Molecular Typing of Borrelia burgdorferi

Guiqing Wang1, Dionysios Liveris2, Priyanka Mukherjee3, Sabrina Jungnick4, Gabriele Margos4, Ira Schwartz2

1 Department of Pathology, New York Medical College, Valhalla, New York, 2 New York Medical College, Valhalla, New York, 3 University of Calgary, Calgary, Alberta, 4 German National Reference Centre for Borrelia, Bavarian Health and Food Safety Authority, Oberschleißheim
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 12C.5
DOI:  10.1002/9780471729259.mc12c05s34
Online Posting Date:  August, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Borrelia burgdorferi sensu lato is a group of spirochetes belonging to the genus Borrelia in the family of Spirochaetaceae. The spirochete is transmitted between reservoirs and hosts by ticks of the family Ixodidae. Infection with B. burgdorferi in humans causes Lyme disease or Lyme borreliosis. Currently, 20 Lyme disease‐associated Borrelia species and more than 20 relapsing fever‐associated Borrelia species have been described. Identification and differentiation of different Borrelia species and strains is largely dependent on analyses of their genetic characteristics. A variety of molecular techniques have been described for Borrelia isolate speciation, molecular epidemiology, and pathogenicity studies. In this unit, we focus on three basic protocols, PCR‐RFLP‐based typing of the rrs‐rrlA and rrfA‐rrlB ribosomal spacer, ospC typing, and MLST. These protocols can be employed alone or in combination for characterization of B. burgdorferi isolates or directly on uncultivated organisms in ticks, mammalian host reservoirs, and human clinical specimens. Curr. Protoc. Microbiol. 34:12C.1‐12C.31. © 2014 by John Wiley & Sons, Inc.

Keywords: spirochetes; molecular typing; OspC; MLST; Borrelia burgdorferi; Lyme disease

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Typing of Borrelia burgdorferi by PCR‐Based RFLP Analysis of the rrs‐rrlA Ribosomal RNA Spacer Locus
  • Alternate Protocol 1: PCR‐RFLP Typing Based on the rrfA‐rrlB Spacer
  • Basic Protocol 2: Genotyping of B. burgdorferi by Outer Surface Protein C (OspC) Sequencing
  • Basic Protocol 3: Multilocus Sequence Typing (MLST) of B. burgdorferi
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Typing of Borrelia burgdorferi by PCR‐Based RFLP Analysis of the rrs‐rrlA Ribosomal RNA Spacer Locus

  Materials
  • 2‐mm skin biopsy samples
  • BSK‐II medium, incomplete (unit 12.1)
  • DNeasy Blood and Tissue Kit (Qiagen) including:
  • Buffer ATL
  • 600 mAU/ml proteinase K
  • Buffer AL
  • Buffer AW1 concentrate
  • Buffer AW2 concentrate
  • Minispin columns
  • 2‐ml collection tubes
  • 96% and 70% ethanol
  • RNase‐free H 2O (e.g., DEPC‐treated; appendix 2A)
  • Anticoagulated whole blood
  • Phosphate‐buffered saline (PBS), pH 7.4
  • B. burgdorferi growing in culture (unit 12.1)
  • Ixodes scapularis ticks (fresh stored in 70% ethanol)
  • 15 mg/ml proteinase K (Roche)
  • Primer P A: 5′‐GGTATGTTTAGTGAGGG‐3′; forward primer 1465‐1481 of the rrs sequence
  • Primer P 95: 5′‐GGTTAGAGCGCAGGTCTG‐3′; reverse primer 941‐924 of the spacer
  • Primer P B: 5′‐CGTACTGGAAAGTGCGGCTG‐3′; forward primer1505‐1524 of the rrs sequence
  • Primer P 97: 5′‐GATGTTCAACTCATCCTGGTCCC‐3′; reverse primer to 908‐886 of the spacer
  • 10 mM (each) 4dNTP mix ( appendix 2A)
  • 5 U/µl Taq DNA polymerase
  • 10× Taq DNA polymerase buffer containing 1.5 mM MgCl 2
  • 10 U/µl MseI restriction endonuclease (New England Biolabs) and 10× NEBuffer 4 with 100 mg/ml BSA; or its isoschizomer Tru1I restriction endonuclease (Fermentas) at 10 U/µl and 10× Fermentas buffer R containing 100 µg/ml BSA
  • 6× DNA loading dye: 30% (v/v) glycerol/0.25% (w/v) bromphenol blue/0.25% (w/v) xylene cyanol
  • Spectrum Brand micro tissue grinders
  • 37°, 56°, 65°C, and 72°C water baths or heat blocks
  • 8 Quickstrip, 0.2‐ml PCR tubes (Phenix Research Products)
  • Thermal cycler
  • Additional equipment for PCR (Kramer and Coen, ) and agarose gel), gel visualization, and gel documentation (Voytas, )
NOTE: Particular care must be taken to prevent cross‐contamination during DNA isolation. Perform all DNA extraction in a designated area in the laboratory, preferably in a dedicated extraction hood. Use barrier filter pipet tips throughout the procedures. Open all reagents as well as boxes of tubes and pipet tips only in the extraction hood. To facilitate detection of contamination among the samples if it occurs, add a “mock” extraction control (essentially an extraction without any DNA sample source) for each set of 10 sample extractions. In addition, a negative (i.e., no‐DNA) control should be included for each set of 10 PCR reactions.

Alternate Protocol 1: PCR‐RFLP Typing Based on the rrfA‐rrlB Spacer

  Additional Materials (also see protocol 1)
  • Primer P 1: 5′‐CTGCGAGTTCGCGGGAGA‐3′; forward primer 77‐95 of the rrfA sequence
  • Primer P 2: 5′‐TCCTAGGCATTCACCATA‐3′; reverse primer 20‐37 of the rrlB sequence
  • 16% acrylamide‐bisacrylamide gel in 1× TBE buffer without stacking gel ( appendix 3M; omit SDS)
  • 0.5 µg/ml ethidium bromide in 1× TBE buffer

Basic Protocol 2: Genotyping of B. burgdorferi by Outer Surface Protein C (OspC) Sequencing

  Materials
  • Specimen (one of the following):
  • 5‐ml culture of B. burgdorferi
  • 1 to 60 g of mouse tissue (ear, heart, bladder, joint)
  • I. scapularis nymphs
  • DNA isolation kit: DNeasy Tissue Kit (Qiagen) for total genomic DNA from ticks or Gentra Puregene DNA isolation kit (Qiagen) for B. burgdorferi or mouse tissues
  • 1 mg/ml collagenase A (Sigma) in PBS, pH 7.4 (see appendix 2A for PBS)
  • 0.2 mg/ml proteinase K (see recipe)
  • 10× PCR buffer with 2.5 mM MgCl 2 (Fermentas)
  • 5 U/µl Taq DNA polymerase (Fermentas)
  • 10 mM (each) 4dNTP mix ( appendix 2A)
  • Primers OC6(+) and OC623 (−) (Table 12.5.1)
  • Positive control: B. burgdorferi genomic DNA which has been previously tested for the presence of ospC
  • Column‐based PCR purification kit (e.g., Qiagen, cat. no. 28106)
  • Centrifuge
  • 55°C water bath or heat block
  • 18‐G, 1½ needles (BD PrecisionGlide)
  • Thermal cycler
  • Multiple sequence alignment program (e.g., DNASTAR)
  • Additional equipment for PCR (Kramer and Coen, ) and agarose gel), gel visualization, and gel documentation (Voytas, )

Basic Protocol 3: Multilocus Sequence Typing (MLST) of B. burgdorferi

  Materials
  • Nuclease‐free (e.g., DEPC‐treated; appendix 2A) double‐distilled H 2O
  • Hot‐Start Taq DNA Polymerase (e.g., HotStarTaq DNA Polymerase, Qiagen)
  • 10× PCR buffer (provided with the Taq polymerase)
  • 20 mM (each) 4dNTP mix ( appendix 2A)
  • Primers for PCR amplification of the MLST genes (Table 12.5.4)
  • HotStar Taq DNA Polymerase Master Mix (Qiagen; already contains Taq polymerase, 2× PCR buffer, dNTPs, and 3 mM MgCl 2)
  • Purified Borrelia DNA isolated from ticks or patients (see protocol 1)
  • ExoSAP (Affymetrix) or a PCR purification kit (Roche, Qiagen, Life Technologies) for PCR clean up
  • 0.2‐ml thin walled PCR tubes
  • Microvolume spectrophotometer: NanoDrop (e.g., Thermo Scientific, PEQLAB)
  • 96‐well PCR plates (e.g., Twin.tec 96 well plate, Eppendorf)
  • Thermal cycler
  • Sequence analysis software (e.g., Lasergene SeqMan from DNASTAR; MEGA; or DNASP)
  • PHYLOViZ 1.0 software
  • goeBURST 1.2.1 software
  • eBURST software
  • MEGA software
  • Additional equipment for PCR (Kramer and Coen, ) and agarose gel), gel visualization, and gel documentation (Voytas, )
Table 2.0.4   MaterialsPrimer Sequences, Size of Amplicon, and Fragment Used for MLST a

Gene 5′‐3′ primer sequence Amplicon size (bp) Size of fragment used for MLST (bp) Primer length (bp) Primer start position in B31 genome T m (°C)
nifS 564
IF b same as outer forward
IR b GTTGGAGCAAGCATTTTATG 719 20 719 54,3
IF/OF b ATGGATTTCAAACAAATAAAAAG 23 1 52,2
OR b GATATTATTGAATTTCTTTTAAG 1027 23 1027 50,4
clpA 579
IF GACAAAGCTTTTGATATTTTAG 24 1255 55
IR CAAAAAAAACATCAAATTTTCTATCTC 823 27 2078 57,6
OF AAAGATAGATTTCTTCCAGAC 21 1237 53,5
OR GAATTTCATCTATTAAAAGCTTTC 981 24 2218 48,3
pyrG 603
IF GATATGGAAAATATTTTATTTATTG 25 448 52,7
IR AAACCAAGACAAATTCCAAG 687 20 1135 52,3
OF GATTGCAAGTTCTGAGAATA 20 391 52,3
OR CAAACATTACGAGCAAATTC 799 20 1190 52,3
recG 651
IF CTTTAATTGAAGCTGGATATC 21 917 53,5
IR CAAGTTGCATTTGGACAATC 722 20 1639 54,3
OF CCCTTGTTGCCTTGCTTTC 19 890 58,4
OR GAAAGTCCAAAACGCTCAG 804 19 1694 55,2
clpX 624
IF AATGTGCCATTTGCAATAGC 20 403 54,3
IR TTAAGAAGACCCTCTAAAATAG 721 22 1124 54,7
OF GCTGCAGAGATGAATGTGCC 20 391 50
OR GATTGATTTCATATAACTCTTTTG 859 24 1250 55
pepX 570
IF TTATTCCAAACCTTGCAATCC 20 449 55,5
IR TGTGCCTGAAGGAACATTTG 648 20 1097 56
OF same as inner forward
OR GTTCCAATGTCAATAGTTTC 791 20 1153 52,3
uvrA 570
IF GCTTAAATTTTTAATTGATGTTGG 24 1434 55
IR CCTATTGGTTTTTGATTTATTTG 677 23 2111 53,9
OF GAAATTTTAAAGGAAATTAAAAGTAG 26 1408 55,2
OR CAAGGAACAAAAACATCTGG 891 20 2299 54,3
rplB 624
IF CGCTATAAGACGACTTTATC 19 40 54,3
IR same as outer reverse 703
OF TGGGTATTAAGACTTATAAGC 21 2
OR GCTGTCCCCAAGGAGACA 741 18 743

 aThese primers (often supplied as 100 pmol/µl stocks) should be diluted to a concentration of approximately 5 pmol/µl.
 bIF = inner forward; IR = inner reverse; OF = outer forward; OR = outer reverse.
NOTE: For the Borrelia MLST/MLSA scheme, the genes listed Table 12.5.3 are employed (Margos et al., ).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Aanensen, D.M. and Spratt, B.G. 2005. The multilocus sequence typing network: mlst.net. Nucleic Acids Res. 33:W728–W733.
  Attie, O., Bruno, J.F., Xu, Y., Qiu, D., Luft, B.J., and Qiu, W.G. 2007. Co‐evolution of the outer surface protein C gene (ospC) and intraspecific lineages of Borrelia burgdorferi sensu stricto in the northeastern United States. Infect. Genet. Evol. 7:1‐12.
  Balmelli, T. and Piffaretti, J.C. 1996. Analysis of the genetic polymorphism of Borrelia burgdorferi sensu lato by multilocus enzyme electrophoresis. Int. J. Syst. Bacteriol. 46:167‐172.
  Baranton, G., Postic, D., Saint Girons, I., Boerlin, P., Piffaretti, J.C., Assous, M., and Grimont, P.A. 1992. Delineation of Borrelia burgdorferi sensu stricto, Borrelia garinii sp. nov., and group VS461 associated with Lyme borreliosis. Int. J. Syst. Bacteriol. 42:378‐383.
  Barbour, A.G. and Hayes, S.F. 1986. Biology of Borrelia species. Microbiol. Rev. 50:381‐400.
  Barbour, A.G. and Travinsky, B. 2010. Evolution and distribution of the ospC gene, a transferable serotype determinant of Borrelia burgdorferi. mBio 1:e00153‐10.
  Bishop, C.J., Aanensen, D.M., Jordan, G.E., Kilian, M., Hanage, W.P., and Spratt, B.G. 2009. Assigning strains to bacterial species via the internet. BMC Biol 7:3.
  Boerlin, P., Peter, O., Bretz, A.G., Postic, D., Baranton, G., and Piffaretti, J.C. 1992. Population genetic analysis of Borrelia burgdorferi isolates by multilocus enzyme electrophoresis. Infect. Immun. 60:1677‐1683.
  Brisson, D. and Dykhuizen, D.E. 2004. ospC diversity in Borrelia burgdorferi: Different hosts are different niches. Genetics 168:713‐722.
  Brisson, D., Baxamusa, N., Schwartz, I., and Wormser, G.P. 2011. Biodiversity of Borrelia burgdorferi strains in tissues of Lyme disease patients. PloS One 6:e22926.
  Bunikis, J., Garpmo, U., Tsao, J., Berglund, J., Fish, D., and Barbour, A.G. 2004. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150:1741‐1755.
  Busch, U., Hizo‐Teufel, C., Boehmer, R., Fingerle, V., Nitschko, H., Wilske, B., and Preac‐Mursic, V. 1996. Three species of Borrelia burgdorferi sensu lato (B. burgdorferi sensu stricto, B afzelii, and B. garinii) identified from cerebrospinal fluid isolates by pulsed‐field gel electrophoresis and PCR. J. Clin. Microbiol. 34:1072‐1078.
  Casjens, S., Palmer, N., van Vugt, R., Mun, H.W., Stevenson, B., Rosa, P., Lathigra, R., Sutton, G., Peterson, J., Dodson, R.J., Haft, D., Hickey, E., Gwinn, M., White, O., and Fraser, M. 2000. A bacterial genome in flux: The twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:490‐516.
  Casjens, S.R., Fraser‐Liggett, C.M., Mongodin, E.F., Qiu, W.G., Dunn, J.J., Luft, B.J., and Schutzer, S.E. 2011. Whole genome sequence of an unusual Borrelia burgdorferi sensu lato isolate. J. Bacteriol. 193:1489‐1490.
  Casjens, S.R., Mongodin, E.F., Qiu, W.G., Luft, B.J., Schutzer, S.E., Gilcrease, E.B., Huang, W.M., Vujadinovic, M., Aron, J.K., Vargas, L.C., Freeman, S., Radune, D., Weidman, J.F., Dimitrov, G.I., Khouri, H.M., Sosa, J.E., Halpin, R.A., Dunn, J.J., and Fraser, C.M. 2012. Genome stability of Lyme disease spirochetes: Comparative genomics of Borrelia burgdorferi plasmids. PloS One 7:e33280.
  Centers for Disease Control and Prevention. 2012. Summary of notifiable diseases—United States, 2010. Morbid. Mortal. Weekly Rep. 59:1‐111.
  Cohan, F.M. 2002. What are bacterial species? Annu. Rev. Microbiol. 56:457‐487.
  Collares‐Pereira, M., Couceiro, S., Franca, I., Kurtenbach, K., Schafer, S.M., Vitorino, L., Goncalves, L., Baptista, S., Vieira, M.L., and Cunha, C. 2004. First isolation of Borrelia lusitaniae from a human patient. J. Clin. Microbiol. 42:1316‐1318.
  Crowder, C.D., Matthews, H.E., Schutzer, S., Rounds, M.A., Luft, B.J., Nolte, O., Campbell, S.R., Phillipson, C.A., Li, F., Sampath, R., Ecker, D.J., and Eshoo, M.W. 2010. Genotypic variation and mixtures of Lyme Borrelia in Ixodes ticks from North America and Europe. PloS One 5:e10650.
  Diza, E., Papa, A., Vezyri, E., Tsounis, S., Milonas, I., and Antoniadis, A. 2004. Borrelia valaisiana in cerebrospinal fluid. Emerg. Infect. Dis. 10:1692‐1693.
  Dykhuizen, D.E., Polin, D.S., Dunn, J.J., Wilske, B., Preac‐Mursic, V., Dattwyler, R.J., and Luft, B.J. 1993. Borrelia burgdorferi is clonal: Implications for taxonomy and vaccine development. Proc. Natl. Acad. Sci. U.S.A. 90:10163‐10167.
  Dykhuizen, D.E., Brisson, D., Sandigursky, S., Wormser, G.P., Nowakowski, J., Nadelman, R.B., and Schwartz, I. 2008. The propensity of different Borrelia burgdorferi sensu stricto genotypes to cause disseminated infections in humans. Am. J. Trop. Med. Hyg. 78:806‐810.
  Enright, M.C. and Spratt, B.G. 1999. Multilocus sequence typing. Trends Microbiol. 7:482‐487.
  Feil, E.J., Li, B.C., Aanensen, D.M., Hanage, W.P., and Spratt, B.G. 2004. eBURST: Inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data. J. Bacteriol. 186:1518‐1530.
  Francisco, A.P., Bugalho, M., Ramirez, M., and Carrico, J.A. 2009. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinform. 10:152.
  Francisco, A.P., Vaz, C., Monteiro, P.T., Melo‐Cristino, J., Ramirez, M., and Carrico, J.A. 2012. PHYLOViZ: Phylogenetic inference and data visualization for sequence based typing methods. BMC Bioinform. 13:87.
  Fraser, C.M., Casjens, S., Huang, W.M., Sutton, G.G., Clayton, R., Lathigra, R., White, O., Ketchum, K.A., Dodson, R., Hickey, E.K., Gwinn, M., Dougherty, B., Tomb, J.F., Fleischmann, R.D., Richardson, D., Peterson, J., Kerlavage, A.R., Quackenbush, J., Salzberg, S., Hanson, M., van Vugt, R., Palmer, N., Adams, M.D., Gocayne, J., and Venter, J.C. 1997. Genomic sequence of a Lyme disease spirochaete, Borrelia burgdorferi. Nature 390:580‐586.
  Fukunaga, M., Okada, K., Nakao, M., Konishi, T., and Sato, Y. 1996. Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of Lyme disease borreliae. Int. J. System. Bacteriol. 46:898‐905.
  Gern, L., Douet, V., Lopez, Z., Rais, O., and Cadenas, F.M. 2010. Diversity of Borrelia genospecies in Ixodes ricinus ticks in a Lyme borreliosis endemic area in Switzerland identified by using new probes for reverse line blotting. Ticks Tick Borne Dis. 1:23‐29.
  Guner, E.S., Watanabe, M., Hashimoto, N., Kadosaka, T., Kawamura, Y., Ezaki, T., Kawabata, H., Imai, Y., Kaneda, K., and Masuzawa, T. 2004. Borrelia turcica sp. nov., isolated from the hard tick Hyalomma aegyptium in Turkey. Int. J. Syst. Evol. Microbiol. 54:1649‐1652.
  Hanincova, K., Liveris, D., Sandigursky, S., Wormser, G.P., and Schwartz, I. 2008. Borrelia burgdorferi sensu stricto is clonal in patients with early Lyme borreliosis. Appl. Environ. Microbiol. 74:5008‐5014.
  Hanincova, K., Mukherjee, P., Ogden, N.H., Margos, G., Wormser, G.P., Reed, K.D., Meece, J.K., Vandermause, M.F., and Schwartz, I. 2013. Multilocus sequence typing of Borrelia burgdorferi suggests existence of lineages with differential pathogenic properties in humans. PloS One 8:e73066.
  Hoen, A.G., Margos, G., Bent, S.J., Kurtenbach, K., and Fish, D. 2009. Phylogeography of Borrelia burgdorferi in the eastern United States reflects multiple independent Lyme disease emergence events. Proc. Natl. Acad. Sci. U.S.A. 106:15013‐15018.
  Holt, J.G. 1994. The spirochetes. In Bergey's Manual of Determinative Bacteriology, Vol. 9 (J.G. Holt, N.R. Krieg, P.H.A. Sneath, J.T. Staley, and S.T. Williams, eds.) pp. 27‐36. Williams and Wilkins, Baltimore.
  Ivanova, L.B., Tomova, A., González‐Acuña, D., Murúa, R., Moreno, C.X., Hernández, C., Cabello, J., Cabello, C., Daniels, T.J., Godfrey, H.P., and Cabello, F.C. 2014. Borrelia chilensis, a new member of the Borrelia burgdorferi sensu lato complex that extends the range of this genospecies in the Southern Hemisphere. Environ. Microbiol. 16:1069‐1080.
  Johnson, R.C. 1984. Borrelia burgdorferi sp. nov.: Etiological agent of Lyme disease. Int. J. System. Bacteriol. 34:496‐497.
  Kawabata, H., Masuzawa, T., and Yanagihara, Y. 1993. Genomic analysis of Borrelia japonica sp. nov. isolated from Ixodes ovatus in Japan. Microbiol. Immunol. 37:843‐848.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Krieg, N.R.S., J.T., Brown, D.R., Hedlund, B.P., Paster, B.J., Ward, N.L., Ludwig, W., and Whitman, W.B. 2010. The Bacteroidetes, Spirochaetes, Tenericutes (Mollicutes), Acidobacteria, Fibrobacteres, Fusobacteria, Dictyoglomi, Gemmatimonadetes, Lentisphaerae, Verrucomicrobia, Chlamydiae, and Planctomycetes, 2nd ed., Vol. 4. Springer, New York.
  Kuehn, B.M. 2013. CDC estimates 300,000 US cases of Lyme disease annually. JAMA 310:1110.
  Kurtenbach, K., Peacey, M., Rijpkema, S.G., Hoodless, A.N., Nuttall, P.A., and Randolph, S.E. 1998. Differential transmission of the genospecies of Borrelia burgdorferi sensu lato by game birds and small rodents in England. Appl. Environ. Microbiol. 64:1169‐1174.
  Lin, T., Oliver, J.H., Jr., Gao, L., Kollars, T.M., Jr., and Clark, K.L. 2001. Genetic heterogeneity of Borrelia burgdorferi sensu lato in the southern United States based on restriction fragment length polymorphism and sequence analysis. J. Clin. Microbiol. 39:2500‐2507.
  Liveris, D., Gazumyan, A., and Schwartz, I. 1995. Molecular typing of Borrelia burgdorferi sensu lato by PCR‐restriction fragment length polymorphism analysis. J. Clin. Microbiol. 33:589‐595.
  Liveris, D., Wormser, G.P., Nowakowski, J., Nadelman, R.B., Bittker, S., Cooper, D., Varde, S., Moy, F.H., Forseter, G., Pavia, C.S., and Schwartz, I. 1996. Molecular typing of Borrelia burgdorferi from Lyme disease patients by PCR‐restriction fragment length polymorphism analysis. J. Clin. Microbiol. 34:1306‐1309.
  Liveris, D., Varde, S., Iyer, R., Koenig, S., Bittker, S., Cooper, D., McKenna, D., Nowakowski, J., Nadelman, R.B., Wormser, G.P., and Schwartz, I. 1999. Genetic diversity of Borrelia burgdorferi in Lyme disease patients as determined by culture versus direct PCR with clinical specimens. J. Clin. Microbiol. 37:565‐569.
  Lunemann, J.D., Zarmas, S., Priem, S., Franz, J., Zschenderlein, R., Aberer, E., Klein, R., Schouls, L., Burmester, G.R., and Krause, A. 2001. Rapid typing of Borrelia burgdorferi sensu lato species in specimens from patients with different manifestations of Lyme borreliosis. J. Clin. Microbiol. 39:1130‐1133.
  Maiden, M.C., Bygraves, J.A., Feil, E., Morelli, G., Russell, J.E., Urwin, R., Zhang, Q., Zhou, J., Zurth, K., Caugant, D.A., Feavers, I.M., Achtman, M., and Spratt, B.G. 1998. Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms. Proc. Natl. Acad. Sci. U.S.A. 95:3140‐3145.
  Marconi, R.T., Liveris, D., and Schwartz, I. 1995. Identification of novel insertion elements, restriction fragment length polymorphism patterns, and discontinuous 23S rRNA in Lyme disease spirochetes: Phylogenetic analyses of rRNA genes and their intergenic spacers in Borrelia japonica sp. nov. and genomic group 21038 (Borrelia andersonii sp. nov.) isolates. J. Clin. Microbiol. 33:2427‐2434.
  Margos, G., Gatewood, A.G., Aanensen, D.M., Hanincova, K., Terekhova, D., Vollmer, S.A., Cornet, M., Piesman, J., Donaghy, M., Bormane, A., Hurn, M.A., Feil, E.J., Fish, D., Casjens, S., Wormser, G.P., Schwartz, I., and Kurtenbach, K. 2008. MLST of housekeeping genes captures geographic population structure and suggests a European origin of Borrelia burgdorferi. Proc. Natl. Acad. Sci. U.S.A. 105:8730‐8735.
  Margos, G., Vollmer, S.A., Cornet, M., Garnier, M., Fingerle, V., Wilske, B., Bormane, A., Vitorino, L., Collares‐Pereira, M., Drancourt, M., and Kurtenbach, K. 2009. A new Borrelia species defined by multilocus sequence analysis of housekeeping genes. Appl. Environ. Microbiol. 75:5410‐5416.
  Margos, G., Hojgaard, A., Lane, R.S., Cornet, M., Fingerle, V., Rudenko, N., Ogden, N., Aanensen, D.M., Fish, D., and Piesman, J. 2010. Multilocus sequence analysis of Borrelia bissettii strains from North America reveals a new Borrelia species, Borrelia kurtenbachii. Ticks Tick‐Borne Dis. 1:151‐158.
  Margos, G., Vollmer, S.A., Ogden, N.H., and Fish, D. 2011. Population genetics, taxonomy, phylogeny and evolution of Borrelia burgdorferi sensu lato. Infect. Genet. Evol. 11:1545‐1563.
  Margos, G., Tsao, J.I., Castillo‐Ramirez, S., Girard, Y.A., Hamer, S.A., Hoen, A.G., Lane, R.S., Raper, S.L., and Ogden, N.H. 2012. Two boundaries separate Borrelia burgdorferi populations in North America. Appl. Environ. Microbiol. 78:6059‐6067.
  Margos, G., Wilske, B., Sing, A., Hizo‐Teufel, C., Cao, W.C., Chu, C., Scholz, H., Straubinger, R.K., and Fingerle, V. 2013. Borrelia bavariensis sp. nov. is widely distributed in Europe and Asia. Int. J. Syst. Evol. Microbiol. 63:4284‐4288.
  Margos, G., Piesman, J., Lane, R.S., Ogden, N.H., Sing, A., Straubinger, R.K., and Fingerle, V. 2014. Borrelia kurtenbachii sp. nov.: A widely distributed member of the Borrelia burgdorferi sensu lato species complex in North America. Int. J. Syst. Evol. Microbiol. 64:128‐130.
  Mukhacheva, T.A. and Kovalev, S.Y. 2013. Multilocus sequence analysis of Borrelia burgdorferi s.l. in Russia. Ticks Tick‐Borne Dis. 4:275‐279.
  Ogden, N.H., Margos, G., Aanensen, D.M., Drebot, M.A., Feil, E.J., Hanincová, K., Schwartz, I., Tyler, S., and Lindsay, L.R. 2011. Investigation of genotypes of Borrelia burgdorferi in Ixodes scapularis ticks collected in surveillance in Canada. Appl. Environ. Microbiol. 77:3244‐3254.
  Ogden, N.H., Mechai, S., and Margos, G. 2013. Changing geographic ranges of ticks and tick‐borne pathogens: Drivers, mechanisms and consequences for pathogen diversity. Front. Cell Infect. Microbiol. 3:46.
  Ojaimi, C., Davidson, B.E., Saint Girons, I., and Old, I.G. 1994. Conservation of gene arrangement and an unusual organization of rRNA genes in the linear chromosomes of the Lyme disease spirochaetes Borrelia burgdorferi, B. garinii and B. afzelii. Microbiology 140:2931‐2940.
  Orloski, K.A., Hayes, E.B., Campbell, G.L., and Dennis, D.T. 2000. Surveillance for Lyme disease—United States, 1992–1998. Morb. Mortal. Wkly Rep. 49:1‐11.
  Postic, D., Assous, M.V., Grimont, P.A., and Baranton, G. 1994. Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length polymorphism of rrf (5S)‐rrl (23S) intergenic spacer amplicons. Int. J. Syst. Bacteriol. 44:743‐752.
  Postic, D., Assous, M., Belfaiza, J., and Baranton, G. 1996. Genetic diversity of Borrelia of Lyme borreliosis. Wien. Klin. Wochenschr. 108:748‐751.
  Postic, D., Garnier, M., and Baranton, G. 2007. Multilocus sequence analysis of atypical Borrelia burgdorferi sensu lato isolates—description of Borrelia californiensis sp. nov., and genomospecies 1 and 2. Int. J. Med. Microbiol. 297:263‐271.
  Qiu, W.G., Dykhuizen, D.E., Acosta, M.S., and Luft, B.J. 2002. Geographic uniformity of the Lyme disease spirochete (Borrelia burgdorferi) and its shared history with tick vector (Ixodes scapularis) in the Northeastern United States. Genetics 160:833‐849.
  Rauter, C., Oehme, R., Diterich, I., Engele, M., and Hartung, T. 2002. Distribution of clinically relevant Borrelia genospecies in ticks assessed by a novel, single‐run, real‐time PCR. J. Clin. Microbiol. 40:36‐43.
  Richter, D., Postic, D., Sertour, N., Livey, I., Matuschka, F.R., and Baranton, G. 2006. Delineation of Borrelia burgdorferi sensu lato species by multilocus sequence analysis and confirmation of the delineation of Borrelia spielmanii sp. nov. Int. J. Syst. Evol. Microbiol. 56:873‐881.
  Rijpkema, S.G., Molkenboer, M.J., Schouls, L.M., Jongejan, F., and Schellekens, J.F. 1995. Simultaneous detection and genotyping of three genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by characterization of the amplified intergenic spacer region between 5S and 23S rRNA genes. J. Clin. Microbiol. 33:3091‐3095.
  Rudenko, N., Golovchenko, M., Grubhoffer, L., and Oliver, J.H. Jr. 2011. Borrelia carolinensis sp. nov., a novel species of the Borrelia burgdorferi sensu lato complex isolated from rodents and a tick from the south‐eastern USA. Int. J. Syst. Evol. Microbiol. 61:381‐383.
  Rudenko, N., Golovchenko, M., Ruzek, D., Piskunova, N., Mallatova, N., and Grubhoffer, L. 2009a. Molecular detection of Borrelia bissettii DNA in serum samples from patients in the Czech Republic with suspected borreliosis. FEMS Microbiol. Lett. 292:274‐281.
  Rudenko, N., Golovchenko, M., Lin, T., Gao, L., Grubhoffer, L., and Oliver, J.H., Jr. 2009b. Delineation of a new species of the Borrelia burgdorferi sensu lato complex, Borrelia americana sp. nov. J. Clin. Microbiol. 47:3875‐3880.
  Schwartz, J.J., Gazumyan, A., and Schwartz, I. 1992. rRNA gene organization in the Lyme disease spirochete, Borrelia burgdorferi. J. Bacteriol. 174:3757‐3765.
  Seinost, G., Dykhuizen, D.E., Dattwyler, R.J., Golde, W.T., Dunn, J.J., Wang, I.N., Wormser, G.P., Schriefer, M.E., and Luft, B.J. 1999. Four clones of Borrelia burgdorferi sensu stricto cause invasive infection in humans. Infect. Immun. 67:3518‐3524.
  Spratt, B.G. 1999. Multilocus sequence typing: Molecular typing of bacterial pathogens in an era of rapid DNA sequencing and the internet. Curr. Opin. Microbiol. 2:312‐316.
  Stanek, G. and Reiter, M. 2011. The expanding Lyme Borrelia complex—clinical significance of genomic species? Clin. Microbiol. Infect. 17:487‐493.
  Stanek, G., Wormser, G.P., Gray, J., and Strle, F. 2011. Lyme borreliosis. Lancet 379:461‐473.
  Stewart, P.E., Wang, X., Bueschel, D.M., Clifton, D.R., Grimm, D., Tilly, K., Carroll, J.A., Weis, J.J., and Rosa, P.A. 2006. Delineating the requirement for the Borrelia burgdorferi virulence factor OspC in the mammalian host. Infect. Immun. 74:3547‐3553.
  Takano, A., Nakao, M., Masuzawa, T., Takada, N., Yano, Y., Ishiguro, F., Fujita, H., Ito, T., Ma, X., Oikawa, Y., Kawamori, F., Kumagai, K., Mikami, T., Hanaoka, N., Ando, S., Honda, N., Taylor, K., Tsubota, T., Konnai, S., Watanabe, H., Ohnishi, M., and Kawabata, H. 2011. Multilocus sequence typing implicates rodents as the main reservoir host of human‐pathogenic Borrelia garinii in Japan. J. Clin. Microbiol. 49:2035‐2039.
  Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. 2011. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28:2731‐2739.
  Theisen, M., Borre, M., Mathiesen, M.J., Mikkelsen, B., Lebech, A.M., and Hansen, K. 1995. Evolution of the Borrelia burgdorferi outer surface protein OspC. J. Bacteriol. 177:3036‐3044.
  Tilly, K., Krum, J.G., Bestor, A., Jewett, M.W., Grimm, D., Bueschel, D., Byram, R., Dorward, D., Vanraden, M.J., Stewart, P., and Rosa, P. 2006. Borrelia burgdorferi OspC protein required exclusively in a crucial early stage of mammalian infection. Infect. Immun. 74:3554‐3564.
  Urwin, R. and Maiden, M.C. 2003. Multi‐locus sequence typing: A tool for global epidemiology. Trends Microbiol. 11:479‐487.
  van Dam, A.P., Kuiper, H., Vos, K., Widjojokusumo, A., de Jongh, B.M., Spanjaard, L., Ramselaar, A.C., Kramer, M.D., and Dankert, J. 1993. Different genospecies of Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme borreliosis. Clin. Infect. Dis. 17:708‐717.
  Vitorino, L.R., Margos, G., Feil, E.J., Collares‐Pereira, M., Ze‐Ze, L., and Kurtenbach, K. 2008. Fine‐scale phylogeographic structure of Borrelia lusitaniae revealed by multilocus sequence typing. PloS One 3:e4002.
  Vollmer, S.A., Bormane, A., Dinnis, R.E., Seelig, F., Dobson, A.D., Aanensen, D.M., James, M.C., Donaghy, M., Randolph, S.E., Feil, E.J., Kurtenbach, K., and Margos, G. 2011. Host migration impacts on the phylogeography of Lyme borreliosis spirochaete species in Europe. Environ. Microbiol. 13:184‐192.
  Vollmer, S.A., Feil, E.J., Chu, C.Y., Raper, S.L., Cao, W.C., Kurtenbach, K., and Margos, G. 2013. Spatial spread and demographic expansion of Lyme borreliosis spirochaetes in Eurasia. Infect. Genet. Evol. 14C:147‐155.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Wang, G. and Schwartz, I. 2011. Genus Borrelia. In Bergey's Manual of Systematic Bacteriology, Vol. 4: The Bacteroidetes, Spirochaetes, Tenericutes (Mollicutes), Acidobacteria, Fibrobacteres, Fusobacteria, Dictyoglomi, Gemmatimonadetes, Lentisphaerae, Verrucomicrobia, Chlamydiae, and Planctomycetes 2nd ed. (N.R.S. Krieg, J.T. Staley, D.R. Brown, B.P. Hedlund, B.J. Paster, N.L. Ward, W. Ludwig, and W.B. Whitman, eds.) pp. 484‐531. Springer, New York.
  Wang, G., van Dam, A.P., Le Fleche, A., Postic, D., Peter, O., Baranton, G., de Boer, R., Spanjaard, L., and Dankert, J. 1997. Genetic and phenotypic analysis of Borrelia valaisiana sp. nov. (Borrelia genomic groups VS116 and M19). Int. J. Syst. Bacteriol. 47:926‐932.
  Wang, G., van Dam, A.P., Spanjaard, L., and Dankert, J. 1998. Molecular typing of Borrelia burgdorferi sensu lato by randomly amplified polymorphic DNA fingerprinting analysis. J. Clin. Microbiol. 36:768‐776.
  Wang, G., van Dam, A.P., Schwartz, I., and Dankert, J. 1999. Molecular typing of Borrelia burgdorferi sensu lato: Taxonomic, epidemiological, and clinical implications. Clin. Microbiol. Rev. 12:633‐653.
  Wang, G., Ojaimi, C., Iyer, R., Saksenberg, V., McClain, S.A., Wormser, G.P., and Schwartz, I. 2001. Impact of genotypic variation of Borrelia burgdorferi sensu stricto on kinetics of dissemination and severity of disease in C3H/HeJ mice. Infect. Immun. 69:4303‐4312.
  Wang, G., Ojaimi, C., Wu, H., Saksenberg, V., Iyer, R., Liveris, D., McClain, S.A., Wormser, G.P., and Schwartz, I. 2002. Disease severity in a murine model of Lyme borreliosis is associated with the genotype of the infecting Borrelia burgdorferi sensu stricto strain. J. Infect. Dis. 186:782‐791.
  Wang, I.N., Dykhuizen, D.E., Qiu, W., Dunn, J.J., Bosler, E.M., and Luft, B.J. 1999. Genetic diversity of ospC in a local population of Borrelia burgdorferi sensu stricto. Genetics 151:15‐30.
  Wayne, L.G., Brenner, D.J., Colwell, R.R., Grimont, P.A.D., Kandler, O., Krichevsky, M.I., Moore, L.H., Moore, W.E.C., Murray, R.G.E., Stackebrandt, E., Starr, M.P., and Truper, H.G. 1987. Report of the ad hoc committee on reconciliation of approaches to bacterial systematics. Int. J. Syst. Bacteriol. 37:463‐464.
  Welsh, J., Pretzman, C., Postic, D., Saint Girons, I., Baranton, G., and McClelland, M. 1992. Genomic fingerprinting by arbitrarily primed polymerase chain reaction resolves Borrelia burgdorferi into three distinct phyletic groups. Int. J. Syst. Bacteriol. 42:370‐377.
  Wormser, G.P., Liveris, D., Nowakowski, J., Nadelman, R.B., Cavaliere, L.F., McKenna, D., Holmgren, D., and Schwartz, I. 1999. Association of specific subtypes of Borrelia burgdorferi with hematogenous dissemination in early Lyme disease. J. Infect. Dis. 180:720‐725.
  Wormser, G.P., Brisson, D., Liveris, D., Hanincova, K., Sandigursky, S., Nowakowski, J., Nadelman, R.B., Ludin, S., and Schwartz, I. 2008. Borrelia burgdorferi genotype predicts the capacity for hematogenous dissemination during early Lyme disease. J. Infect. Dis. 198:1358‐1364.
  Xu, G., Wesker, J., White, C., Campbell, J., Reich, N.G., and Rich, S.M. 2013. Detection of heterogeneity of Borrelia burgdorferi in ixodes ticks by culture‐dependent and culture‐independent methods. J. Clin. Microbiol. 51:615‐617.
  Xu, Y. and Johnson, R.C. 1995. Analysis and comparison of plasmid profiles of Borrelia burgdorferi sensu lato strains. J. Clin. Microbiol. 33:2679‐2685.
Internet Resources
  http://borrelia.mlst.net
  Borrelia burgdorferi MLST database,
  http://www.phyloviz.net/beta/Tutorial.html
  Phyloviz tutorial.
  http://www.phyloviz.net/wiki/tutorial/
  eBURST tutorial.
  http://eburst.mlst.net/v3/instructions/
  MEGA tutorial.
  http://www.megasoftware.net/tutorial.php
  DNASP tutorial.
  http://www.ub.edu/dnasp/DnaSPHelp.pdf
  Spatial epidemiology tutorial.
  http://www.spatialepidemiology.net/
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library