Leptospira: Molecular Detection of Pathogenic Species in Natural Sources

Brittney Beigel1, Ashutosh Verma2

1 College of Veterinary Medicine, Lincoln Memorial University, Harrogate, Tennessee, 2 Center for Infectious, Zoonotic and Vector‐borne Diseases, College of Veterinary Medicine, Lincoln Memorial University, Harrogate, Tennessee
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 12E.6
DOI:  10.1002/cpmc.43
Online Posting Date:  November, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

This protocol describes a method for the rapid detection of leptospiral DNA in environmental water. In summary, the DNA is extracted from water samples and tested in a TaqMan‐based real‐time quantitative polymerase chain reaction (qPCR) for the presence of lipl32, a gene that is present only in pathogenic Leptospira spp. The gene target used in this assay is important in that it only detects pathogenic leptospires and not the saprophytic leptospires that may be present in environmental samples. © 2017 by John Wiley & Sons, Inc.

Keywords: environmental water; leptospirosis; Leptospira spp; molecular detection; qPCR

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Sample Collection and DNA Extraction
  • Support Protocol 1: Preparing the PCR Workstation and Biosafety Cabinet
  • Basic Protocol 2: Preparing the Reaction Plate and Running qPCR Assay
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Sample Collection and DNA Extraction

  Materials
  • Water to be tested
  • DNeasy Blood and Tissue Kit (Qiagen)
  • 50‐ml conical centrifuge tubes (e.g., BD Falcon)
  • 15/50 ml tube rack
  • Wire mesh strainer (optional)
  • Refrigerated centrifuge
  • 1.5‐ml microcentrifuge tube, autoclaved
  • Microcentrifuge tube rack

Support Protocol 1: Preparing the PCR Workstation and Biosafety Cabinet

  Materials
  • 70% isopropyl alcohol
  • UV light source
  • PCR workstation (e.g., UVP UV PCR Workstation), containing:
  • 1.5‐ml microcentrifuge tubes
  • 5‐ml microcentrifuge tube
  • Microcentrifuge tube rack
  • 10‐ to 100‐µl pipet tips
  • 100‐ to 1000‐µl pipet tips
  • 0.1 to 10 µl pipet tips
  • Pipets
  • Kimwipes
  • Microamp Optical 96‐well reaction plate (Thermo Scientific)
  • Microamp 96‐well base (Thermo Scientific)
  • Biosafety cabinet (e.g., 1300 Series A2 Biosafety Cabinet; Thermo Scientific), containing:
  • 1.5‐ml microcentrifuge tubes
  • 5‐ml microcentrifuge tube
  • 10‐ to 100‐µl pipet tips
  • 100 to 1000 µl pipet tips
  • 0.1‐ to 10‐µl pipet tips
  • Pipets
  • Kimwipes
  • Microamp Optical Adhesive Film (Thermo Scientific)

Basic Protocol 2: Preparing the Reaction Plate and Running qPCR Assay

  Materials
  • LipL32‐45F (forward primer; 5′‐ AAGCATTACCGCTTGTGGTG‐3′; Stoddard et al., )
  • LipL32‐286R (reverse primer; 5′‐GAACTCCCATTTCAGCGATT‐3′; Stoddard et al., )
  • LipL32‐189P (probe; FAM‐5′‐AAAGCCAGGACAAGCGCCG‐3′‐BHQ1; Stoddard et al., )
  • Platinum qPCR Supermix‐UDG (Invitrogen)
  • Nuclease‐free water, 0.2 filtered through 0.2‐µm filter (Ambion)
  • 70% isopropyl alcohol
  • Leptospira DNA standards (107 to 1 or 105 to 0.01 genome equivalents; Levett et al., )
  • UVP UV PCR Workstation (also see protocol 2Support Protocol)
  • 1300 Series A2 Biosafety Cabinet (also see protocol 2Support Protocol))
  • 1.5‐ml microcentrifuge tubes, autoclaved
  • 5‐ml microcentrifuge tube, autoclaved
  • Microcentrifuge tube rack
  • Isotemp digital dry bath/block heater
  • MicroAmp optical 96‐well reaction plate (Thermo Scientific)
  • MicroAmp 96‐well base (Thermo Scientific)
  • MicroAmp optical adhesive film (Thermo Scientific)
  • Tabletop centrifuge with microtiter plate adapter
  • ABI Quant Studio 3 Real‐Time PCR Machine (Applied Biosciences) with QS3 software
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Adler, B., & de la Peña Moctezuma, A. (2010). Leptospira and leptospirosis. Veterinary Microbiology, 140, 287–296. doi: 10.1016/j.vetmic.2009.03.012.
  Ko, A. I., Goarant, C., & Picardeau, M. (2009). Leptospira: The dawn of the molecular genetics era for an emerging zoonotic pathogen. Nature Reviews. Microbiology, 7, 736–747. doi: 10.1038/nrmicro2208.
  Rawlins, J., Portanova, A., Zuckerman, I., Loftis, A., Ceccato, P., Willingham, A. L., & A., Verma. (2014). Molecular detection of leptospiral DNA in environmental water on St. Kitts. International Journal of Environmental Research and Public Health, 11, 7953–7960. doi: 10.3390/ijerph110807953.
  Stoddard, R. A., Gee, J. E., Wilkins, P. P., McCaustland, K., & Hoffmaster, A. R. (2009). Detection of pathogenic Leptospira spp. through TaqMan polymerase chain reaction targeting the LipL32 gene. Diagnostic Microbiology and Infectious Disease, 64, 247–255. doi: 10.1016/j.diagmicrobio.2009.03.014.
  Levett, P. N., Morey, R. E., Galloway, R. L., Turner, D. E., Steigerwalt, A. G., & Mayer, L. W. (2005). Detection of pathogenic leptospires by real‐time quantitative PCR. Journal of Medical Microbiology, 54, 45–49. doi: 10.1099/jmm.0.45860‐0.
  Zuerner, R. L. (2005). Laboratory maintenance of pathogenic Leptospira. Current Protocols in Microbiology, 00, 12E.1.1–12E.1.13. doi: 10.1002/9780471729259.mc12e01s00.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library