Production of Myxoma Virus Gateway Entry and Expression Libraries and Validation of Viral Protein Expression

Sherin E. Smallwood1, Masmudur M. Rahman1, Steven J. Werden2, Maria Fernanda Martino1, Grant McFadden1

1 Department of Molecular Genetics and Microbiology, College of Medicine, University of Florida, Gainesville, Florida, 2 Department of Molecular Pathology, University of Texas M.D. Anderson Cancer Center, Houston, Texas
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14A.2
DOI:  10.1002/9780471729259.mc14a02s21
Online Posting Date:  May, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Invitrogen's Gateway technology is a recombination‐based cloning method that allows for rapid transfer of numerous open reading frames (ORFs) into multiple plasmid vectors, making it useful for diverse high‐throughput applications. Gateway technology has been utilized to create an ORF library for Myxoma virus (MYXV), a member of the Poxviridae family of DNA viruses. MYXV is the prototype virus for the genus Leporipoxvirus, and is pathogenic only in European rabbits. MYXV replicates exclusively in the host cell cytoplasm, and its genome encodes 171 ORFs. A number of these ORFs encode proteins that interfere with or modulate host defense mechanisms, particularly the inflammatory responses. Furthermore, MYXV is able to productively infect a variety of human cancer cell lines and is being developed as an oncolytic virus for treating human cancers. MYXV is therefore an excellent model for studying poxvirus biology, pathogenesis, and host tropism, and a good candidate for ORFeome development. Curr. Protoc. Microbiol. 21:14A.2.1‐14A.2.29. © 2011 by John Wiley & Sons, Inc.

Keywords: Myxoma virus; Gateway recombination cloning; entry clone; expression clone; protein expression

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: PCR Amplification of Target Genes
  • Support Protocol 1: Gel Purify PCR Product
  • Basic Protocol 2: BP Clonase Reaction to Create Entry Clones
  • Basic Protocol 3: LR Clonase Reaction to Create Expression Clones
  • Basic Protocol 4: Verify Protein Expression by TNT and Immunoblot Analysis
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: PCR Amplification of Target Genes

  Materials
  • Sterile ultra‐pure pyrogen‐free water
  • 10× Pfu Ultra amplification buffer (provided with Agilent Pfu Ultra High‐Fidelity DNA polymerase)
  • 10 mM 4dNTPs (see recipe)
  • 100 ng/µl genomic DNA
  • 2.5 units/µl Pfu Ultra High‐Fidelity DNA Polymerase (Agilent Technologies, cat. no. 600382)
  • 50 pmol/µl gene‐specific forward primer
  • 50 pmol/µl gene‐specific reverse primer
  • 6× agarose gel loading buffer (Fisher, cat. no. BP633‐5)
  • 1% Agarose‐TAE gel (see recipe)
  • SYBR Safe DNA gel Stain (Invitrogen, cat. no. S33102)
  • 1‐kb DNA ladder (NEB, cat. no. N3232L) or other similar size marker
  • 50 pmol/µl universal forward primer
  • 50 pmol/µl universal reverse primer
  • Thin‐walled 0.2‐ml PCR tubes
  • Thermal cycler
  • 0.5‐ml microcentrifuge tubes
  • Horizontal gel apparatus
  • Power supply
  • Gel‐doc system

Support Protocol 1: Gel Purify PCR Product

  Materials
  • 1% Agarose‐TAE gel (see recipe)
  • SYBR Safe DNA gel stain
  • 6× agarose gel loading buffer
  • PCR sample(s) from protocol 1
  • 1‐kb DNA ladder
  • QIAquickGel Extraction kit (Qiagen cat. no. 28706) containing:
    • Buffer QG
    • Buffer PE
    • QIAquick spin columns
    • 2‐ml collection tubes
  • 3 M sodium acetate, pH 5.0 (see recipe)
  • Isopropanol
  • Sterile ultra‐pure pyrogen‐free water (pH 7.0 to 8.5)
  • Horizontal mini‐gel apparatus
  • Power supply
  • 2‐ml microcentrifuge tubes
  • Balance
  • Low‐frequency UV light box
  • UV face shield
  • Scalpel with no. 11 or similar blade
  • Heat block or water bath set at 50°C
  • Vortex mixer
  • Microcentrifuge
  • Additional reagents and equipment for determining the concentration of the purified PCR product (Gallagher and Desjardins, )

Basic Protocol 2: BP Clonase Reaction to Create Entry Clones

  Materials
  • Sterile ultra‐pure, pyrogen‐free water
  • 150 ng/µl pDONR222 entry vector (Invitrogen)
  • 10 to 20 ng/µl second‐round PCR product (see protocol 1)
  • Gateway BP Clonase II enzyme mix (Invitrogen, cat. no. 11789‐100)
  • 2 µg/µl proteinase K (provided with BP Clonase II)
  • One Shot Mach1 T1 Phage‐Resistant Chemically Competent E. coli (Invitrogen, cat. no. C8620‐03 or other E. coli competent cell, e.g., Seidman et al., )
  • SOC medium (see recipe)
  • LB agar plates supplemented with 50 µg/ml kanamycin (see recipe)
  • 5 U/µl Taq DNA polymerase (NEB, cat. no. M0273X)
  • 10× standard Taq reaction buffer (provided with Taq DNA polymerase)
  • 50 mM MgCl 2
  • 10 mM 4dNPTs (see recipe)
  • 50 pmol/µl Universal forward primer
  • 50 pmol/µl Universal reverse primer
  • 6× agarose gel loading buffer
  • 1% agarose‐TAE gel (see recipe)
  • SYBR Safe DNA gel stain
  • 1‐kb DNA ladder
  • LB medium supplemented with 50 µg/ml kanamycin (see recipe)
  • 100% glycerol, sterile
  • Plasmid DNA isolation kit (e.g., Qiagen)
  • M13 forward and reverse primers (Invitrogen, cat. nos. N520‐02 and N530‐02, respectively)
  • 0.5‐ and 1.5‐ml sterile microcentrifuge tubes
  • 37°C shaking incubator
  • Ice bath
  • 42°C water bath
  • 37°C bacterial incubator
  • 0.2‐ml thin‐wall PCR tubes
  • Thermal cycler

Basic Protocol 3: LR Clonase Reaction to Create Expression Clones

  Materials
  • Sterile ultra‐pure, pyrogen‐free water
  • 150 ng/µl entry clone
  • 150 ng/µl pANT7‐cGST entry vector (HIP)
  • Gateway LR Clonase II Enzyme mix (Invitrogen, cat. no. 11791‐100)
  • 2 µg/µl proteinase K (provided with LR Clonase II)
  • E. coli competent cells (e.g., DH5α; Invitrogen, cat. no. 18258‐012, or DH5α competent cells prepared in‐lab)
  • SOC medium (see recipe)
  • LB‐agar plates supplemented with 100 µg/ml ampicillin (see recipe)
  • 5 U/µl Taq DNA polymerase
  • 10× standard Taq reaction buffer
  • 50 mM MgCl 2
  • 10 mM 4dNPTs (see recipe)
  • 50 pmol/µl pANT7 forward screening primer (5′ GTAAAACGACGGCCAG 3′)
  • 50 pmol/µl pANT7 reverse screening primer (5′ GCCCGGATATAGTTCCTCCTTTCA 3′)
  • 6× agarose gel loading buffer
  • 1% agarose‐TAE gel (see recipe)
  • 1× TAE (see recipe)
  • SYBR Safe DNA gel Stain
  • 1‐kb DNA ladder
  • LB medium supplemented with 100 µg/ml ampicillin (see recipe)
  • 100% glycerol, sterile
  • Plasmid DNA isolation kit (e.g., Qiagen)
  • 0.5‐ml sterile microcentrifuge tubes
  • 25°C incubator, optional
  • 37°C shaking incubator
  • Ice bath
  • 42°C water bath
  • 37°C bacterial incubator
  • Pipet tips, sterile
  • 0.2 ml thin‐wall PCR tubes
  • Thermal cycler
  • Additional reagents and equipment for growing E. coli DH5α competent cells (e.g., Seidman et al., )

Basic Protocol 4: Verify Protein Expression by TNT and Immunoblot Analysis

  Materials
  • Sterile ultra‐pure pyrogen‐free water
  • TNT Coupled Reticulocyte Lysate System (Promega, cat. no. L4610) containing:
    • TNT rabbit reticulocyte lysate
    • TNT reaction buffer
    • Amino acids minus methionine
    • Amino acids minus leucine
    • TNT T7 RNA polymerase
  • RNasin ribonuclease inhibitor (Promega, cat. no. N2511)
  • Expression clone plasmid prep at a concentration of 500 ng/µl (see protocol 4)
  • SDS‐PAGE gel (8 to 12% acrylamide, depending on size of proteins; e.g., Gallagher, , or can be purchased from Thermo Scientific, Invitrogen, or BioRad)
  • 2× protein gel loading buffer (Fisher, cat. no. BP637‐5)
  • 2‐mercaptoethanol
  • SDS‐PAGE running buffer (see recipe)
  • SeeBlue Plus2 Pre‐Stained Standard (Invitrogen, cat. no. LC5925)
  • Transfer buffer (see recipe)
  • Methanol
  • TBS‐Tween (TBS‐T; see recipe)
  • Blocking buffer (see recipe)
  • Primary antibody against tag (rabbit anti‐GST polyclonal antibody, Fisher Scientific, cat. no. RB‐9410‐P)
  • Secondary HRP‐tagged antibody (goat anti‐rabbit‐HRP: Jackson Immuno Research Labs, cat. no. 111‐035‐144 or Santa Cruz Biotechnology, cat. no. SC‐2004)
  • Immobilon Western Chemiluminescent HRP substrate (Millipore, cat. no. WBKLS0500)
  • 1000‐, 200‐, and 10‐µl pipet tips, sterile
  • 0.5‐ and 1.5‐ml microcentrifuge tubes, sterile
  • Incubator or water bath set at 30°C
  • Water bath or heat block set at 90°C
  • Vertical Mini‐gel apparatus (e.g., BioRad Mini‐PROTEAN Tetra Cell, cat. no. 165‐8004)
  • Power supply (e.g., BioRad, cat. no. 164‐5052, which can supply constant voltage, current, or power; not all power supplies are compatible with the semi‐dry blotter used here)
  • Several small containers for washing blots (e.g., 4‐in. × 6‐in. Rubbermaid container with lid, or pipet tip box lids)
  • Shaker platform (one at room temperature and one at 4°C)
  • Semi‐dry blotter (e.g., Owl Separation Systems model HEP‐1, Fisher Scientific)
  • Whatman 3MM paper (Fisher, cat. no. 05‐714‐5) cut to gel size
  • Hybond PVDF membrane (GE Healthcare Bio Sciences, cat. no. RPN303F) cut to gel size
  • Forceps
  • Seal‐a‐meal bags or other heat‐sealable bags (Fisher, cat. no. 01‐812‐25A)
  • Seal‐a‐meal or other heat sealer apparatus
  • Vortex mixer
  • Sheet protector or Saran wrap
  • Light‐proof cassette or folder for x‐ray film
  • X‐ray film
  • X‐ray film developer
NOTE: Promega's TNT Coupled Reticulocyte Lysate System is a cell‐free system that utilizes rabbit reticulocyte lysate in a one‐step coupled transcription/translation reaction for protein expression.NOTE: The DNA template used in the TNT reactions must be ethanol‐, calcium‐, salt‐, and RNase‐free. DNA prepped using Qiagen's QIAprep Spin Miniprep kit, which the authors use, meets these standards. Promega recommends its Wizard Plus Minipreps DNA Purification, but indicates that standard alkaline lysate preps according to the Sambrook and Russell ( ) method will also work.NOTE: The package insert with this kit outlines the set up for 50 µl reactions; however, it is sufficient to set up reactions of 12.5 µl, and recommended, as the kits are costly. Each component of the reaction is reduced proportionately when assembling a reaction.NOTE: The TNT kit is stored at −80°C, and upon removal from the freezer, the RNA polymerase should be placed on ice immediately. The reticulocyte lysate should be thawed rapidly by hand, and then transferred to ice. Keep all components of the kit on ice at all times.NOTE: Wear gloves to reduce the risk of contaminating reactions with RNases, and sterilize all tips and tubes used in setting up the reactions.NOTE: TNT kits can be purchased with T7, SP6, or T3 RNA polymerase. The MYXV ORF expression library reported here is cloned into the pANT7‐cGST expression vector, which has a T7 promoter. Use only the T7 RNA polymerase provided with the kit.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Aguiar, J.C., LaBaer, J., Blair, P.L., Shamailova, V.Y., Koundinya, M., Russell, J.A., Huang, F., Mar, W., Anthony, R.M., Witney, A., Caruana, S.R., Brizuela, L., Sacci J.B. Jr., Hoffman, S.L., and Carucci, D.J. 2004. High‐throughput generation of P. falciparum functional molecules by recombinational cloning. Genome Res. 14:2076‐2082.
   Barrett, J.W., Cao, J‐X., Hota‐Mitchell, S., and McFadden, G. 2001. Immunomodulatory proteins of myxoma virus. Semin. Immunol. 13:73‐84.
   Brandner, C.J., Maier, R.H., Henderson, D.S., Hintner, H., Bauer, J.W., and Onder, K. 2008. The ORFeome of Staphylococcus aureus v 1.1. BMC Genomics 9:321.
   Brizuela, L., Braun, P., and LaBaer, J. 2001. FLEXGene repository: From sequenced genomes to gene repositories for high‐throughput functional biology and proteomics. Mol. Biochem. Parasitol. 118:155‐165.
   Cameron, C., Hota‐Mitchell, S., Chen, L., Barrett, J., Cao, J.X., Macaulay, C., Willer, D., Evans, D., and McFadden, G. 1999. The complete DNA sequence of myxoma virus. Virology 264:298‐318.
   Gallagher, S.R. 2006. One‐dimensional SDS gel electrophoresis of proteins. Curr. Protoc. Mol. Biol. 75:10.2A.1‐10.2A.37.
   Gallagher, S.R. and Desjardins, P.R. 2006. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 76:A.3D.1‐A.3D.21.
   Hartley, J.L., Temple, G.F., and Brasch, M. 2000. DNA cloning using in vitro site‐specific recombination. Genome Res. 10:1788‐1795.
   Kerr, P. and McFadden, G. 2002. Immune responses to myxoma virus. Viral Immunol. 15:229‐246.
   Kim, M., Madlambayan, G.J., Rahman, M.M., Smallwood, S.E., Meacham, A.M., Hosaka, K., Scott, E.W., Cogle, C.R., and McFadden, G. 2009. Myxoma virus targets primary human leukemic stem and progenitor cells while sparing normal hematopoietic stem and progenitor cells. Leukemia 23:2313‐2317.
   LaBaer, J., Qiu, Q., Anumanthan, N., Mar, W., Zuo, D., Murthy, T.V.S., Taycher, H., Halleck, A., Hainesworth, E., Lory, S., and Brizuela, L. 2004. The Pseudomonas aeruginosa PAO1 gene collection. Genome Res. 14:2190‐2200.
   Landy, A. 1989. Dynamic, structural, and regulatory aspects of lambda site‐specific recombination. Annu. Rev. Biochem. 58:913‐949.
   Liu, L., Lalani, A., Dai, E., Seet, B, Macauley, C., Singh, R., Fan, L., McFadden, G., and Lucas, A. 2000. The viral anti‐inflammatory chemokine‐binding protein M‐T7 reduces intimal hyperplasia after vascular injury. J. Clin. Investig. 105:1613‐1621.
   Lucas, A. and McFadden, G. 2004. Secreted immunomodulatory viral proteins as novel biotherapeutics. J. Immunol. 173:4765‐4774.
   Lun, X., Yang, W., Alain, T., Shi, Z‐Q., Muzik, H., Barrett, J.W., McFadden, G., Bell, J., Hamilton, M.G., Senger, D.L., and Forsyth, P.A. 2005. Myxoma virus is a novel oncolytic virus with significant antitumor activity against experimental human gliomas. Cancer Res. 65:9982‐9990.
   McFadden, G. 2005. Poxvirus tropism. Nat. Rev. Microbiol. 3:201‐213.
   Park, J. and LaBaer, J. 2006. Recombinational cloning. Curr. Protoc. Mol. Biol. 74:3.20.1‐3.20.22.
   Rajagopala, S.V., Yamamoto, N., Zweifel, A.E., Nakamichi, T., Huang, H‐K., Mendez‐Rios, J.D., Franca‐Koh, J., Boorgula, M.P., Fujita, K., Suzuki, K., Hu, J.C., Wanner, B.L., Mori, H., and Uetz, P. 2010. The Escherichia coli K‐12 ORFeome: A resource for comparative molecular biology. BMC Genomics 11:470.
   Ramachandran, N., Hainsworth, E., Demirkan, G., and LaBaer, J. 2006. On‐chip protein synthesis for making microarrays. In New and Emerging Proteomic Techniques (D. Nedelkov and R.W. Nelson, eds.), pp. 1‐.14. Humana Press, Totowa, N.J.
   Regnery, D.C. 1971. The epidemic potential of Brazilian myxoma virus (Lausanne strain) for three species of North American cottontails. Am. J. Epidemiol. 94:514‐519.
   Rual, J‐F., Hill, D.E., and Vidal, M. 2004a. ORFeome projects: Gateway between genomics and omics. Curr. Opin. Chem. Biol. 8:20‐25.
   Rual, J‐F., Hirozane‐Kishikawa, T., Hao, T., Bertin, N., Li, S., Dricot, A., Li, N., Rosenberg, J., Lamesch, P., Vidalain, P‐O., Clingingsmith, T.R., Hartley, J.L., Esposito, D., Cheo, D., Moore, T., Simmons, B., Sequerra, R., Bosak, S., Doucette‐Stamm, L., Le Peuch, C., Vandenhaute, J., Cusic, M.E., Albala, J.S., Hill, D.E., and Vidal, M. 2004b. Human ORFeome version 1.1: A platform for reverse proteomics. Genome Res. 14:2128‐2135.
   Sambrook, J., and Russell, D. 2001. Molecular Cloning: A Laboratory Manual, rd ed3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
   Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
   Silvers, L., Barnard, D., Knowlton, F., Inglis, B., Labudovic, A., Holland, M.K., Janssens, P.A., van Leeuwen, B.H., and Kerr, P.J. 2010. Host‐specificity of myxoma virus: Pathogenesis of South American and North American strains of myxoma virus in two North American lagommorph species. Vet. Microbiol. 141:289‐300.
   Stanford, M.M., Werden, S.J., and McFadden, G. 2007. Myxoma virus in the European rabbit: interactions between the virus and its susceptible host. Vet. Res. 38:299‐318.
   Sypula, J., Wang, F., Ma, Y., Bell, J., and McFadden, G. 2004. Myxoma virus tropism in human tumor cells. Gene Ther. Mol. Biol. 8:103‐114.
   Walhout, A.J.M., Temple, G.F., Brasch, M.A., Hartley, J.L., Lorson, M.A., van den Heuvel, S., and Vidal, M. 2000. Gateway recombinational cloning: application to the cloning of large numbers of open reading frames or ORFeomes. Methods Enzymol. 328:575‐592.
   Zhang, L., Villa, N.Y., Rahman, M.M., Smallwood, S., Shattuck, D., Neff, C., Dufford, M., Lanchbury, J.S., LaBaer, J., and McFadden, G. 2009. Analysis of vaccinia virus‐host protein‐protein interactions: validations of yeast two‐hybrid screenings. J. Proteome Res. 8:4311‐4318.
Internet Resources
  http://www.poxvirus.org/index.asp
  Web site for the Poxvirus Bioinformatics Resource Center, which provides resources and data for the study of poxviruses.
   http://www.idtdna.com
  The Web site for Integrated DNA technologies has an oligo analyzer under SciTools that is useful in designing primers. It calculates melting temperature, G‐C content, etc.
  http://www.orfeomecollaboration.org/html/index.shtml
  Web site for The ORFeome Collaboration, a source of sequence‐validated human and mouse ORFs in Gateway entry vectors.
  http://www.invitrogen.com/gateway
  The Invitrogen Web site is an excellent source for complete information about Gateway cloning technology.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library