Genetic Manipulation of Leptospira biflexa

Hélène Louvel1, Mathieu Picardeau1

1 Unité de Biologie des Spirochètes Institut Pasteur, Paris, France
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 12E.4
DOI:  10.1002/9780471729259.mc12e04s05
Online Posting Date:  June, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The genus Leptospira belongs to the order Spirochaetales and is composed of both saprophytic and pathogenic members, such as Leptospirabiflexa and L. interrogans, respectively. A major factor contributing to our ignorance of spirochetal biology has been the lack of methods available for genetic analysis of these organisms. In recent years, an E. coliL. biflexa shuttle vector has been constructed and a system for targeted mutagenesis and random transposon mutagenesis of the saprophyte L. biflexa has been developed. These studies enable the use of L. biflexa as a model bacterium among spirochetes.

Keywords: spirochetes; Leptospira; electrotransformation; genetics; mutagenesis; transposon; allelic exchange

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Preparation and Transformation of Electrocompetent Leptospira biflexa
  • Basic Protocol 2: Introduction of E. coli‐L. biflexa Shuttle Vector into L. biflexa For Complementation of Mutants or Heterologous Gene Expression
  • Basic Protocol 3: Targeted Mutagenesis by Homologous Recombination
  • Basic Protocol 4: Counterselection of Leptospira biflexa Using rpsL+
  • Basic Protocol 5: Genome‐Wide Transposon Mutagenesis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation and Transformation of Electrocompetent Leptospira biflexa

  Materials
  • L. biflexa serovar Patoc strain Patoc1 (National Reference Center for Leptospira, Institut Pasteur, Paris, France)
  • EMJH liquid medium (see recipe)
  • Sterile water (B. Braun)
  • Plasmid DNA (see Basic Protocols protocol 22, protocol 33, protocol 44, and protocol 55; Fig. ), salt‐free
  • EMJH agar plates supplemented with the appropriate antibiotic (see recipe)
  • 30°C shaker and incubator
  • 50‐ml polypropylene centrifuge tubes (Corning)
  • 0.2‐cm electroporation cuvettes (Bio‐Rad), chilled
  • Electroporator (Bio‐Rad, Gene Pulser)
  • 15‐ml polypropylene tubes (Falcon), sterile

Basic Protocol 2: Introduction of E. coli‐L. biflexa Shuttle Vector into L. biflexa For Complementation of Mutants or Heterologous Gene Expression

  Materials
  • Suicide plasmid (for example, a pGEM7Z‐f+ Promega derivative plasmid that replicates in E. coli but not in Leptospira species) containing the gene of interest interrupted by a kanamycin or spectinomycin resistance cassette (Fig. )
  • Tris·Cl, pH 8.0 ( appendix 2A)
  • PCR primers flanking the insertion site of the resistance cassette in the targeted gene (Fig. )
  • UV chamber (GS Gene linker, Bio‐Rad)
  • 100°C water bath
  • Additional reagents and equipment for preparation and transformation of electrocompetent Leptospirabiflexa ( protocol 1) and PCR (Kramer and Coen, )

Basic Protocol 3: Targeted Mutagenesis by Homologous Recombination

  Materials
  • L. biflexa serovar Patoc strain Patoc1 resistant to streptomycin (National Reference Center for Leptospira, Institut Pasteur, Paris, France)
  • Primer LpR1 (5′‐ TACAAAATGTCGCTATCTGG‐3′)
  • Primer LpR2 (5′‐TGTATTTAGGATCGCCTTCG‐3′)
  • EMJH agar plates supplemented with 40 µg/ml streptomycin and another appropriate antibiotic (see recipe)
  • Sterile toothpicks
  • Additional reagents and equipment for preparing thermolysates ( protocol 3), PCR (Kramer and Coen, ), cloning (Ausubel et al., , Chapter 3), and transformation of Leptospira ( protocol 1)

Basic Protocol 4: Counterselection of Leptospira biflexa Using rpsL+

  Materials
  • pSC189 derivative plasmids carrying both the hyperactive transposase C9 and the Himar1 transposon containing a kanamycin resistance cassette (Fig. , plasmid vectors are available upon request from authors: )
  • EMJH agar plates supplemented with 40 µg/ml kanamycin and 50 µM hemin (see recipe)
  • Additional reagents and equipment for introducing the plasmid by electroporation ( protocol 1), replica plating, extraction of genomic DNA (Wilson, ), and ligation‐mediated PCR (Prod'hom et al., )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Ausubel, F.A., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K. (eds.), 2007. Current Protocols in Molecular Biology, Chapter 3. John Wiley & Sons, Hoboken, N.J.
   Bauby, H., Saint Girons, I., and Picardeau, M. 2003. Construction and complementation of the first auxotrophic mutant in the spirochaete Leptospira meyeri. Microbiology 149:689‐693.
   Bourhy, P., Frangeul, L., Couve, E., Glaser, P., Saint Girons, I., and Picardeau, M. 2005a. Complete nucleotide sequence of the LE1 prophage from the spirochete Leptospira biflexa and characterization of its replication and partition functions. J. Bacteriol. 187:3931‐3940.
   Bourhy, P., Louvel, H., Saint Girons, I., and Picardeau, M. 2005b. Random insertional mutagenesis of Leptospira interrogans, the agent of leptospirosis, using a mariner transposon. J. Bacteriol. 187:3255‐3258.
   Chiang, S.L. and Rubin, E.J. 2002. Construction of a mariner‐based transposon for epitope‐tagging and genomic targeting. Gene 296:179‐185.
   Guégan, R., Camadro, J.M., Saint Girons, I., and Picardeau, M. 2003. Leptospira spp. possess a complete heme biosynthetic pathway and are able to use exogenous heme sources. Mol. Microbiol. 49:745‐754.
   Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
   Levett, P.N. 2001. Leptospirosis. Clin. Microbiol. Rev. 14:296‐326.
   Louvel, H., Saint Girons, I., and Picardeau, M. 2005. Isolation and characterization of FecA‐ and FeoB‐mediated iron acquisition systems of the spirochete Leptospira biflexa by random insertional mutagenesis. J. Bacteriol. 187:3255‐3258.
   Picardeau, M., Brenot, A., and Saint Girons, I. 2001. First evidence for gene replacement in Leptospira spp. Inactivation of L. biflexa flaB results in non‐motile mutants deficient in endoflagella. Mol. Microbiol. 40:189‐199.
   Picardeau, M., Bauby, H., and Saint Girons, I. 2003. Genetic evidence for the existence of two pathways for the biosynthesis of methionine in Leptospira spp. FEMS Microbiol. Lett. 225:257‐262.
   Prod'hom, G., Lagier, B., Pelicic, V., Hance, A.J., Gicquel, B., and Guilhot, C. 1998. A reliable amplification technique for the characterization of genomic DNA sequences flanking insertion sequences. FEMS Microbiol. Lett. 158:75‐81.
   Saint Girons, I., Bourhy, P., Ottone, C., Picardeau, M., Yelton, D., Hendrix, R.W., Glaser, P., and Charon, N. 2000. The LE1 bacteriophage replicates as a plasmid within Leptospira biflexa: Construction of an L. biflexa‐Escherichia coli shuttle vector. J. Bacteriol. 182:5700‐5705.
   Tchamedeu Kameni, A.P., Couture‐Tosi, E., Saint‐Girons, I., and Picardeau, M. 2002. Inactivation of the spirochete recA gene results in a mutant with low viability and irregular nucleoid morphology. J. Bacteriol. 184:452‐458.
   Wilson, K. 1997. Preparation of genomic DNA from bacteria. Curr. Protoc. Mol. Biol. 27:2.4.1‐2.4.5.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library