Solution I (see recipe)
  • Lysozyme solution (see recipe)
  • Solution II (see recipe)
  • RNase A solution (see recipe)
  • Proteinase K solution (see recipe)
  • TE‐saturated phenol
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 3 M sodium acetate (see recipe)
  • 100% ethanol
  • 250‐ml screw‐cap flasks
  • 30° or 37°C incubator
  • Sterile 250‐ml Nalgene centrifugation bottles with inserts and screw caps
  • Refrigerated centrifuge
  • 15‐ and 50‐ml polypropylene conical tubes
  • 37°C shaking water bath
  • 55°C water bath
  • Equipment for agarose gel electrophoresis
  • Spectrophotometer

Alternate Protocol 1: Moderate Yield Extraction of Genomic DNA from S. pyogenes (GAS)

  Additional Materials (also see protocol 1)
  • MasterPure Complete DNA and RNA Purification Kit (Epicentre, cat. no. MC85200)
  • Temperature‐controlled thermomixer (Eppendorf, cat. no. 5360 000.011)
  • Temperature‐controlled water‐bath

Alternate Protocol 2: Quick Extraction of Genomic DNA from S. pyogenes (GAS)

  Additional Materials (also see protocol 1)
  • FastDNA Spin Kit (MP Biomedicals, cat. no. 116540600)
  • FastPrep cell disruptor (MP Biomedicals, cat. no. 116004500)

Basic Protocol 2: Transformation of S. pyogenes (GAS) Cells

  Materials
  • Todd‐Hewitt yeast (THY) broth for GAS growth (see recipe)
  • 2 M glycine solution (see recipe)
  • Antibiotics (see reciperecipes)
  • Viable, isolated GAS colony on appropriate agar plate (unit 9.2)
  • Hyaluronidase solution (see recipe), optional
  • EP solution (see recipe), ice cold
  • Saline solution (see recipe)
  • THY agar plates with and without appropriate antibiotic (see recipe)
  • 15‐ml conical tubes
  • Temperature‐controlled CO 2 incubator
  • 250‐ and 500‐ml sterile, screw‐cap centrifugation bottles (Nalgene) with inserts
  • Spectrophotometer
  • Microscope
  • Refrigerated centrifuge
  • 1.5‐ml microcentrifuge tubes
  • 0.025‐µm membrane filter for plasmid dialysis (Millipore, cat. no. VSWP02500)
  • 2‐in. petri dishes
  • 2‐mm electroporation cuvettes (Bio‐Rad, cat. no. 165‐2082)
  • Gene Pulser Xcell microbial system apparatus (Bio‐Rad, cat. no. 165‐2662)

Basic Protocol 3: Gene Disruption Using Conditional Replicative Plasmids

  Materials
  • Primers targeting an internal fragment of the studied gene (see step 1)
  • Genomic DNA from GAS strain (see protocol 1)
  • High‐fidelity DNA polymerase
  • PCR purification kit (Promega)
  • DNA of a temperature‐sensitive plasmid conditionally replicative in GAS
  • Restriction enzyme(s), DNA ligase, and corresponding buffers
  • Electrocompetent cells of E. coli (see appendix 3L)
  • Electrocompetent cells of GAS (see protocol 4)
  • Todd‐Hewitt yeast (THY) broth (see recipe)
  • Saline solution (see recipe)
  • THY agar plates with appropriate antibiotic (see recipe)
  • Set of primers targeting gDNA surrounding mutation
  • TSA blood agar plates (unit 9.2)
  • 15‐ml screw‐cap conical tubes
  • Temperature‐controlled CO 2 incubator
  • Refrigerated centrifuge
  • Additional reagents and equipment for PCR ( appendix 3D), drop dialysis and GAS transformation (see protocol 4)

Basic Protocol 4: Gene Disruption Using Suicide Plasmids

  Materials
  • Primers targeting an internal fragment of the studied gene (see step 1)
  • Genomic DNA from GAS strain
  • High‐fidelity DNA polymerase
  • PCR purification kit (Promega)
  • DNA of a suicide plasmid (non‐replicating in GAS)
  • Todd‐Hewitt Yeast (THY) broth (see recipe)
  • Saline solution (see recipe)
  • THY agar plates with appropriate antibiotic (see recipe)
  • Set of primers targeting gDNA surrounding mutation
  • Temperature‐controlled CO 2 incubator
  • Refrigerated centrifuge
  • Additional reagents and equipment for PCR ( appendix 3D), drop dialysis and GAS transformation (see protocol 4)

Basic Protocol 5: Gene Replacement by Allelic Exchange

  Materials
  • Two sets of primers to amplify DNA flanking gene to mutagenize (see step 1)
  • Set of primers to amplify desired antibiotic‐resistance cassette (see step 1)
  • Genomic DNA from GAS strain (see protocol 1)
  • Plasmid DNA to amplify desired antibiotic‐resistance cassette
  • High‐fidelity DNA polymerase
  • PCR purification kit
  • DNA of a temperature‐sensitive plasmid conditionally replicative in GAS
  • Electrocompetent cells of E. coli (see appendix 3L)
  • Electrocompetent cells of GAS strain (see protocol 4)
  • Todd‐Hewitt yeast (THY) broth for GAS growth (see recipe)
  • Saline solution (see recipe)
  • THY agar plates with appropriate antibiotic (see recipe)
  • Set of primers targeting gDNA surrounding mutation
  • 15‐ml screw‐cap conical tubes
  • Temperature‐controlled CO 2 incubator
  • Refrigerated centrifuge
  • Additional reagents and equipment for PCR ( appendix 3D), drop dialysis and GAS transformation (see protocol 4)

Basic Protocol 6: Tn4001 Transposition in S. pyogenes (GAS)

  Materials
  • Electrocompetent cells of GAS strain to mutagenize (see protocol 4)
  • Todd‐Hewitt yeast (THY) broth (see recipe)
  • pMGC57 plasmid
  • Saline solution (see recipe)
  • THY agar plates with 100 µg/ml spectinomycin (THYA Sp100, see recipe)
  • Temperature‐controlled CO 2 incubator
  • 15‐ml conical tubes
  • Additional reagents and equipment for PCR ( appendix 3D), drop dialysis and GAS transformation (see protocol 4)
NOTE: For antibiotics, the superscript (Sp100) refers to the microgram per milliliter final antibiotic concentration used for drug selection in a given experiment.

Basic Protocol 7: Mariner Transposition in S. pyogenes (GAS)

  Materials
  • DNA of the plasmid pOSKAR
  • Electrocompetent cells of E. coli C43 strain (see appendix 3L)
  • LB broth
  • LB‐agar plates containing Sp100 and Km50
  • Spectinomycin and kanamycin (see reciperecipes)
  • Plasmid Miniprep kit (Wizard Plus SV, Promega, cat. no. A1460)
  • Restriction enzymes and buffers (EcoRI and PstI)
  • Plasmid Midi kit (QIAGEN, cat. no. 12143)
  • Electrocompetent cells of the GAS strain (see protocol 4)
  • Todd‐Hewitt yeast (THY) broth (see recipe)
  • Saline solution (see recipe)
  • THY agar plates containing appropriate antibiotic (see recipe)
  • 25% glycerol in PBS (see recipe)
  • Temperature‐controlled CO 2 incubator with and without shaking
  • Refrigerated centrifuge
  • Spectrophotometer
  • Sterile cell spreader
  • 2‐ml screw‐cap vials
  • Additional reagents and equipment for PCR ( appendix 3D) and drop dialysis and GAS transformation (see protocol 4)

Alternate Protocol 3: Mariner Transposition in Easily Transformable S. pyogenes (GAS)

  Materials
  • Genomic DNA of GAS Oskar mutant (see protocol 1)
  • Primers oPCR1, Deg3, Anchor1, Deg4, and Anchor2 (see Table 9.3.1)
  • Gel and PCR Clean‐Up System kit (Wizard SV; Promega, cat. no. A9282)
  • Additional reagents and equipment for PCR ( appendix 3D)
Table 9.0.1   MaterialsList of Primers Used for AP‐PCR Analyses of Oskar Transposons

Primer name Sequence
Primer Adapter‐1 5′‐AGTCTCGCAGATGATAAGGTGGTCGTGGT‐3′
Primer Adapter‐Tsp 5′‐AATTACCACGACCACCTTATCATC‐3′
Primer Anchor1 5′‐CGCAACTGTCCATACTCTG‐3′
Primer Anchor2 5′‐GCCTACGAGGAATTTGTATCG‐3′
Primer Deg3 5′‐TAGAGTTATTAATGGAATTGCTGATNNNNNNNNNNN‐3′
Primer Deg4 5′‐TAGAGTTATTAATGGAATTGCTGAT‐3′
Primer oID3 5′‐TAATACGACTCACTATAGGGAG‐3′
Primer oPCR1 5′‐TACTGGATGAATTGTTTTAGTACC‐3′

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bessen, D.E. 2009. Population biology of the human restricted pathogen, Streptococcus pyogenes. Infect. Genet. Evol. 9:581‐593.
  Caparon, M.G. and Scott, J.R. 1991. Genetic manipulation of pathogenic streptococci. Methods Enzymol. 204:556‐586.
  Cho, K.H. and Caparon, M. 2006. Genetics of Group A Streptococci. In Gram‐Positive Pathogens, 2nd edition (V.A. Fischetti, R.P. Novick, J.J. Ferretti, D.A. Portnoy, and J.I. Rood, eds.) pp. 59‐73. ASM Press, Washington, D.C.
  Dunny, G.M., Lee, L.N., and LeBlanc, D.J. 1991. Improved electroporation and cloning vector system for Gram‐positive bacteria. Appl. Environ. Microbiol. 57:1194‐1201.
  Husmann, L.K., Scott, J.R., Lindahl, G., and Stenberg, L. 1995. Expression of the Arp protein, a member of the M protein family, is not sufficient to inhibit phagocytosis of Streptococcus pyogenes. Infect. Immun. 63:345‐348.
  Le Breton, Y., Mistry, P., Valdes, K.M., Quigley, J., Kumar, N., Tettelin, H., and McIver, K.S. 2013. Genome‐wide identification of genes required for fitness of group a streptococcus in human blood. Infect. Immun. 81:862‐875.
  Lyon, W.R., Gibson, C.M., and Caparon, M.G. 1998. A role for Trigger Factor and an Rgg‐like regulator in the transcription, secretion and processing of the cysteine proteinase of Streptococcus pyogenes. EMBO J. 17:6263‐6275.
  Maguin, E., Duwat, P., Hege, T., Ehrlich, D., and Gruss, A. 1992. New thermosensitive plasmid for Gram‐positive bacteria. J. Bacteriol. 174:5633‐5638.
  Miroux, B. and Walker, J.E. 1996. Over‐production of proteins in Escherichia coli: Mutant hosts that allow synthesis of some membrane proteins and globular proteins at high levels. J. Mol. Biol. 260:289‐298.
  Okada, N., Geist, R.T., and Caparon, M.G. 1993. Positive transcriptional control of mry regulates virulence in the group A Streptococcus. Mol. Microbiol. 7:893‐903.
  Perez‐Casal, J., Price, J.A., Maguin, E., and Scott, J.R. 1993. An M protein with a single C repeat prevents phagocytosis of Streptococcus pyogenes: Use of a temperature‐sensitive shuttle vector to deliver homologous sequences to the chromosome of S. pyogenes. Mol. Microbiol. 8:809‐819.
  Trieu‐Cuot, P., Carlier, C., Poyart‐Salmeron, C., and Courvalin, P. 1990. A pair of mobilizable shuttle vectors conferring resistance to spectinomycin for molecular cloning in Escherichia coli and in Gram‐positive bacteria. Nucleic Acids Res 18:4296.
  Warrens, A.N., Jones, M.D., and Lechler, R.I. 1997. Splicing by overlap extension by PCR using asymmetric amplification: An improved technique for the generation of hybrid proteins of immunological interest. Gene 186:29‐35.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library