Chlamydia trachomatis Transformation and Allelic Exchange Mutagenesis

Konrad E. Mueller1, Katerina Wolf1, Kenneth A. Fields1

1 Department of Microbiology, Immunology & Molecular Genetics, University of Kentucky College of Medicine, Lexington, Kentucky
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 11A.3
DOI:  10.1002/cpmc.31
Online Posting Date:  May, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Gene inactivation is essential for forward and reverse genetic approaches to establish protein function. Techniques such as insertion or chemical mutagenesis have been developed to mutagenize chlamydiae via targeted or random mutagenesis, respectively. Both of these approaches require transformation of chlamydiae to either introduce insertion elements or complement mutants. We have recently developed a targeted mutagenesis strategy, fluorescence‐reported allelic exchange mutagenesis (FRAEM), to delete Chlamydia trachomatis L2 genes. This approach overcomes several barriers for genetically manipulating intracellular bacteria. Perhaps most significantly, FRAEM employs fluorescence reporting to indicate successful transformation and subsequent recombination events. Three protocols are provided that detail methods to construct gene‐specific suicide vectors, transform C. trachomatis L2 to select for recombinants, and isolate clonal populations via limiting dilution. In aggregate, these protocols will allow investigators to engineer C. trachomatis L2 strains carrying complete deletions of desired gene(s). © 2017 by John Wiley & Sons, Inc.

Keywords: chlamydia; mutagenesis; transformation

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Assembly of Deletion Construct
  • Basic Protocol 2: Transformation of C. Trachomatis
  • Basic Protocol 3: Isolation of Deletion Mutant by Limiting Dilution
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Assembly of Deletion Construct

  Materials
  • Q5® High‐Fidelity DNA Polymerase (NEB, cat. no. M0491S)
  • Zymoclean™ Gel DNA Recovery Kit (Zymo Research, cat. no. D4001)
  • Primer pair to amplify the gene targeted for deletion surrounded by approximately 3‐kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R
  • pUC18A plasmid DNA (developed in the Fields lab; available upon request)
  • Cutsmart buffer (NEB, cat. no. B7204S)
  • DpnI restriction enzyme (NEB, cat. no. R0176S)
  • NEB® 10‐beta Competent E. coli (NEB, cat. no. C3019H)
  • LB agar plates and liquid medium containing 100 μg/ml spectinomycin ( appendix 4A; Stevenson, )
  • Primer pair surrounding, but directed away from, the target gene: X‐away F and R
  • Zyppy™ Plasmid Miniprep Kit (Zymo Research, cat. no. D4036)
  • pUC19G plasmid DNA (developed in the Fields lab; available upon request)
  • Primer pair for amplifying the bla‐gfp cassette from pUC19G:
    • bla‐gfp F: GGAAATGTGCGCGGAACCC
    • bla‐gfp R: TTACTTGTATAGTTCATCCATGCCATGTG
  • T4 polynucleotide kinase (NEB, cat. no. M0201S)
  • Quick Ligation™ Kit (NEB, cat. no. M2200S)
  • LB agar plates and liquid medium containing 50 μg/ml carbenicillin ( appendix 4A; Stevenson, )
  • Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC:
    • HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTCGGTCTGACGC TCAGTGGAACG
  • HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCCpSUmC plasmid DNA
  • pSUmC plasmid DNA (developed in the Fields lab; available upon request)
  • dam/dcm Competent E. coli (NEB, cat. no. C2925I, NEB)
  • QIAfilter Plasmid Maxi Kit (Qiagen, cat. no. 12262)
  • Thermal cycler
  • 37ºC incubator/shaker
  • Additional reagents and equipment for the polymerase chain reaction (PCR; Kramer & Coen, ), purification of DNA (e.g., unit 15.5; Li, Huang, & Hayama, 2000), agarose gel electrophoresis (Voytas, ), insertion/deletion PCR (Geiser et al., ), and direct PCR on bacterial colonies ( appendix 3D; Woodman, Savage, Arnold, & Stevenson, 2016)

Basic Protocol 2: Transformation of C. Trachomatis

  Materials
  • McCoy cells (ATCC #CRL‐1696)
  • RPMI 1640 medium (Gibco, cat. no. 11875119) supplemented with 10% (v/v) heat‐inactivated fetal bovine serum (FBS; Gibco, cat. no. 16000044)
  • Crude stock of C. trachomatis elementary bodies (EBs; see recipe)
  • CaCl 2 buffer (see recipe)
  • Unmethylated deletion construct ( protocol 1) at 1.0 to 1.5 µg/µl ( protocol 1)
  • Sucrose‐phosphate‐glutamate (SPG) buffer (see recipe)
  • Hanks’ Balanced Salt Solution (HBSS; Gibco, cat. no. 24020117)
  • 1 mg/ml (1000×) cycloheximide (see recipe)
  • 0.5 mg/ml (10,000×) anhydrotetracycline hydrochloride stock (see recipe)
  • 6 mg/ml (10,000×) penicillin G sodium salt (recipe)
  • 6‐well cell culture plates (Corning, cat. no. 3516)
  • 37ºC, 5% CO 2 humidified incubator
  • Refrigerated centrifuge
  • Cell scrapers (Corning, cat. no. 353085)
  • 2‐ml Safe‐Lock microcentrifuge tubes (Eppendorf, cat. no. 022363352)
  • Microscope

Basic Protocol 3: Isolation of Deletion Mutant by Limiting Dilution

  Materials
  • Crude stock of C. trachomatis transformed with the deletion construct ( protocol 2)
  • McCoy cells (ATCC #CRL‐1696)
  • RPMI 1640 medium (Gibco, cat. no. 11875119) supplemented with 10% (v/v) heat‐inactivated fetal bovine serum (FBS; Gibco, cat. no. 16000044)
  • Hanks’ Balanced Salt Solution (HBSS; Gibco, cat. no. 24020117)
  • 1 mg/ml (1000×) cycloheximide (see recipe)
  • 6 mg/ml (10,000×) penicillin G sodium salt (recipe)
  • Sucrose‐phosphate‐glutamate (SPG) buffer (see recipe)
  • 37ºC, 5% CO 2 humidified incubator
  • Fluorescence microscope
  • 2‐ml Safe‐Lock microcentrifuge tubes (Eppendorf, cat. no. 022363352)384‐well tissue culture plates (Greiner, cat. no. 781091)
  • Additional reagents and equipment for titering C. trachomatis [see Support Protocol 2 in unit 11.1 (Scidmore, )]
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Agaisse, H., & Derre, I. (2013). A C. trachomatis cloning vector and the generation of C. trachomatis strains expressing fluorescent proteins under the control of a C. trachomatis promoter. PLoS One, 8(2), e57090. doi: 10.1371/journal.pone.0057090
  Agaisse, H., & Derre, I. (2014). Expression of the effector protein IncD in Chlamydia trachomatis mediates recruitment of the lipid transfer protein CERT and the endoplasmic reticulum‐resident protein VAPB to the inclusion membrane. Infection and Immunity, 82(5), 2037–2047. doi: 10.1128/IAI.01530‐14
  Bauler, L. D., & Hackstadt, T. (2014). Expression and targeting of secreted proteins from Chlamydia trachomatis. Journal of Bacteriology, 196(7), 1325–1334. doi: 10.1128/JB.01290‐13
  Binet, R., & Maurelli, A. T. (2009). Transformation and isolation of allelic exchange mutants of Chlamydia psittaci using recombinant DNA introduced by electroporation. Proceedings of the National Academy of Sciences of the United States of America, 106(1), 292–297. doi: 10.1073/pnas.0806768106
  Burnett, L. C., Lunn, G., & Coico, R. (2009). Biosafety: Guidelines for working with pathogenic and infectious microorganisms. Current Protocols in Microbiology, 13, 1A.1.1–1A.1.14.
  Geiser, M., Cebe, R., Drewello, D., & Schmitz, R. (2001). Integration of PCR fragments at any specific site within cloning vectors without the use of restriction enzymes and DNA ligase. Biotechniques, 31(1), 88–90.
  Gerard, H. C., Mishra, M. K., Mao, G., Wang, S., Hali, M., Whittum‐Hudson, J. A., … Hudson, A. P. (2013). Dendrimer‐enabled DNA delivery and transformation of Chlamydia pneumoniae. Nanomedicine, 9(7), 996–1008. doi: 10.1016/j.nano.2013.04.004
  Gong, S., Yang, Z., Lei, L., Shen, L., & Zhong, G. (2013). Characterization of Chlamydia trachomatis plasmid‐encoded open reading frames. Journal of Bacteriology, 195(17), 3819–3826. doi: 10.1128/JB.00511‐13
  Johnson, C. M., & Fisher, D. J. (2013). Site‐specific, insertional inactivation of incA in Chlamydia trachomatis using a group II intron. PLoS One, 8(12), e83989. doi: 10.1371/journal.pone.0083989
  Kannan, R. M., Gerard, H. C., Mishra, M. K., Mao, G., Wang, S., Hali, M., … Hudson, A. P. (2013). Dendrimer‐enabled transformation of Chlamydia trachomatis. Microbial Pathogenesis, 65, 29–35. doi: 10.1016/j.micpath.2013.08.003
  Kari, L., Goheen, M. M., Randall, L. B., Taylor, L. D., Carlson, J. H., Whitmire, W. M., … Caldwell, H. D. (2011). Generation of targeted Chlamydia trachomatis null mutants. Proceedings of the National Academy of Sciences of the United States of America, 108(17), 7189–7193. doi: 10.1073/pnas.1102229108
  Kokes, M., Dunn, J. D., Granek, J. A., Nguyen, B. D., Barker, J. R., Valdivia, R. H., & Bastidas, R. J. (2015). Integrating chemical mutagenesis and whole‐genome sequencing as a platform for forward and reverse genetic analysis of Chlamydia. Cell Host & Microbe, 17(5), 716–725. doi: 10.1016/j.chom.2015.03.014
  Kramer, M.F. & Coen, D.M. (2000). Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Current Protocols in Molecular Biology, 56, 15.1.1‐15.1.14.
  Li, J. K.‐K., Huang, I.‐J., & Hayama, E. (2012). Separation and isolation of BTV dsRNA segments and viral proteins. Current Protocols in Microbiology, 25, 15C.5.1–15C.5.22. doi: 10.1002/9780471729259.mc15c05s25
  Lowden, N. M., Yeruva, L., Johnson, C. M., Bowlin, A. K., & Fisher, D. J. (2015). Use of aminoglycoside 3' adenyltransferase as a selection marker for Chlamydia trachomatis intron‐mutagenesis and in vivo intron stability. BMC Research Notes, 8, 570. doi: 10.1186/s13104‐015‐1542‐9
  Mueller, K. E., & Fields, K. A. (2015). Application of beta‐lactamase reporter fusions as an indicator of effector protein secretion during infections with the obligate intracellular pathogen Chlamydia trachomatis. PLoS One, 10(8), e0135295. doi:10.1371/journal.pone.0135295
  Mueller, K. E., Wolf, K., & Fields, K. A. (2016). Gene deletion by fluorescence‐reported allelic exchange mutagenesis in Chlamydia trachomatis. MBio, 7(1), e01817–01815. doi:10.1128/mBio.01817‐15
  Nguyen, B. D., & Valdivia, R. H. (2012). Virulence determinants in the obligate intracellular pathogen Chlamydia trachomatis revealed by forward genetic approaches. Proceedings of the National Academy of Sciences of the United States of America, 109(4), 1263–1268. doi: 10.1073/pnas.1117884109
  Scidmore, M. (2005). Cultivation and laboratory maintenance of Chlamydia trachomatis. Current Protocols in Microbiology, 1, 11A.1.1–11A.1.25. doi:10.1002/9780471729259
  Song, L., Carlson, J. H., Whitmire, W. M., Kari, L., Virtaneva, K., Sturdevant, D. E., … Caldwell, H. D. (2013). Chlamydia trachomatis plasmid‐encoded Pgp4 is a transcriptional regulator of virulence‐associated genes. Infection and Immunity, 81(3), 636–644. doi: 10.1128/IAI.01305‐12
  Stevenson, B. (2006). Common bacterial culture techniques and media. Current Protocols in Microbiology, 00, 4A:A.4A.1–A.4A.8. doi: 10.1002/9780471729259.mca04as00
  Tam, J. E., Davis, C. H., & Wyrick, P. B. (1994). Expression of recombinant DNA introduced into Chlamydia trachomatis by electroporation. Canadian Journal of Microbiology, 40(7), 583–591. doi: 10.1139/m94‐093
  Voytas, D. (2000). Agarose gel electrophoresis. Current Protocols in Molecular Biology, 51, 2.5A.1‐2.5A.9.
  Wang, Y., Kahane, S., Cutcliffe, L. T., Skilton, R. J., Lambden, P. R., & Clarke, I. N. (2011). Development of a transformation system for Chlamydia trachomatis: Restoration of glycogen biosynthesis by acquisition of a plasmid shuttle vector. PLoS Pathogens, 7(9), e1002258. doi: 10.1371/journal.ppat.1002258
  Wickstrum, J., Sammons, L. R., Restivo, K. N., & Hefty, P. S. (2013). Conditional gene expression in Chlamydia trachomatis using the tet system. PLoS One, 8(10), e76743. doi:10.1371/journal.pone.0076743
  Zhong, G. (2016). Chlamydial plasmid‐dependent pathogenicity. Trends in Microbiology. doi: 10.1016/j.tim.2016.09.006
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library