Natural Vaccinia Virus Infection: Diagnosis, Isolation, and Characterization

Erna Geessien Kroon1, Jônatas Santos Abrahão1, Giliane de Souza Trindade1, Graziele Pereira Oliveira1, Ana Paula Moreira Franco Luiz1, Galileu Barbosa Costa1, Mauricio Teixeira Lima1, Rafael Silva Calixto1, Danilo Bretas de Oliveira2, Betânia Paiva Drumond1

1 Laboratório de Vírus, Departamento de Microbiologia, Instituto de Ciências Biológicas, Universidade Federal de Minas Gerais, Belo Horizonte, 2 Faculdade de Medicina de Diamantina, Universidade Federal dos Vales do Jequitinhonha e Mucuri, Diamantina
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14A.5
DOI:  10.1002/cpmc.13
Online Posting Date:  August, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Natural infections of Vaccinia virus (VACV)—the prototype species of the Orthopoxvirus genus, from the family Poxviridae and subfamily Chordopoxvirinae—cause an occupational emergent zoonotic disease that is primarily associated with the handling of infected dairy cattle. In humans, VACV infection is characterized by skin lesions, primarily on the hands, and accompanied by systemic symptoms such as fever, myalgia, headache, and lymphadenopathy. The diagnosis of VACV is usually performed according to the methods described for other orthopoxviruses. This unit describes the methods utilized to obtain clinical samples, the serological and molecular techniques used for diagnosis, and the isolation methods and techniques used for molecular and biological characterization of the viruses. © 2016 by John Wiley & Sons, Inc.

Keywords: vaccinia virus; orthopoxvirus; natural vaccinia virus infection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Sample Collection: Selection of Samples for Diagnosis
  • Basic Protocol 2: Serological Technique: Indirect Elisa
  • Basic Protocol 3: Serological Technique: Plaque Reduction Neutralization Test
  • Support Protocol 1: Vacv Replication
  • Support Protocol 2: Titration of VACV by Plaque Assay
  • Support Protocol 3: Molecular Technique: DNA Extraction from Clinical Samples and Infected Cells
  • Basic Protocol 4: Molecular Technique: PCR Amplification of the C11R Gene
  • Support Protocol 4: Molecular Technique: Agarose Gel Electrophoresis
  • Support Protocol 5: Molecular Technique: Polyacrylamide Gel Electrophoresis
  • Alternate Protocol 1: Molecular Technique: qPCR OF THE C11R GENE
  • Basic Protocol 5: Viral Isolation Technique: Isolation of VACV in Vero Cell Lines
  • Basic Protocol 6: Viral Isolation Technique: Isolation of VACV in Primary Chicken Embryo Fibroblast Cells
  • Basic Protocol 7: Viral Isolation Technique: Isolation of VACV In Chicken Chorioallantoic Membrane
  • Basic Protocol 8: Viral Isolation Technique: Plaque Purification of VACV Isolates
  • Viral Characterization
  • Basic Protocol 9: Molecular Characterization: qPCR to Amplify the A56R (Hemagglutinin) Gene
  • Basic Protocol 10: Molecular Characterization: PCR for the A56R (Hemagglutinin) Gene
  • Alternate Protocol 2: Molecular Characterization: PCR for the A26L Gene
  • Alternate Protocol 3: Molecular Characterization: PCR for the C23L Gene
  • Basic Protocol 11: Molecular Characterization: Sequencing and Sequence Analysis of PCR‐amplified DNA Fragments
  • Basic Protocol 12: Biological Characterization of Virulence in Mouse Models
  • Basic Protocol 13: Biological Characterization of Plaque Phenotype in Cell Culture
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Sample Collection: Selection of Samples for Diagnosis

  Materials
  • Sample of interest (i.e., solid tissue, vesicle fluid, lesion swab, whole blood, plasma, or serum)
  • Phosphate buffered saline (PBS; see recipe) containing antimicrobial agents: penicillin (200 U/ml), amphotericin B (4 µg/ml), and gentamicin (100 µg/ml)
  • 1.5‐ml microcentrifuge tube, sterile
  • Scissors, sterile
  • Tweezers, sterile
  • Mortar and pestle
  • Liquid nitrogen
  • Homogenizer (e.g., Polytron Handheld Homogenizer)
  • Vortex
  • Sonicator (e.g., Unique Ultrasonic Cleaner, USC‐2850A)
  • Refrigerated centrifuge and microcentrifuge
  • Anticoagulant‐treated tubes (e.g., BD Vacutainer, cat. no. 367863)
  • Dry tubes or serum clot activator tubes (e.g., BD Vacutainer, cat. no. 367815)

Basic Protocol 2: Serological Technique: Indirect Elisa

  Materials
  • Purified VACV (see protocol 4, unit 14.3, or Earl et al., )
  • Coating buffer (see recipe)
  • PBST: 0.05% (v/v) Tween 20 in PBS (see recipe)
  • Blocking buffer: 5% (w/v) dry‐fat milk in PBST
  • Test serum or plasma samples (see protocol 1)
  • Positive and negative sera, for controls
  • Serum diluent: 0.5% (w/v) dry‐fat milk in PBST
  • Secondary antibody: rabbit anti‐bovine IgG or rabbit anti‐human IgG antibody conjugated to horseradish peroxidase (e.g., Sigma Aldrich)
  • 3,3′,5,5′‐tetramethylbenzidine (TMB) Substrate Reagent Set (e.g., BD Biosciences)
  • 1 M sulfuric acid
  • Bath sonicator (e.g., Unique Ultrasonic Cleanser, USC‐2850A)
  • Reagent reservoir or petri dish
  • UV light (15 Watts)
  • 96‐well ELISA plate
  • ELISA washer
  • 37°C incubator
  • ELISA microplate reader

Basic Protocol 3: Serological Technique: Plaque Reduction Neutralization Test

  Materials
  • Trypsin/EDTA solution (see recipe)
  • BSC‐40 cells (ATCC #CRL‐2761)
  • Minimum essential medium (MEM; e.g., Gibco, cat. no. 11700‐077) with and without 5% (v/v) fetal bovine serum (FBS)
  • Test serum samples (see protocol 1)
  • Purified VACV (see protocol 4, unit 14.3, or Earl et al., )
  • 10% formalin in PBS (see recipe)
  • 1% (w/v) crystal violet (see recipe)
  • 37°C, 5% humidified incubator
  • Hemocytometer
  • 6‐well tissue culture plates
  • 1.5‐ml microcentrifuge tubes
  • 56°C water bath
  • Sonicator
  • Aspirator

Support Protocol 1: Vacv Replication

  Materials
  • Vero cells (ATCC #CCL‐81)
  • MEM (e.g., Gibco, cat. no. 11700‐077) with and without 1% (v/v) and 5% (v/v) FBS
  • PBS (see recipe)
  • Trypsin/EDTA solution (see recipe)
  • Viral samples to be replicated (see protocol 5)
  • Tissue culture flasks
  • 37°C, 5% humidified incubator
  • Aspirator
  • Inverted microscope
  • Hemocytometer
  • Cell scraper
  • Liquid nitrogen
  • 37°C water bath
  • Centrifuge

Support Protocol 2: Titration of VACV by Plaque Assay

  Materials
  • Samples to be extracted (see protocol 1)
  • PBS (see recipe)
  • 25:24:1 phenol (pH 8.0)/chloroform/isoamyl alcohol
  • 96% to 100% ethanol, ice cold
  • 3 M sodium acetate, pH 5.5
  • Nuclease‐free water
  • 37°C and 75°C incubator
  • 1.5‐ml polypropylene microcentrifuge tubes
  • Vortex
  • Centrifuge with refrigeration capabilities
CAUTION: Perform phenol manipulation in a fume hood. Wear gloves, safety glasses, and a lab coat at all times.

Support Protocol 3: Molecular Technique: DNA Extraction from Clinical Samples and Infected Cells

  Materials
  • 10× PCR buffer (see recipe)
  • 10 mM dNTP mix
  • 25 mM MgCl 2
  • 1 µg/µl bovine serum albumin (BSA)
  • 2 U/µl Taq DNA polymerase
  • Primers (10 µM):
  • vgfF: 5′‐CGCTGCTATGATAATCAGATCATT‐3′
  • vgfR: 5′‐GATATGGTTGTGCCATAATTTTTAT‐3′
  • vgfF2: 5′‐ACACGGTGACTGTATCCA‐3′
  • vgfR2: 5′‐CTAATACAAGCATAATAC‐3′
  • Nuclease‐free water
  • Extracted DNA (50 to 100 ng; see protocol 6) or processed sample (see protocol 1)
  • Positive (VACV DNA) and negative control samples
  • 0.2‐ml thin‐walled PCR tubes
  • Thermal cycler

Basic Protocol 4: Molecular Technique: PCR Amplification of the C11R Gene

  Materials
  • Agarose (e.g., Sigma)
  • 10× TAE buffer (see recipe)
  • SYBR Safe DNA Gel Stain (e.g., Thermo Fisher Scientific, cat. no. S33102)
  • DNA Ladder (e.g., Promega)
  • PCR‐amplified DNA samples (see protocol 7)
  • 6× DNA loading buffer (see recipe)
  • Erlenmeyer flask
  • Gel casting platform (e.g., BIO‐RAD Wide Mini Handcasting Kit, cat. no. 1704497)
  • Horizontal gel electrophoresis system (e.g., BIO‐RAD Wide Mini‐Sub Cell GT System, cat. no. 1704405EDU)
  • DC power source
  • UV imaging platform (e.g., UVItec Cambridge Essential V4)

Support Protocol 4: Molecular Technique: Agarose Gel Electrophoresis

  Materials
  • 5× TBE buffer (see recipe)
  • Acrylamide solution (see recipe)
  • TEMED (e.g., Thermo Fisher Scientific, cat. no. 17919)
  • 10% (w/v) ammonium persulfate
  • PCR‐amplified DNA samples (see protocol 7)
  • 6× DNA loading buffer (see recipe)
  • DNA ladder (e.g., Promega)
  • Fixer 1 solution (see recipe)
  • Fixer 2 solution (see recipe)
  • 1× oxidant solution (see recipe)
  • 0.2 % (w/v) silver nitrate
  • Developer solution (see recipe)
  • Dry solution (see recipe)
  • SYBR Gold Nucleic Acid Gel Stain (10,000× concentration in DMSO; e.g., Thermo Fisher Scientific, cat. no. S11494)
  • Gel casting platform (e.g., BIO‐RAD Mini‐PROTEAN Tetra Cell Casting Module)
  • Bulldog clips
  • Vertical gel electrophoresis apparatus (e.g., BIO‐RAD, cat no. 1658040EDU)
  • Electrophoresis electrode assembly (e.g., BIO‐RAD Mini‐PROTEAN Tetra Electrode Assembly)
  • DC power source
  • Spacer or plastic wedge, to separate glass plates of casting platform
  • Cellophane
  • Blue light transilluminator (e.g., Thermo Fisher Scientific Safe Imager 2.0, cat. no. G6600EU)

Support Protocol 5: Molecular Technique: Polyacrylamide Gel Electrophoresis

  Materials
  • Power SYBR Green PCR Master Mix (e.g., Thermo Fisher Scientific)
  • Primers (10 µM):
  • VGF forward: 5′‐CGCTACAACAGATATTCCAGCTATCAG‐3′
  • VGF reverse: 5′‐AGCGTGGATACAGTCACCGTGTAA‐3′
  • Nuclease‐free water
  • Extracted DNA (10 to 50 ng; see protocol 6) or processed sample (see protocol 1)
  • Real‐time PCR plate or 0.2‐ml PCR tubes
  • Centrifuge
  • Real‐time PCR system and analysis software

Alternate Protocol 1: Molecular Technique: qPCR OF THE C11R GENE

  Materials
  • Vero cells
  • MEM (e.g., Gibco, cat. no. 11700‐077) with 5% and 2% (v/v) FBS
  • Processed clinical samples (see protocol 1)
  • 25‐cm2 tissue culture flasks
  • 37°C, 5% humidified incubator
  • Inverted microscope
  • Liquid nitrogen
  • 37°C water bath
  • Refrigerated centrifuge

Basic Protocol 5: Viral Isolation Technique: Isolation of VACV in Vero Cell Lines

  Materials
  • CEF cells
  • MEM (e.g., Gibco, cat. no. 11700‐077) containing 10% FBS
  • Additional reagents and equipment for isolating VACV in cells ( protocol 11)

Basic Protocol 6: Viral Isolation Technique: Isolation of VACV in Primary Chicken Embryo Fibroblast Cells

  Materials
  • 9‐ or 10‐day‐old embryonated eggs
  • 70% ethanol
  • Processed clinical sample (see protocol 1)
  • PBS (see recipe) containing penicillin (200 U/ml), amphotericin B (1.5 µg/ml), and gentamicin (40 µg/ml)
  • Cotton
  • Egg box
  • Egg piercer
  • Small catheter
  • Vacuum/pressure bulb (e.g., Thomas Scientific, cat. no. HS20631B)
  • 1‐ml syringe with 25‐G, 16‐mm needle
  • Tape or melted wax
  • 1.5‐ml microcentrifuge tubes

Basic Protocol 7: Viral Isolation Technique: Isolation of VACV In Chicken Chorioallantoic Membrane

  Materials
  • BSC‐40 cells at confluent monolayer grown in tissue culture flasks
  • MEM (e.g., Gibco, cat. no. 11700‐077) with and without 5% (v/v) FBS
  • Agarose (e.g., Promega)
  • MEM (2× concentrated; e.g., Gibco, cat. no. 11700‐077) with 2% (v/v) FBS
  • Isolated VACV to be plaque purified (see Basic Protocols protocol 115 to protocol 137)
  • PBS (see recipe)
  • 6‐well tissue culture plate
  • 37°C, 5% humidified incubator
  • Inverted microscope
  • 37°C and 56°C water bath

Basic Protocol 8: Viral Isolation Technique: Plaque Purification of VACV Isolates

  Materials
  • Power SYBR Green PCR Master Mix (e.g., Thermo Fisher Scientific)
  • Primers (0.2 μM):
  • HA‐gen F: 5′‐CATCATCTGGAATTGTCACTACTAAA‐3′
  • HA‐gen R: 5′‐ACGGCCGACAATATAATTAATGC‐3′
  • HA‐BVV‐nDEL F: 5′‐GCGGATCTTTATGATACGTACAATG‐3′
  • Nuclease‐free water
  • Extracted DNA sample (10 to 100 ng; see protocol 6)
  • Positive control: DNA of VACV group 1 and 2
  • Real‐time PCR plate or thin‐walled, 0.2‐ml PCR strip tubes with real‐time grade optical strip cap
  • Real‐time PCR system and analysis software

Basic Protocol 9: Molecular Characterization: qPCR to Amplify the A56R (Hemagglutinin) Gene

  Materials
  • 10× PCR buffer (see recipe)
  • 10 mM dNTP mix
  • 25 mM MgCl 2
  • 5 U/µl Taq DNA
  • Primers (10 µM):
  • EACP1: 5′‐ATGACACGATTGCCAATAC‐3′
  • EACP2: 5′‐CTAGACTTTGTTTTCTG‐3′
  • Nuclease‐free water
  • Extracted DNA (100 ng; see protocol 6)
  • Positive control: VACV DNA
  • Thin‐walled, 0.2‐ml PCR tubes
  • Thermal cycler
  • Additional reagents and equipment for electrophoresis (Support Protocols protocol 84 and protocol 95)

Basic Protocol 10: Molecular Characterization: PCR for the A56R (Hemagglutinin) Gene

  Materials
  • 10× PCR buffer (see recipe)
  • 10 mM dNTP mix
  • 25 mM MgCl 2
  • 5 U/µl Taq DNA polymerase
  • Primers (10 µM):
  • ATI‐iF/1: 5′‐ACCACGTCTACACTCGGCGA‐3′
  • ATI‐iR/2: 5′‐TGCATCGAGAGCGGAGGAGGA‐3'
  • ATI‐iR/3: 5′‐CGATGCCAAGTACATCGACGA‐3′
  • Nuclease‐free water
  • Extracted DNA (100 ng; protocol 6)
  • Positive control: VACV DNA
  • Thin‐walled, 0.2‐ml PCR tubes
  • Thermal cycler
  • Additional reagents and equipment for electrophoresis (Support Protocols protocol 84 and protocol 95)

Alternate Protocol 2: Molecular Characterization: PCR for the A26L Gene

  Materials
  • 10× PCR buffer (see recipe)
  • 10 mM dNTP mix
  • 25 mM MgCl 2
  • 5 U/µl Taq DNA polymerase
  • Primers (10 µM):
  • C23LF: 5′‐GCGTGTCCCCAGGACAAGGT‐3′
  • C23LR: 5′‐ATGTCGCTGTCTTTCTCTTCTTCGC‐3′
  • C23LRD: 5′‐CTGGATGGGTCTTG‐3′
  • Nuclease‐free water
  • Extracted DNA (100 ng; see protocol 6)
  • Positive control: VACV DNA
  • Thin‐walled, 0.2‐ml PCR tubes
  • Thermal cycler
  • Additional reagents and equipment for electrophoresis (Support Protocols protocol 84 and protocol 95)

Alternate Protocol 3: Molecular Characterization: PCR for the C23L Gene

  Materials
  • Isolated PCR product (see Basic Protocols protocol 74 or protocol 1610 or Alternate Protocols protocol 172 or protocol 183) or PCR product run on agarose gel (see protocol 8)
  • ExoSAP‐IT PCR Product Cleanup (e.g., Affymetrix)
  • MinElute PCR Purification Kit (e.g., Qiagen) containing:
  • Buffer QG
  • Buffer PE
  • Buffer EB
  • Spin column
  • 2‐ml collection tube
  • 3 M sodium acetate, pH 5.0
  • Isopropanol
  • Forward and reverse primers
  • 0.5‐ml and 1.5‐ml microcentrifuge tubes (DNase‐free)
  • Vortex
  • Scalpel
  • Centrifuge
  • DNA sequencing facility
  • Computer with Internet access and SeqTrace (or equivalent) software (available at http://seqtrace.googlecode.com) and MEGA 6.0 software (available at http://www.megasoftware.net)
  • Additional reagents and equipment for PCR (Basic Protocols protocol 74 and protocol 115 and Alternate Protocols protocol 172 and protocol 183) and agarose gel electrophoresis ( protocol 8)

Basic Protocol 11: Molecular Characterization: Sequencing and Sequence Analysis of PCR‐amplified DNA Fragments

  Materials
  • 4‐ to 6‐week‐old male BALB/c mice
  • Viral samples to be inoculated previously purified and titrated (see Support Protocols protocol 41 and protocol 52)
  • PBS (see recipe)
  • Ketamine/xylazine in PBS (see appendix a.3n)
  • Positive control: VACV Western Reserve strain
  • Mouse housing facility
  • Insulin syringe with 12.7‐mm needle
  • Petri dish
  • Scale, to weigh mice
NOTE: All protocols using live animals must first be reviewed and approved by an Institutional Animal Care and Use Committee (IACUC) and must conform to governmental regulations regarding the care and use of laboratory animals.

Basic Protocol 12: Biological Characterization of Virulence in Mouse Models

  Materials
  • BSC‐40 cells grown to 80% to 90% confluence in 6‐well tissue culture plates (see protocol 14, steps 1 through 3)
  • Agarose
  • 2× MEM (e.g., Gibco, cat. no. 11700‐077) with 2% (v/v) FBS
  • VACV to be assayed
  • 1× MEM (e.g., Gibco, cat. no. 11700‐077)
  • PBS (see recipe)
  • 10% formalin in PBS
  • 1% (w/v) crystal violet (see recipe)
  • 37°C and 56°C water bath
  • 37°C, 5% humidified incubator
  • Aspirator
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Abrahão, J.S., Drumond, B.P., Trindade, G.E.S., da Silva‐Fernandes, A.T., Ferreira, J.M., Alves, P.A., Campos, R.K., Siqueira, L., Bonjardim, C.A., Ferreira, P.C., and Kroon, E.G. 2010. Rapid detection of orthopoxvirus by semi‐nested PCR directly from clinical specimens: A useful alternative for routine laboratories. J. Med. Virol. 82:692‐699. doi: 10.1002/jmv.21617.
  Altschul, S.F., Gish, W., Miller, W., Myers, E.W., and Lipman, D.J. 1990. Basic local alignment search tool. J. Mol. Biol. 215:403‐410. doi: 10.1016/S0022‐2836(05)80360‐2.
  Assis, F.L., Almeida, G.M., Oliveira, D.B., Franco‐Luiz, A.P., Campos, R.K., Guedes, M.I., Fonseca, F.G., Trindade, G.S., Drumond, B.P., Kroon, E.G., and Abrahão, J.S. 2012. Characterization of a new Vaccinia virus isolate reveals the C23L gene as a putative genetic marker for autochthonous group 1 Brazilian Vaccinia virus. PLoS ONE 7:e50413. doi: 10.1371/journal.pone.0050413.
  Campos, M.A.S. and Kroon, E.G. 1993. Critical period of irreversible block of VACV replication. Braz. J. Microbiol. 24:104–110.
  Campos, R.K., Brum, M.C., Nogueira, C.E., Drumond, B.P., Alves, P.A., Siqueira‐Lima, L., Assis, F.L., Trindade, G.S., Bonjardim, C.A., Ferreira, P.C., Weiblen, R., Flores, E.F., Kroon, E.G., and Abrahão, J.S., 2011. Assessing the variability of Brazilian Vaccinia virus isolates from a horse exanthematic lesion: Coinfection with distinct viruses. Arch. Virol. 156:275‐283. doi: 10.1007/s00705‐010‐0857‐z.
  Costa, G.B., Moreno, E.C., de Souza Trindade, G., and Studies Group in Bovine Vaccinia. 2013. Neutralizing antibodies associated with exposure factors to orthopoxvirus in laboratory workers. Vaccine 31:4706‐4709. doi: 10.1016/j.vaccine.2013.08.023.
  Cotter, C.A., Earl, P.L., Wyatt, L.S., and Moss, B. 2015. Preparation of cell cultures and vaccinia virus stocks. Curr. Protoc. Microbiol. 39:14A.3.1‐14A.3.18. doi: 10.1002/9780471729259.mc14a03s39.
  Damaso, C.R.A., Esposito, J.J., Condit, R.C., and Moussatché, N., 2000. An emergent poxvirus from humans and cattle in Rio de Janeiro State: Cantagalo virus may derive from Brazilian smallpox vaccine. Virology 277:439‐449. doi: 10.1006/viro.2000.0603.
  de Souza Trindade, G., Li, Y., Olson, V.A., Emerson, G., Regnery, R.L., da Fonseca, F.G., Kroon, E.G., and Damon, I. 2008. Real‐time PCR assay to identify variants of vaccinia virus: Implications for the diagnosis of bovine vaccinia in Brazil. J. Virol. Methods 152:63‐71. doi: 10.1016/j.jviromet.2008.05.028.
  Drumond, B.P., Leite, J.A., da Fonseca, F.G., Bonjardim, C.A., Ferreira, P.C., and Kroon, E.G. 2008. Brazilian Vaccinia virus strains are genetically divergent and differ from the lister vaccine strain. Microbes Infect. 10:185‐197. doi: 10.1016/j.micinf.2007.11.005.
  Earl, P.L., Moss, B., Wyatt, L.S., and Carroll, M.W. 2001. Generation of recombinant vaccinia viruses. Curr. Protoc. Mol. Biol. 43:16.17.1‐16.17.19. doi: 10.1002/0471142727.mb1617s43.
  Ferreira, J.M., Drumond, B.P., Guedes, M.I., Pascoal‐Xavier, M.A., Almeida‐Leite, C.M., Arantes, R.M., Mota, B.E., Abrahão, J.S., Alves, P.A., Oliveira, F.M., Ferreira, P.C., Bonjardim, C.A., Lobato, Z.I., and Kroon, E.G. 2008. Virulence in murine model shows the existence of two distinct populations of Brazilian Vaccinia virus strains. PLoS ONE 8: e3043. doi: 10.1371/journal.pone.0003043.
  Ladunga, I. 2009. Finding similar nucleotide sequences using network blast searches. Curr. Protoc. Bioinform. 26:3.3.1‐3.3.26. doi: 10.1002/0471250953.bi0303s26.
  Mota, B.E., Trindade, G.S., Diniz, T.C., da Silva‐Nunes, M., Braga, E.M., Urbano‐Ferreira, M., Rodrigues, G.O., Bonjardim, C.A., Ferreira, P.C., and Kroon, E.G. 2010. Seroprevalence of orthopoxvirus in an amazonian rural village, acre, Brazil. Arch. Virol. 155:1139‐1144. doi: 10.1007/s00705‐010‐0675‐3.
  Oliveira, G., Assis, F., Almeida, G., Albarnaz, J., Lima, M., Andrade, A.C., Calixto, R., Oliveira, C., Neto, J.D., Trindade, G., Ferreira, P.C., Kroon, E.G., and Abrahão, J. 2015. From lesions to viral clones: Biological and molecular diversity amongst autochthonous Brazilian Vaccinia virus. Viruses 7:1218‐1237. doi: 10.3390/v7031218.
  Pearson, W. 2004. Finding protein and nucleotide similarities with FASTA. Curr. Protoc. Bioinform. 8:3.9.1‐3.9.23. doi: 10.1002/0471250953.bi0309s04.
  Pearson, W.R. 2013. An introduction to similarity (“homology”) searching. Curr. Prot. Bioinform. 42:3.1.1‐3.1.8. doi: 10.1002/0471250953.bi0301s42.
  Ropp, S.L., Jin, Q.I., Knight, J.C., Massung, R.F., and Esposito, J.J. 1995. PCR Strategy for identification and differentiation of small pox and other orthopoxviruses. J. Clin. Microbiol. 33:2069‐2076.
  Sanger, F., Nicklen, S., and Coulson, A.R. 1977. DNA Sequencing with chain‐terminating inhibitors. Proc. Natl. Acad. Sci. U.S.A. 74:5463‐5467. doi: 10.1073/pnas.74.12.5463.
  Silva‐Fernandes, A.T., Travassos, C.E., Ferreira, J.M., Abrahão, J.S., Rocha, E.S., Viana‐Ferreira, F., dos Santos, J.R., Bonjardim, C.A., Ferreira, P.C., and Kroon, E.G. 2009. Natural human infections with vaccinia virus during bovine Vaccinia outbreaks. J. Clin. Virol. 44:308‐313. doi: 10.1016/j.jcv.2009.01.007.
  Stucky, B.J. 2012. SeqTrace: A graphical tool for rapidly processing DNA sequencing chromatograms. J. Biomol. Tech. 23:90‐93. doi: 10.7171/jbt.12‐2303‐004.
  Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30:2725‐2729. doi: 10.1093/molbev/mst197.
  Trindade, G.S., da Fonseca, F.G., Marques, J.T., Nogueira, M.L., Mendes, L.C., Borges, A.S., Peiró, J.R., Pituco, E.M., Bonjardim, C.A., Ferreira, P.C., and Kroon, E.G. 2003. Araçatuba virus: A Vaccinia‐Like virus associated with infection in humans and cattle. Emerg. Infect. Dis. 9:155‐160. doi: 10.3201/eid0902.020244.
  Trindade, G.S., Lobato, Z.I.P., Drumond, B.P., Leite, J.A., Trigueiro, R.C., Guedes, M.I.M.C., da Fonseca, F.G., Santos, J.R.D., Bonjardim, C.A., Ferreira, P.C.P., and Kroon, E.G. 2006. Isolation of two Vaccinia virus strains from a single bovine Vaccinia outbreak in rural area from Brazil: Implications on the emergence of zoonotic orthopoxviruses. Am. J. Trop. Med. Hyg. 75:486‐490.
Key References
  Abrahão, J.S., Guedes, M.I., Trindade, G.S., Fonseca, F.G., Campos, R.K., Mota, B.E., Lobato, Z.I., Fernandes, A.T., Rodrigues, G.O., Lima, L.S., Ferreira, P.C., Bonjardim, C.A., and Kroon, E.G. 2009. One more piece in the VACV ecological puzzle: Could peridomestic rodents be the link between wildlife and bovine Vaccinia outbreaks in Brazil? PLoS ONE 4:1‐7. doi: 10.1371/journal.pone.0005361.
  This manuscript describes the circulation of VACV in bovines and peridomestic rodents.
  Damon, I. 2013. Poxviridae and their replication. In Fields Virology, 6th ed. (B.N. Fields, D.M. Knipe, and P.M. Howley, eds.) pp. 2129‐2159. Lippincott, Williams, and Wilkins, Philadelphia.
  A useful book chapter with basic virology information on poxviruses.
  Kroon, E.G., Mota, B.E., Abrahão, J.S., da Fonseca, F.G., and de Souza Trindade, G. 2011. Zoonotic Brazilian Vaccinia virus: From field to therapy. Antiviral Res. 92:150‐163. doi: 10.1016/j.antiviral.2011.08.018.
  An extensive review about the Brazilian VACV, from discovery to diagnosis.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library