Hamster Model of Leptospirosis

David A. Haake1

1 Veterans Affairs, Greater Los Angeles, Healthcare, Los Angeles, California
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 12E.2
DOI:  10.1002/9780471729259.mc12e02s02
Online Posting Date:  September, 2006
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This unit describes the techniques involved in the hamster model of leptospirosis. Hamsters are exquisitely susceptible to infection with pathogenic Leptospira species. The LD50 of virulent Leptospiral strains by intraperitoneal inoculation of 3‐ to 4‐week‐old hamsters is as low as a single organism. The pathogenesis of severe leptospirosis in the hamster is a model of accidental infections observed in nature in many mammals, including humans. Animal husbandry issues and the reproducibility of the hamster model make it the animal model of choice for Leptospiral vaccine and antibiotic treatment studies.

Keywords: Leptospira; Leptospirosis; Leptospiraceae; Hamsters; Golden Syrian; Mesocricetus

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Strategic Planning
  • Basic Protocol 1: Intraperitoneal Challenge of Hamsters with Leptospira
  • Basic Protocol 2: Harvesting Blood and Tissues for Assessment of Leptospira Infection
  • Basic Protocol 3: Detection of Leptospiral Infection
  • Alternate Protocol 1: Quantification of Infection Levels Using Real‐Time PCR
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Intraperitoneal Challenge of Hamsters with Leptospira

  Materials
  • 3‐ to 4‐week‐old Golden Syrian hamsters (Harlan Bioproducts for Science)
  • Log‐phase Leptospira culture for challenge (unit 12.1): low‐passage, virulent strain (e.g., L. interrogans serovar Copenhageni strain L1‐130 or L. kirschneri serovar Grippotyphosa strain RM52)
  • EMJH liquid medium (see recipe)
  • Hamster cages, solid‐bottom, with filter top to prevent escape of contaminated bedding (e.g., Ancare; http://www.ancare.com)
  • Hamster bedding (Sani‐Chips; P.J. Murphy Forest Products, http://www.pjmurphy.net/)
  • Dark‐field microscope (unit 2.1)
  • Petroff‐Hausser counting chamber or equivalent (also see appendix 4A)
  • 1‐ml syringes
  • 22‐G needles
  • Additional reagents and equipment for intraperitoneal injection (Donovan and Brown, )

Basic Protocol 2: Harvesting Blood and Tissues for Assessment of Leptospira Infection

  Materials
  • Hamsters infected with Leptospira (see protocol 1)
  • Isoflurane
  • Small, sealable container (e.g., Tupperware) to accommodate hamster for anesthesia
  • Gauze or cotton sponges
  • 50‐ml conical polypropylene centrifuge tubes
  • Dissecting equipment: two sets of dissecting scissors, tweezers, and scalpel
  • Additional reagents and equipment for blood collection by cardiac puncture (Donovan and Brown, )
NOTE: All reagents and equipment coming into contact with living cells must be sterile, and aseptic technique should be used accordingly.

Basic Protocol 3: Detection of Leptospiral Infection

  Materials
  • Blood and organs from Leptospira‐infected hamster (and blood from uninfected hamster as control in serological procedure)
  • Semisolid Leptospira medium with 5‐fluorouracil (see recipe)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • Culture of late logarithmic growth–phase Leptospira (unit 12.1)
  • Neutral buffered formalin (e.g., Fisher)
  • 70% (v/v) ethanol
  • Steiner‐Steiner silver staining kit (optional; e.g., Sigma)
  • Stomacher bags (e.g., Thomas Scientific)
  • Microscope with dark‐field optics (unit 2.1)
  • Dedicated histopathology facility (optional)
  • Additional reagents and equipment for paraffin‐embedding and sectioning of tissues (Zeller, ), hematoxylin/eosin staining (Zeller and Rogers, ), and Steiner‐Steiner silver staining (Steiner and Steiner, ; reagents available as kit from Sigma and other histology suppliers)
NOTE: All reagents and equipment coming into contact with living cells must be sterile, and aseptic technique should be used accordingly.

Alternate Protocol 1: Quantification of Infection Levels Using Real‐Time PCR

  • QIAamp Blood Kit (Qiagen)
  • DNeasy Tissue Kit (Qiagen)
  • TaqMan Universal PCR Master Mix (Applied Biosystems)
  • PCR primers:
    • Lepto F (5′‐CCCGCGTCCGATTAG‐3′)
    • Lepto R (5′‐TCCATTGTGGCCGRACAC‐3′)
  • TaqMan probe (Applied Biosystems):
    • [5′ (FAM)‐CTCACCAAGGCGACGATCGGTAGC‐(TAMRA) 3′]
  • Negative control: genomic DNA (Wilson, ) extracted from the nonpathogen L. biflexa (ATCC # 23582)
  • Positive control dilution series: genomic DNA (Wilson, ) extracted from serial dilutions containing 108 to 100 cells/ml of the Leptospira challenge strain
  • TE buffer
  • 96‐well PCR plate
  • ABI Prism 7700 Sequence Detection System (Applied Biosystems) with dedicated real‐time PCR software
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Barnett, J.K., Barnett, D., Bolin, C.A., Summers, T.A., Wagar, E.A., Cheville, N.F., Hartskeerl, R.A., and Haake, D.A. 1999. Expression and distribution of Leptospiral outer membrane components during renal infection of hamsters. Infect. Immun. 67:853‐861.
   Bolin, C.A. and Alt, D.P. 2001. Use of a monovalent Leptospiral vaccine to prevent renal colonization and urinary shedding in cattle exposed to Leptospira borgpetersenii serovar hardjo. Am. J. Vet. Res. 62:995‐1000.
   Donovan, J. and Brown, P. 2006a. Handling and restraint. In Current Protocols in Immunology (J.E. Coligan, B. Bierer, D.H. Margulies, and W. Strober, eds.) pp. 1.3.1‐1.3.6. John Wiley & Sons, Hoboken, N.J.
   Donovan, J. and Brown, P. 2006b. Parenteral injections. In Current Protocols in Immunology (J.E. Coligan, B. Bierer, D.H. Margulies, and W. Strober, eds.) pp. 1.6.1‐1.6.9. John Wiley & Sons, Hoboken, N.J.
   Donovan, J. and Brown, P. 2006c. Blood collection. In Current Protocols in Immunology (J.E. Coligan, B. Bierer, D.H. Margulies, and W. Strober, eds.) pp. 1.7.1‐1.7.9. John Wiley & Sons, Hoboken, N.J.
   Faine, S. 1957a. Virulence in Leptospira. I: Reactions of guinea pigs to experimental infection with Leptospira icterohaemorrhagiae. Brit. J. Exp. Pathol. 38:1‐7.
   Faine, S. 1957b. Virulence in Leptospira. II: The growth in vivo of virulent Leptospira icterohaemorrhagiae. Brit. J. Exp. Pathol. 38:8‐14.
   Faine, S. 1962. The growth of Leptospira australis B in the kidneys of mice in the incipient experimental carrier state. J. Hyg. 60:435‐442.
   Faine, S., Adler, B., Bolin, C., and Perolat, P. 1999. Leptospira and leptospirosis, 2nd ed. MediSci, Melbourne, Australia.
   Ferguson, L.C., and Hamdy, A.H. 1957. Virulence of Leptospira pomona in hamsters and cattle . Am. J. Vet. Res. 18:35‐42.
   Haake, D.A., Mazel, M.K., McCoy, A.M., Milward, F., Chao, G., Matsunaga, J., and Wagar, E.A. 1999. Leptospiral outer membrane proteins OmpL1 and LipL41 exhibit synergistic immunoprotection . Infect. Immun. 67:6572‐6582.
   Koizumi, N. and Watanabe, H. 2004. Leptospiral immunoglobulin‐like proteins elicit protective immunity. Vaccine 22:1545‐1552.
   Lewis, C. and Gray, J.E. 1961. Experimental Leptospira pomona infection in the Mongolian gerbil (Meriones unguiculatus). J. Infect. Dis. 109:194‐204.
   Miller, C.D., Songer, J.R., and Sullivan, J.F. 1987. A twenty‐five year review of laboratory‐acquired human infections at the National Animal Disease Center. Am. Ind. Hyg. Assoc. J. 48:271‐275.
   Miller, N.G., and Wilson, R.B. 1966. Electron microscopy of the liver of the hamster during acute and chronic leptospirosis. Am. J. Vet. Res. 27:1071‐1081.
   Nally, J.E., Chantranuwat, C., Wu, X.Y., Fishbein, M.C., Pereira, M.M., Da Silva, J.J., Blanco, D.R., and Lovett, M.A. 2004. Alveolar septal deposition of immunoglobulin and complement parallels pulmonary hemorrhage in a guinea pig model of severe pulmonary leptospirosis. Am. J. Pathol. 164:1115‐1127.
   Pereira, M.M., Andrade, J., Marchevsky, R.S., and Ribeiro dos Santos, R. 1998. Morphological characterization of lung and kidney lesions in C3H/HeJ mice infected with Leptospira interrogans serovar icterohaemorrhagiae: Defect of CD4+ and CD8+ T‐cells are prognosticators of the disease progression. Exp. Toxicol. Pathol. 50:191‐198.
   Pike, R.M. 1976. Laboratory‐associated infections: Summary and analysis of 3921 cases. Health Lab. Sci. 13:105‐114.
   Stavitsky, A.B. 1945. Studies on the pathogenesis of leptospirosis. J. Infect. Dis. 76:179‐192.
   Smythe, L.D., Smith, I.L., Smith, G.A., Dohnt, M.F., Symonds, M.L., Barnett, L.J., and McKay, D.B. 2002. A quantitative PCR (TaqMan) assay for pathogenic Leptospira spp. BMC Infect. Dis. 2:13.
   Steiner, G. and Steiner, G. 1944. New simple silver stain for demonstration of bacteria, spirochetes, and fungi in sections of paraffin embedded tissue blocks. J. Lab. Clin. Med. 29:868‐871.
   Truccolo, J., Charavay, F., Merien, F., and Perolat, P. 2002. Quantitative PCR assay to evaluate ampicillin, ofloxacin, and doxycycline for treatment of experimental leptospirosis. Antimicrob. Agents Chemother. 46:848‐853.
   van den Ingh, T.S., and Hartman, E.G. 1986. Pathology of acute Leptospira interrogans serotype icterohaemorrhagiae infection in the Syrian hamster. Vet. Microbiol. 12:367‐376.
   Wilson, K. 1997. Preparation of genomic DNA from bacteria. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 2.4.1‐2.4.5. John Wiley & Sons, Hoboken, N.J.
   Zeller, R. 1989. Fixation, embedding, and sectioning of tissues, embryos, and single cells. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 14.1.1‐14.1.8. John Wiley & Sons, Hoboken, N.J.
   Zeller R. and Rogers, M. 1993. Counterstaining and mounting of autoradiographed in situ hybridization slides. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 14.5.1‐14.5.5. John Wiley & Sons, Hoboken, N.J.
Key References
   Faine et al., 1999. See above.
  This monograph contains a wealth of detailed information and useful commentary and is an invaluable resource that should be on hand in any laboratory that works with animal models of leptospirosis.
   Richmond, J.Y. and McKinney, W. 1999. Biosafety in Microbiological and Biomedical Laboratories, 4th ed. US Government Printing Office, Washington, D.C.
  Printed version of important safety document, also available online (see ).
Internet Resources
   http://www.cdc.gov/od/ohs/biosfty/bmbl4/bmbl4toc.htm
  Web site for the guide to Biosafety in Microbiological and Biomedical Laboratories, 4th Edition (Richmond and McKinney, ; see ).
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library