Construction of a Transcription Map for Papillomaviruses using RACE, RNase Protection, and Primer Extension Assays

Xiaohong Wang1, Zhi‐Ming Zheng1

1 Tumor Virus RNA Biology Section, Gene Regulation and Chromosome Biology Laboratory, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Frederick, Maryland
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14B.6
DOI:  10.1002/9780471729259.mc14b06s40
Online Posting Date:  February, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Papillomaviruses are a family of small, non‐enveloped DNA tumor viruses. Knowing a complete transcription map of each papillomavirus genome can provide guidance for various papillomavirus studies. This unit provides detailed protocols to construct a transcription map of human papillomavirus type 18. The same approach can be easily adapted to other transcription map studies of any other papillomavirus genotype due to the high degree of conservation in genome structure, organization, and gene expression among papillomaviruses. The focused methods are 5′‐ and 3′‐rapid amplification of cDNA ends (RACE), which are techniques commonly used in molecular biology to obtain full‐length RNA transcript or to map a transcription start site (TSS) or an RNA polyadenylation (pA) cleavage site. Primer walking RT‐PCR is a method for studying the splicing junction of RACE products. In addition, RNase protection assay and primer extension are also introduced as alternative methods in the mapping analysis. © 2016 by John Wiley & Sons, Inc.

Keywords: papillomaviruses; transcription map; RACE; primer walking; RPA; primer extension

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Rapid Amplification of cDNA Ends (RACE)
  • Basic Protocol 2: Primer Walking RT‐PCR to Detect a Splice Junction
  • Basic Protocol 3: RNase Protection Assay
  • Basic Protocol 4: Primer Extension
  • Support Protocol 1: Preparation of 8% Denaturing Page Gel and Gel Analysis of Primer Extention and RPA Products
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Rapid Amplification of cDNA Ends (RACE)

  Materials
  • 100% ethanol
  • TRIzol reagent (Invitrogen)
  • HeLa cell monolayers in 35‐mm dishes
  • HPV‐infected raft tissues from human keratinocytes (see unit 14.3)
  • Chloroform
  • Isopropyl alcohol
  • 75% and 95% ethanol (in DEPC‐treated water)
  • RNase‐free water (DEPC‐treated)
  • QuickPrep Micro mRNA purification kit (GE Healthcare) containing:
    • Oligo(dT)‐cellulose
    • Extraction buffer: buffered aqueous solution containing guanidinium thiocyanate and N‐lauroyl sarcosine
    • High‐salt buffer: 10 mM Tris·Cl (pH 7.5), 1 mM EDTA, 0.5 M NaCl
    • Low‐salt buffer: 10 mM Tris·Cl (pH 7.5), 1 mM EDTA, 0.1 M NaCl
    • Elution buffer: 10 mM Tris·Cl (pH 7.5), 1 mM EDTA
    • Glycogen solution: 5 to 10 mg/ml glycogen in DEPC‐treated water
    • Potassium acetate solution: 2.5 M potassium acetate (pH 5.0)
    • MicroSpin columns
  • SMARTer RACE cDNA Amplification Kit (Clontech) containing:
    • 5× first‐strand buffer: 250 mM Tris·Cl (pH 8.3), 375 mM KCl, 30 mM MgCl 2, RNase‐free
    • Dithiothreitol (DTT; 20 mM)
    • dNTP mix (dATP, dCTP, dGTP, and dTTP, each at 10 mM)
    • 5′‐RACE CDS primer A (5′‐CDS; 12 μM)
    • 5′‐(T) 25VN‐3′ (N = A, C, G, or T; V = A, G, or C)
    • 3′‐RACE CDS primer A (3′‐CDS; 12 μM)
    • 5′–AAGCAGTGGTATCAACGCAGAGTAC(T)30 VN–3′ (N = A, C, G, or T; V = A, G, or C)
    • Deionized H 2O
    • SMARTer IIA oligonucleotide (12 μM)
    • 5′–AAGCAGTGGTATCAACGCAGAGTACXXXXX–3′ (X, undisclosed base including I and G)
    • RNase inhibitor (40 U/μl)
    • SMARTScribe reverse transcriptase (100 U/μl)
    • Tricine‐EDTA buffer (10 mM Tricine‐KOH, pH 8.5, 1.0 mM EDTA)
  • Advantage 2 PCR kit (Clontech) containing:
    • PCR‐grade water
    • 10× Advantage 2 PCR buffer: 400 mM Tricine‐KOH (pH 8.7 at 25°C), 150 mM KOAc, 35 mM Mg(OAc) 2, 37.5 μg/ml BSA, 0.05% Tween 20, 0.05% Nonidet‐P40
    • 50× dNTP mix
    • 50× Advantage 2 polymerase mix
    • 5′‐RACE‐Ready cDNA
    • 3′‐RACE‐Ready cDNA
    • 10× universal primer A mix (UPM)
    • Long (0.4 μM): 5′‐CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT‐3′
    • Short (2 μM): 5′‐CTAATACGACTCACTATAGGGC‐3′
    • Nested universal primer A (NUP; 10 μM): 5′‐AAGCAGTGGTATCAACGCAGAGT‐3′
  • HPV18‐specific primer (10 μM; see Table 14.6.1)
  • 1.2% to 2% low‐melting agarose gel
  • QIAquick Gel Extraction Kit (Qiagen) containing:
  • QIAquick spin columns
  • Buffer QG: 5.5 M guanidine thiocyanate (GuSCN), 20 mM Tris·Cl (pH 6.6)
  • Buffer PE: 10 mM Tris·Cl (pH 7.5), 80% ethanol
  • Buffer EB: 10 mM Tris·Cl, pH 8.5
  • 3 M sodium acetate, pH 5.0
  • Isopropanol
  • pCR2.1‐TOPO TA Cloning Kit (Invitrogen) containing:
  • Salt solution: 1.2 M NaCl, 0.06 M MgCl 2
  • Sterile water
  • pCR2.1‐TOPO vector
  • dNTPs
  • M13 forward primer (5′‐GTAAAACGACGGCCAG‐3′)
  • M13 reverse primer (5′‐CAGGAAACAGCTATGAC‐3′)
  • One Shot TOP10 competent cells (ThermoFisher Scientific)
  • SOC medium (Sigma‐Aldrich)
  • LB plates containing 50 μg/ml ampicillin
  • LB broth containing 50 μg/ml ampicillin
  • DEPC water
  • 10× PCR buffer II: 200 mM Tris·Cl (pH 8.4), 500 mM KCl
  • 25 mM MgCl 2
  • 5 U/μl Taq DNA polymerase
  • QIAprep Spin Miniprep Kit (Qiagen) containing:
  • QIAprep spin columns
  • Buffer P1: 50 mM Tris·Cl (pH 8.0), 10 mM EDTA, 100 μg/ml RNase A
  • Buffer P2: 200 mM NaOH, 1% SDS
  • Buffer N3: 4.2 M Gu‐HCl, 0.9 M potassium acetate, pH 4.8
  • Buffer PE: 10 mM Tris·Cl (pH 7.5), 80% ethanol
  • Buffer EB: 10 mM Tris·Cl, pH 8.5
  • BigDye terminator v1.1 ready reaction mix (Applied Biosystems, Lift Technologies)
  • 2.5× sequencing buffer: 200 mM Tris·Cl, 5 mM MgCl 2, pH 9.0
  • 1.5‐ml microcentrifuge tubes, RNase‐free
  • Electric homogenizer with disposable probes (Omni International), optional
  • Refrigerated microcentrifuge
  • NanoDrop 1000 spectrophotometer
  • 37°, 42°, 50°, and 72°C water baths
  • Thermal cycler
  • 0.2‐ml PCR tubes
  • Owl EasyCast B2 Mini gel electrophoresis systems
  • Razor blades
  • Analytical balance
  • 14‐ml conical tubes (Falcon)
  • 37°C shaking incubator
  • Centrifuge
  • Centri‐Spin Columns (Princeton Separations)
  • SpeedVac evaporator
  • 3130XL DNA Analyzer system (Applied Biosystems, Life Technologies)
Table 4.0.1   MaterialsPrimers Used for 5′ RACE to Map an HPV18 TSS and 3′ RACE to Map an HPV18 pA Cleavage Site a

Forward primer
nt 3976‐3996 3′RACE mapping HPV18 pA cleavage sites for early transcripts 5′‐ TGTATGTGTGCTGCCATG TCC‐3′
nt 7038‐7056 3′RACE mapping HPV18 pA cleavage sites for late transcripts 5′‐ CGTCGCAAGCCCACC ATAG‐3′
Reverse primer
nt 233‐209 5′RACE mapping HPV18 TSS for early transcripts 5′‐ CTCTGTAAGTTCCAATACT GTCTTG‐3′
nt 850‐833 5′RACE mapping HPV18 TSS for late transcripts 5′‐CTGGAATGCTCGAAGG TC‐3′
nt 904‐886 5′RACE mapping HPV18 TSS for late transcripts 5′‐CACTGAGGTAC/CTGCT GGGATGCACACCAC‐3′
nt 3517‐3500 5′RACE mapping HPV18 splice junctions 5′‐ ACGGACACGGTGCTGG AA‐3′

 aHPV18‐specific primers (Wang et al., ) designed to meet regular primer criteria and not complementary to the 3′‐end of the universal primer A mix. Primers in similar positions for other papillomaviruses can be designed accordingly.

Basic Protocol 2: Primer Walking RT‐PCR to Detect a Splice Junction

  Materials
  • Total RNAs (see protocol 1, step 9)
  • RQ1 RNase‐free DNase 10× reaction buffer: 400 mM Tris·Cl, pH 8.0, 100 mM MgSO 4, 10 mM CaCl 2 (Promega)
  • RQ1 RNase‐free DNase (Promega)
  • Nuclease‐free water
  • RQ1 DNase stop solution: 20 mM EGTA, pH 8.0 (Promega)
  • DEPC‐treated water, ice cold
  • 5 M ammonium acetate
  • Glycogen
  • 75% and 100% ethanol, ice cold
  • 10× PCR buffer II: 200 mM Tris·Cl, pH 8.4, 500 mM KCl (Life Technologies)
  • 25 mM MgCl 2 (Life Technologies)
  • dNTP mix (10 mM each) (Life Technologies)
  • 5 U/μl Taq DNA polymerase (Life Technologies)
  • 40 U/μl RNase inhibitor (Life Technologies)
  • 50 μM random hexamer (Life Technologies)
  • 50 U/μl MuLV reverse transcriptase (Life Technologies)
  • HPV‐specific forward primer (20 μM)
  • HPV‐specific reverse primer (20 μM)
  • 1.2% to 2% low‐melting agarose gel
  • 37° and 65°C water baths
  • Refrigerated centrifuge
  • NanoDrop 1000 spectrophotometer
  • Thermal cycler
  • Additional reagents and equipment for gel electrophoresis, TOPO TA cloning, plasmid minipreparation, plasmid DNA sequencing, and data analysis (see protocol 1)

Basic Protocol 3: RNase Protection Assay

  Materials
  • Riboprobe in vitro Transcription Systems (Promega) containing:
  • 5× transcription buffer: 200 mM Tris·Cl, pH 7.9, 30 mM MgCl 2, 10 mM spermidine, 50 mM NaCl
  • DTT (100 mM)
  • RNase inhibitor (20 U/μl)
  • rATP (10 mM)
  • rUTP (10 mM)
  • rGTP (1 mM)
  • rCTP (10 mM)
  • m7G (5′)ppp(5′) (10 mM)
  • α‐32P rGTP (10 mCi/ml, 3000 Ci/mmol)
  • T7 RNA polymerase (20 U/μl)
  • Nuclease‐free water
  • Linearized DNA template or PCR product with T7 promoter attached
  • DEPC‐treated water
  • 5 M ammonium acetate
  • 75% and 100% ethanol, room temperature and ice cold
  • 10× TURBO DNase buffer: 200 mM Tris·Cl, pH 7.5, 100 mM MgCl 2, and 5 mM CaCl 2, pH 7.5 (Ambion)
  • TURBO DNase (Ambion)
  • Formamide loading dye: 49 ml formamide, 1 ml 0.5 M EDTA, 0.013 g bromophenol blue, 0.013 g xylene cyanol
  • 6%, 7.5 M urea gel (see protocol 5Support Protocol)
  • PAGE gel elution buffer: 0.5 M ammonium acetate, 1 mM EDTA, 0.2% SDS
  • tRNA or yeast RNA (Ambion)
  • RPA III System (Ambion) containing:
  • Hybridization III buffer: 80% formamide, 400 mM NaCl, 40 mM PIPES, pH 6.4, 1 mM EDTA
  • RNase A/RNase T1 mix: 250 U/ml RNase A and 10,000 U/ml RNase T1
  • RNase digestion III buffer: 5 mM EDTA, 300 mM NaCl, 10 mM Tris·Cl, pH 7.5
  • RNase inactivation/precipitation III solution: 4 M guanidine isothiocyanate, 0.5% n‐lauroyl sarcosine, 25 mM sodium citrate, pH 7.0, 0.1 M β‐mercaptoethanol, 4 μg/ml yeast tRNA
  • RNA loading dye: 95% formamide, 0.025% xylene cyanol and bromophenol blue, 18 mM EDTA, 0.025% SDS
  • Human pTRI‐cyclophilin DNA template
  • 8% denaturing PAGE gel
  • 0.5× TBE: 44.5 mM Tris base, 44.5 mM boric acid, 0.95 mM EDTA
  • DNase inactivation reagent: 0.5 mM EDTA, pH 8.0, 10 mM Tris·Cl, pH 7.5
  • 37°, 42°, and 75°C water baths
  • Refrigerated centrifuge
  • Gel electrophoresis apparatus
  • Plastic wrap
  • X‐ray film, cassettes, and developer
  • 1.5‐ml microcentrifuge tubes
  • Millipore 0.44‐μm filtration tubes
  • Beckman LS 6500 scintillation counter
  • 3M filter paper
  • Gel dryer

Basic Protocol 4: Primer Extension

  Materials
  • T4 polynucleotide kinase (New England Biolab)
  • T4 polynucleotide kinase 10× buffer: 500 mM Tris·Cl, pH 7.5, 100 mM MgCl 2, 50 mM DTT, 1 mM spermidine
  • γ‐32P ATP (10 mCi/ml, 3000 Ci/mmol, GE Healthcare Life Sciences)
  • Nuclease‐free water
  • 100‐bp DNA ladder (Invitrogen)
  • 5 M ammonium acetate
  • 75% and 100% ethanol, ice cold
  • AMV primer extension 2× buffer: 100 mM Tris·Cl, pH 8.3 (42°C), 100 mM KCl, 20 mM MgCl 2, 20 mM DTT, 2 mM each dNTP, 1 mM spermidine
  • Sodium pyrophosphate (40 mM)
  • AMV reverse transcriptase (Promega)
  • DEPC‐treated water
  • Loading dye: 98% formamide, 10 mM EDTA, 0.1% xylene cyanol, 0.1% bromophenol blue
  • TE buffer
  • USB Sequenase Version 2.0 DNA Sequencing Kit contains the following reagents:
  • Sequenase version 2.0 DNA polymerase (13 U/μl)
  • Inorganic pyrophosphatase (4 U/μl)
  • Enzyme dilution buffer: 10 mM Tris·Cl, pH 7.5, 5 mM DTT, 0.1 mM EDTA
  • Glycerol enzyme dilution buffer: 20 mM Tris·Cl, pH 7.5, 2 mM DTT, 0.1 mM EDTA, 50% glycerol
  • 5× Sequenase reaction buffer: 200 mM Tris·Cl, pH 7.5, 100 mM MgCl 2, 250 mM NaCl
  • Dithiothreitol solution (0.1 M)
  • Mn buffer: 0.15 M sodium isocitrate, 0.1 M MnCl
  • Control DNA M13 mp18 (0.2 μg/μl)
  • Primer (−40 M13) (0.5 pmol/μl, 5′‐GTTTTCCCAGTCACGAC‐3′)
  • 5× labeling mix: 7.5 μM dGTP, 7.5 μM dCTP, 7.5 μM dTTP
  • ddGTP termination mix: 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddGTP, 50 mM NaCl
  • ddATP termination mix: 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddATP, 50 mM NaCl
  • ddTTP termination mix: 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddTTP, 50 mM NaCl
  • ddCTP termination mix: 80 μM dGTP, 80 μM dATP, 80 μM dCTP, 80 μM dTTP, 8 μM ddCTP, 50 mM NaCl
  • Sequencing extending mix: 180 μM each dGTP, dATP, dCTP, dTTP, 50 mM NaCl
  • Stop solution: 95% formamide, 20 mM EDTA, 0.05% bromophonel blue, 0.05% xylene cyanol FF
  • Denaturing polyacrylamide gel (see protocol 5Support Protocol)
  • 0.5× TBE buffer
  • 37°C water bath
  • 42°, 58°, 65°, 75°, and 90°C heating blocks
  • Refrigerated centrifuge
  • Electrophoresis apparatus
  • 3M filter paper
  • Plastic wrap
  • Gel dryer (Savant stacked gel dryer SGD300)
  • X‐ray film or PhosphorImager

Support Protocol 1: Preparation of 8% Denaturing Page Gel and Gel Analysis of Primer Extention and RPA Products

  Materials
  • 70% ethanol
  • Sigma cote
  • SequaGel UreaGel System (National diagnostics) containing:
  • UreaGel concentrate: 237.5 g/liter of acrylamide, 12.5 g/liter of methylene bisacrylamide, 7.5 M urea in deionized water
  • UreaGel diluent: 7.5 M urea in deionized water
  • UreaGel buffer: 0.89 M Tris‐borate, 20 mM EDTA, pH 8.3, 10× TBE, and 7.5 M urea
  • 10% ammonium persulfate
  • TEMED
  • 1× TBE: 89 mM Tris base, 89 mM boric acid, 1.9 mM EDTA
  • Sequencing glass plates (Gibco BRL)
  • Spacers (0.4‐mm thick, Gibco‐BRL)
  • 100‐ml Erlenmeyer flask
  • Combs (0.4‐mm thick, Gibco‐BRL)
  • Model S2 sequencing gel electrophoresis apparatus (Gibco‐BRL)
  • Savant stacked gel dryer SGD300
  • 3 M filter paper
  • Plastic wrap
  • Kodak X‐ray film
  • Kodak X‐ray cassettes
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Banerjee, N.S., Chow, L.T., and Broker, T.R. 2005. Retrovirus‐mediated gene transfer to analyze HPV gene regulation and protein functions in organotypic “raft” cultures. Methods Mol. Med. 119:187‐202.
  Bernard, H.U. 2002. Gene expression of genital human papillomaviruses and considerations on potential antiviral approaches. Antivir. Ther. 7:219‐237.
  Bernard, H.U., Burk, R.D., Chen, Z., van Doorslaer, K., Hausen, H., and de Villiers, E.M. 2010. Classification of papillomaviruses (PVs) based on 189 PV types and proposal of taxonomic amendments. Virology 401:70‐79. doi: 10.1016/j.virol.2010.02.002.
  Boyle, A.P., Guinney, J., Crawford, G.E., and Furey, T.S. 2008. F‐Seq: A feature density estimator for high‐throughput sequence tags. Bioinformatics 24:2537‐2538. doi: 10.1093/bioinformatics/btn480.
  Chenchik, A., Diachenko, L., Moqadam, F., Tarabykin, V., Lukyanov, S., and Siebert, P.D. 1996. Full‐length cDNA cloning and determination of mRNA 5′ and 3′ ends by amplification of adaptor‐ligated cDNA. Biotechniques 21:526‐534.
  Chiang, C.M., Broker, T.R., and Chow, L.T. 1991. An E1M‐E2C fusion protein encoded by human papillomavirus type 11 is a sequence‐specific transcription repressor. J. Virol. 65:3317‐3329.
  Dollard, S.C., Wilson, J.L., Demeter, L.M., Bonnez, W., Reichman, R.C., Broker, T.R., and Chow, L.T. 1992. Production of human papillomavirus and modulation of the infectious program in epithelial raft cultures. OFF. Genes Dev. 6:1131‐1142. doi: 10.1101/gad.6.7.1131.
  Doorbar, J. 2005. The papillomavirus life cycle. J. Clin. Virol. 32:S7‐15. doi: 10.1016/j.jcv.2004.12.006.
  Drury, S.E., Gough, R.E., McArthur, S., and Jessop, M. 1998. Detection of herpesvirus‐like and papillomavirus‐like particles associated with diseases of tortoises. Vet. Rec. 143:639.
  Guo, M., Gong, Y., Deavers, M., Silva, E.G., Jan, Y.J., Cogdell, D.E., Luthra, R., Lin, E., Lai, H.C., Zhang, W., and Sneige, N. 2008. Evaluation of a commercialized in situ hybridization assay for detecting human papillomavirus DNA in tissue specimens from patients with cervical intraepithelial neoplasia and cervical carcinoma. J. Clin. Microbiol. 46:274‐280. doi: 10.1128/JCM.01299‐07.
  Herbst, L.H., Lenz, J., Van, D.K., Chen, Z., Stacy, B.A., Wellehan, J.F., Jr., Manire, C.A., and Burk, R.D. 2009. Genomic characterization of two novel reptilian papillomaviruses, Chelonia mydas papillomavirus 1 and Caretta caretta papillomavirus 1. Virology 383:131‐135. doi: 10.1016/j.virol.2008.09.022.
  Hopman, A.H., Kamps, M.A., Smedts, F., Speel, E.J., Herrington, C.S., and Ramaekers, F.C. 2005. HPV in situ hybridization: Impact of different protocols on the detection of integrated HPV. Int. J. Cancer 115:419‐428. doi: 10.1002/ijc.20862.
  Hummel, M., Hudson, J.B., and Laimins, L.A. 1992. Differentiation‐induced and constitutive transcription of human papillomavirus type 31b in cell lines containing viral episomes. J. Virol. 66:6070‐6080.
  Jia, R., Liu, X., Tao, M., Kruhlak, M., Guo, M., Meyers, C., Baker, C.C., and Zheng, Z.M. 2009. Control of the papillomavirus early‐to‐late switch by differentially expressed SRp20. J. Virol. 83:167‐180. doi: 10.1128/JVI.01719‐08.
  Kawaji, H., Frith, M.C., Katayama, S., Sandelin, A., Kai, C., Kawai, J., Carninci, P., and Hayashizaki, Y. 2006. Dynamic usage of transcription start sites within core promoters. Genome Biol. 7:R118. doi: 10.1186/gb‐2006‐7‐12‐r118.
  Kiyono, T., Nagashima, K., and Ishibashi, M. 1989. The primary structure of major viral RNA in a rat cell line transfected with type 47 human papillomavirus DNA and the transforming activity of its cDNA and E6 gene. Virology 173:551‐565. doi: 10.1016/0042‐6822(89)90567‐9.
  Lange, C.E., Favrot, C., Ackermann, M., Gull, J., Vetsch, E., and Tobler, K. 2011. Novel snake papillomavirus does not cluster with other non‐mammalian papillomaviruses. Virol. J. 8:436. doi: 10.1186/1743‐422X‐8‐436.
  Li, Y., Wang, X., Ni, T., Wang, F., Lu, W., Zhu, J., Xie, X., and Zheng, Z.M. 2013. Human papillomavirus type 58 genome variations and RNA expression in cervical lesions. J. Virol. 87:9313‐9322. doi: 10.1128/JVI.01154‐13.
  Longworth, M.S. and Laimins, L.A. 2004. Pathogenesis of human papillomaviruses in differentiating epithelia. Microbiol. Mol. Biol. Rev. 68:362‐372. doi: 10.1128/MMBR.68.2.362‐372.2004.
  Majerciak, V., Yamanegi, K., and Zheng, Z.M. 2006. Gene structure and expression of Kaposi's sarcoma‐associated herpesvirus ORF56, ORF57, ORF58, and ORF59. J. Virol. 80:11968‐11981. doi: 10.1128/JVI.01394‐06.
  Majerciak, V., Ni, T., Yang, W., Meng, B., Zhu, J., and Zheng, Z.M. 2013. A viral genome landscape of RNA polyadenylation from KSHV latent to lytic infection. PLoS. Pathog. 9:e1003749. doi: 10.1371/journal.ppat.1003749.
  Maruyama, K. and Sugano, S. 1994. Oligo‐capping: A simple method to replace the cap structure of eukaryotic mRNAs with oligoribonucleotides. Gene 138:171‐174. doi: 10.1016/0378‐1119(94)90802‐8.
  McLaughlin‐Drubin, M.E., Christensen, N.D., and Meyers, C. 2004. Propagation, infection, and neutralization of authentic HPV16 virus. Virology 322:213‐219. doi: 10.1016/j.virol.2004.02.011.
  Meyers, C., Mayer, T.J., and Ozbun, M.A. 1997. Synthesis of infectious human papillomavirus type 18 in differentiating epithelium transfected with viral DNA. J. Virol. 71:7381‐7386.
  Meyers, C., Frattini, M.G., Hudson, J.B., and Laimins, L.A. 1992. Biosynthesis of human papillomavirus from a continuous cell line upon epithelial differentiation. Science 257:971‐973. doi: 10.1126/science.1323879.
  Middleton, K., Peh, W., Southern, S., Griffin, H., Sotlar, K., Nakahara, T., El Sherif, A., Morris, L., Seth, R., Hibma, M., Jenkins, D., Lambert, P., Coleman, N., and Doorbar, J. 2003. Organization of human papillomavirus productive cycle during neoplastic progression provides a basis for selection of diagnostic markers. J. Virol. 77:10186‐10201. doi: 10.1128/JVI.77.19.10186‐10201.2003.
  Mistry, N., Wibom, C., and Evander, M. 2008. Cutaneous and mucosal human papillomaviruses differ in net surface charge, potential impact on tropism. Virol. J. 5:118. doi: 10.1186/1743‐422X‐5‐118.
  Munoz, N., Castellsague, X., de Gonzalez, A.B., and Gissmann, L. 2006. Chapter 1: HPV in the etiology of human cancer. Vaccine 24:S3‐1‐S310.
  Ni, T., Corcoran, D.L., Rach, E.A., Song, S., Spana, E.P., Gao, Y., Ohler, U., and Zhu, J. 2010. A paired‐end sequencing strategy to map the complex landscape of transcription initiation. Nat. Methods 7:521‐527. doi: 10.1038/nmeth.1464.
  Ni, T., Yang, Y., Hafez, D., Yang, W., Kiesewetter, K., Wakabayashi, Y., Ohler, U., Peng, W., and Zhu, J. 2013. Distinct polyadenylation landscapes of diverse human tissues revealed by a modified PA‐seq strategy. BMC. Genomics 14:615. doi: 10.1186/1471‐2164‐14‐615.
  Ozbun, M.A. and Meyers, C. 1997. Characterization of late gene transcripts expressed during vegetative replication of human papillomavirus type 31b. J. Virol. 71:5161‐5172.
  Palermo‐Dilts, D.A., Broker, T.R., and Chow, L.T. 1990. Human papillomavirus type 1 produces redundant as well as polycistronic mRNAs in plantar warts. J. Virol. 64:3144‐3149.
  Pauws, E., van Kampen, A.H., van de Graaf, S.A., de Vijlder, J.J., and Ris‐Stalpers, C. 2001. Heterogeneity in polyadenylation cleavage sites in mammalian mRNA sequences: Implications for SAGE analysis. Nucleic Acids Res. 29:1690‐1694. doi: 10.1093/nar/29.8.1690.
  Renaud, K.J. and Cowsert, L.M. 1996. Characterization of human papillomavirus‐11 mRNAs expressed in the context of autonomously replicating viral genomes. Virology 220:177‐185. doi: 10.1006/viro.1996.0298.
  Sankovski, E., Mannik, A., Geimanen, J., Ustav, E., and Ustav, M. 2014. Mapping of betapapillomavirus human papillomavirus 5 transcription and characterization of viral‐genome replication function. J. Virol. 88:961‐973. doi: 10.1128/JVI.01841‐13.
  Tang, S. and Zheng, Z.M. 2002. Kaposi's sarcoma‐associated herpesvirus K8 exon 3 contains three 5′‐ splice sites and harbors a K8.1 transcription start site. J. Biol. Chem. 277:14547‐14556. doi: 10.1074/jbc.M111308200.
  Wang, H.K., Duffy, A.A., Broker, T.R., and Chow, L.T. 2009a. Robust production and passaging of infectious HPV in squamous epithelium of primary human keratinocytes. Genes Dev. 23:181‐194. doi: 10.1101/gad.1735109.
  Wang, X., Meyers, C., Wang, H.K., Chow, L.T., and Zheng, Z.M. 2011. Construction of a full transcription map of human papillomavirus type 18 during productive viral infection. J. Virol. 85:8080‐8092. doi: 10.1128/JVI.00670‐11.
  Wang, X., Tang, S., Le, S.Y., Lu, R., Rader, J.S., Meyers, C., and Zheng, Z.M. 2008. Aberrant expression of oncogenic and tumor‐suppressive microRNAs in cervical cancer is required for cancer cell growth. PLoS. ONE. 3:e2557. doi: 10.1371/journal.pone.0002557.
  Wang, X., Wang, H.‐K., McCoy, J.P., Banerjee, N.S., Rader, J.S., Broker, T.R., Meyers, C., Chow, L.T., and Zheng, Z.M. 2009b. Oncogenic HPV infection interrupts the expression of tumor‐suppressive miR‐34a through viral oncoprotein E6. RNA 15:637‐647. doi: 10.1261/rna.1442309.
  Wang, X., Wang, H.K., Li, Y., Hafner, M., Banerjee, N.S., Tang, S., Briskin, D., Meyers, C., Chow, L.T., Xie, X., Tuschl, T., and Zheng, Z.M. 2014. microRNAs are biomarkers of oncogenic human papillomavirus infections. Proc. Natl. Acad. Sci. U. S. A 111:4262‐4267. doi: 10.1073/pnas.1401430111.
  Yang, C., Bolotin, E., Jiang, T., Sladek, F.M., and Martinez, E. 2007. Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA‐less core promoters. Gene 389:52‐65. doi: 10.1016/j.gene.2006.09.029.
  Zheng, Z.M. and Baker, C.C. 2006. Papillomavirus genome structure, expression, and post‐transcriptional regulation. Front Biosci. 11:2286‐2302. doi: 10.2741/1971.
  Zhu, Y.Y., Machleder, E.M., Chenchik, A., Li, R., and Siebert, P.D. 2001. Reverse transcriptase template switching: A SMART approach for full‐length cDNA library construction. Biotechniques 30:892‐897.
  Zhumabayeva, B., Diatchenko, L., Chenchik, A., and Siebert, P.D. 2001. Use of SMART‐generated cDNA for gene expression studies in multiple human tumors. Biotechniques 30:158‐163.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library