Detection and Genotyping of Human Papillomaviruses from Archival Formalin‐Fixed Tissue Samples

Koenraad Van Doorslaer1, Zigui Chen2, Alison A. McBride1

1 Lab of Viral Diseases, NIAID, NIH, Bethesda, Maryland, 2 Department of Microbiology, The Chinese University of Hong Kong
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14B.9
DOI:  10.1002/cpmc.16
Online Posting Date:  November, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Pathology departments routinely process and store formalin‐fixed, paraffin‐embedded (FFPE) tissue samples for clinical diagnosis. These collections often contain decades’ worth of samples and represent a treasure trove of specimens that can be analyzed for retrospective epidemiological studies, diagnostics, and pathogen discovery. Accurate amplification and sequencing of DNA from these samples is critical for the usability of these FFPE samples. Here we present a collection of protocols that describe extraction of DNA from FFPE tissues, PCR amplification of human papillomavirus DNA, and subsequent genotyping of the infecting virus. © 2016 by John Wiley & Sons, Inc.

Keywords: cervix; cancer; degenerate primers; FFPE; formalin; HPV; neoplasia; PCR; papillomavirus; sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: DNA Isolation from Formalin‐Fixed Paraffin‐Embedded Tissue
  • Basic Protocol 2: Use of Degenerate SPF10 PCR Primers to Amplify HPV‐Specific DNA
  • Basic Protocol 3: Genotyping of PCR Amplicons
  • Alternate Protocol 1: Use of Degenerate GP5 +/6 + PCR Primers to Amplify HPV‐Specific DNA
  • Alternate Protocol 2: Use of Degenerate SPF1/GP6+ PCR Primers to Amplify HPV‐Specific DNA
  • Support Protocol 1: TOPO Cloning of PCR Amplicons
  • Support Protocol 2: Control Amplification of Cellular DNA
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: DNA Isolation from Formalin‐Fixed Paraffin‐Embedded Tissue

  Materials
  • FFPE tissue block or slides containing tissue sections
  • Xylene (Sigma, cat. no. 214736)
  • 95% Ethanol (Sigma, cat. no. 493511)
  • Qiagen DNeasy Blood & Tissue Kit (B&T Qiagen, cat. no.69504) containing:
    • DNeasy Mini Spin Columns and Collection Tubes
    • Tissue Lysis Buffer ATL
    • Lysis Buffer AL
    • Wash Buffer AW1 (concentrate; add ethanol before use; the volume of ethanol (96% to 100%) to be added is indicated on the bottle): Buffer AW1 is stable for at least 1 year when stored at room temperature
    • Wash Buffer AW2 (concentrate; add ethanol before use; the volume of ethanol (96% to 100%) to be added is indicated on the bottle): Buffer AW2 is stable for at least 1 year when stored at room temperature
    • Elution Buffer AE
    • Proteinase K
  • 3 M sodium acetate, pH 5.2 (see recipe)
  • TE buffer (see recipe)
  • 1.5‐ml microcentrifuge tubes
  • Vortex mixer
  • Microcentrifuge with rotor for 1.5‐ml and 2‐ml tubes
  • Pipet tips
  • Thermomixer, shaking water bath, or rocking platform for heating at 56°C
  • Bench top centrifuge capable of 20,000 × g

Basic Protocol 2: Use of Degenerate SPF10 PCR Primers to Amplify HPV‐Specific DNA

  Materials
  • SPF10 series of PCR primers (see Table 14.9.1; 100 μM stock concentration)
  • Double‐distilled water
  • High‐Fidelity PCR system (e.g., Roche FastStart High‐fidelity PCR system; Sigma cat. no. 3553400001) containing:
    • PCR buffer 2
    • FastStart High‐Fidelity Enzyme Blend
  • PCR‐grade deoxynucleoside triphosphates (dNTPs; Sigma, cat. no. 11969064001)
  • Template DNA (see protocol 1)
  • Nusieve 3:1 agarose (Lonza, cat. no. 50090)
  • 50 × TAE running buffer (see recipe)
  • Gel electrophoresis loading buffer (see recipe)
  • Ethidium bromide (10 mg/ml; Sigma, cat. no. E1510)
  • Molecular weight markers (e.g., NEB 2‐Log DNA ladder; NEB, cat. no. N3200S)
  • 200‐µl thin‐walled PCR tubes (or other appropriate for thermal cycler)
  • Thermal cycler
  • Agarose gel electrophoresis system
  • UV light box and camera
Table 4.0.1   MaterialsDetails of Oligonucleotide Primers Used in this Protocol

  Sequence T m (°C) Reference
SPF1A 5′‐GCiCAGGGiCACAATAATGG‐3′ 59.0 Quint et al. ( )
SPF1B 5′‐GCiCAGGGiCATAACAATGG‐3′ 59.0 Quint et al. ( )
SPF1C 5′‐GCiCAGGGiCATAATAATGG‐3′ 56.1 Quint et al. ( )
SPF1D 5′‐GCiCAAGGiCATAATAATGG‐3′ 54.0 Quint et al. ( )
SPF2A 5′‐GTiGTATCiACAACAGTAACAAA‐3′ 52.7 Quint et al. ( )
SPF2B 5′‐GTiGTATCiACTACAGTAACAAA‐3′ 51.8 Quint et al. ( )
GP5+ 5′‐TTTGTTACTGTGGTAGATACTAC‐3′ 49.5 de Roda Husman et al. ( )
GP6+ 5′‐GAAAAATAAACTGTAAATCATATTC‐3′ 45.3 de Roda Husman et al. ( )
GP68 5′‐TTTCTTACTGTTGTGGATACCAC‐3′ 52.7 Nazarenko et al. ( )
GAPDH F 5′‐GGCAGCAGCAAGCATTCCT‐3′ 59.0 Huang et al. ( )
GAPDH R 5′‐GCCCAACACCCCCAGTCA‐3′ 60.7 Huang et al. ( )

 a“i” represents inosine, will basepair with A, C, or T.
 bDo not add 5' phosphates to your primers for PCR, or the PCR product synthesized will not be suitable for TOPO‐TA mediated cloning ( protocol 6).

Basic Protocol 3: Genotyping of PCR Amplicons

  Materials
  • Chromatogram files
  • Software program capable of displaying sequence chromatograms: e.g., Geneious (Kearse et al., ); many free alternatives are available for different platforms (Windows, Mac OS, Linux)

Alternate Protocol 1: Use of Degenerate GP5 +/6 + PCR Primers to Amplify HPV‐Specific DNA

  Materials
  • GP5 +, GP6 +, and GP68 PCR primers (see Table 14.9.1; 100 μM stock concentration)
  • Double‐distilled water
  • HotStarTaq Plus DNA Polymerase (Qiagen cat. no. 203601) containing:
    • CoralLoad PCR buffer
    • MgCl 2
  • PCR‐grade deoxynucleoside triphosphates (dNTPs; Sigma, cat. no. 11969064001)
  • Template DNA (see protocol 1)
  • Uracyl‐DNA Glycosylase, heat labile (Roche cat no. 11775367001), optional
  • PCR nucleotide mixplus (Roche cat no 11888412001), optional
  • Nusieve 3:1 agarose (Lonza, cat.no. 50090)
  • 50 × TAE running buffer (see recipe)
  • Ethidium bromide (10 mg/ml; Sigma, cat. no. E1510)
  • Gel electrophoresis loading buffer (see recipe)
  • Molecular weight markers (e.g., NEB 2‐Log DNA ladder; NEB, cat.no. N3200S)
  • 200‐µl thin‐walled PCR tubes (or other appropriate for thermal cycler)
  • Thermal cycler
  • Agarose gel electrophoresis system
  • UV light box and camera

Alternate Protocol 2: Use of Degenerate SPF1/GP6+ PCR Primers to Amplify HPV‐Specific DNA

  Materials
  • SPF1 primers (see Table 14.9.1; 100 μM stock concentration)
  • GP6+ PCR primers (see Table 14.9.1; 100 μM stock concentration)
  • Double‐distilled water
  • AmpliTaq Gold DNA polymerase (ThermoFisher, cat. no. N8080241) containing:
  • GeneAmp 10× PCR buffer II
  • 10 mM PCR‐grade deoxynucleoside triphosphates (dNTPs; Sigma, cat. no. 11969064001)
  • 25 mM MgCl 2
  • Template DNA (see protocol 1)
  • Nusieve 3:1 agarose (Lonza, cat.no. 50090)
  • 50 × TAE running buffer (see recipe)
  • Ethidium bromide (10 mg/ml; Sigma, cat. no. E1510)
  • Gel electrophoresis loading buffer (see recipe)
  • Molecular weight markers (e.g., NEB 2‐Log DNA ladder; NEB, cat.no. N3200S)
  • 200‐µl thin‐walled PCR tubes (or other appropriate for thermal cycler)
  • Thermal cycler
  • Agarose gel electrophoresis system
  • UV light box and camera

Support Protocol 1: TOPO Cloning of PCR Amplicons

  Materials
  • PCR fragment (see protocol 2 or protocol 4 or 2)
  • PCR clean‐up kit (e.g., High Pure PCR Product Purification Kit; Roche, cat.no. 11732668001)
  • Agarose Gel purification kit (e.g., zymoclean Gel DNA recovery kit; Zymo. cat. no. D4007)
  • 10 × ThermoPol Buffer (NEB, cat. no. B9004)
  • 10 mM dATP
  • Taq DNA Polymerase (NEB, cat. no. M0267)
  • Double‐distilled water
  • TOPO TA cloning kit (ThermoFisher, cat. no. K450001) containing:
    • Salt solution (1.2 M NaCl and 0.06 M MgCl 2)
    • Topoisomerase I‐activated pCR 2.1‐TOPO vector
  • One Shot Chemically Competent E. coli [TOP10; F– mcrA Δ(mrrhsdRMS‐mcrBC) Φ80lacZ Δ M15 Δ lacX74 recA1 araD139 Δ(ara leu) 7697 galU galK rpsL (StrR) endA1 nupG]
  • Ice
  • S.O.C. medium (see recipe)
  • LB plates containing 50 µg/ml Kanamycin or Carbenicillin
  • Liquid selective LB medium
  • Miniprep kit (e.g., Wizard Plus SV Miniprep; Promega, cat. no. A1270)
  • 200‐µl thin‐walled PCR tubes (or other appropriate for thermal cycler)
  • Thermal cycler
  • Shaking incubator

Support Protocol 2: Control Amplification of Cellular DNA

  Additional Materials (see protocol 1)
  • GAPDH primers (see Table 14.9.1; 100 μM stock concentration)
  • Double‐distilled water
  • AmpliTaq Gold DNA polymerase (ThermoFisher, cat. no. N8080241) containing:
  • GeneAmp 10× PCR buffer
  • PCR‐grade deoxynucleoside triphosphates (dNTPs; Sigma, cat. no. 11969064001)
  • Template DNA (see protocol 1)
  • Nusieve 3:1 agarose (Lonza, cat.no. 50091)
  • 200‐µl thin‐walled PCR tubes (or other appropriate for thermal cycler)
  • Thermal cycler or heat block capable of maintaining 72°C
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Alvarez‐Aldana, A., Martinez, J.W., and Sepulveda‐Arias, J.C. 2015. Comparison of five protocols to extract DNA from paraffin‐embedded tissues for the detection of human papillomavirus. Pathol. Res. Pract. 211:150‐155. doi: 10.1016/j.prp.2014.10.011.
  Bodily, J. and Laimins, L.A. 2011. Persistence of human papillomavirus infection: Keys to malignant progression. Trends Microbiol 19:33‐39. doi: 10.1016/j.tim.2010.10.002.
  Boshart, M., Gissmann, L., Ikenberg, H., Kleinheinz, A., Scheurlen, W., and zur Hausen, H. 1984. A new type of papillomavirus DNA, its presence in genital cancer biopsies and in cell lines derived from cervical cancer. EMBO J. 3:1151‐1157.
  Castro, F.A., Koshiol, J., Quint, W., Wheeler, C.M., Gillison, M.L., Vaughan, L.M., Kleter, B., van Doorn, L.J., Chaturvedi, A.K., Hildesheim, A., Schiffman, M., Wang, S.S., Zuna, R.E., Walker, J.L., Dunn, S.T., and Wentzensen, N. 2015. Detection of HPV DNA in paraffin‐embedded cervical samples: A comparison of four genotyping methods. BMC Infect. Dis. 15:544. doi: 10.1186/s12879‐015‐1281‐5.
  Chaturvedi, A.K., Katki, H.A., Hildesheim, A., Rodriguez, A.C., Quint, W., Schiffman, M., Van Doorn, L.J., Porras, C., Wacholder, S., Gonzalez, P., Sherman, M.E., Herrero, R., and Group, C.V.T. 2011. Human papillomavirus infection with multiple types: Pattern of coinfection and risk of cervical disease. J. Infect. Dis. 203:910‐920. doi: 10.1093/infdis/jiq139.
  Cole, S.T. and Danos, O. 1987. Nucleotide sequence and comparative analysis of the human papillomavirus type 18 genome. Phylogeny of papillomaviruses and repeated structure of the E6 and E7 gene products. J. Mol. Biol. 193:599‐608. PMID: 3039146.
  de Roda Husman, A.M., Walboomers, J.M., van den Brule, A.J., Meijer, C.J., and Snijders, P.J. 1995. The use of general primers GP5 and GP6 elongated at their 3′ ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J. Gen. Virol. 76 (Pt 4):1057‐1062. doi: 10.1099/0022‐1317‐76‐4‐1057.
  Delius, H. and Hofmann, B. 1994. Primer‐directed sequencing of human papillomavirus types. Curr. Top. Microbiol. Immunol. 186:13‐31.
  Evans, M.F., Adamson, C.S., Simmons‐Arnold, L., and Cooper, K. 2005. Touchdown General Primer (GP5+/GP6+) PCR and optimized sample DNA concentration support the sensitive detection of human papillomavirus. BMC Clin. Pathol. 5:10. doi: 10.1186/1472‐6890‐5‐10.
  Greer, C.E., Peterson, S.L., Kiviat, N.B., and Manos, M.M. 1991. PCR amplification from paraffin‐embedded tissues. Effects of fixative and fixation time. Am. J. Clin. Pathol. 95:117‐124. doi: 10.1093/ajcp/95.2.117.
  Greer, C.E., Wheeler, C.M., and Manos, M.M. 1994. Sample preparation and PCR amplification from paraffin‐embedded tissues. PCR Methods Appl. 3:S113‐122. doi: 10.1101/gr.3.6.S113.
  Guerendiain, D., Moore, C., Wells, L., Conn, B., and Cuschieri, K. 2016. Formalin fixed paraffin embedded (FFPE) material is amenable to HPV detection by the Xpert((R)) HPV assay. J. Clin. Virol. 77:55‐59. doi: 10.1016/j.jcv.2016.02.007.
  Halec, G., Alemany, L., Lloveras, B., Schmitt, M., Alejo, M., Bosch, F.X., Tous, S., Klaustermeier, J.E., Guimera, N., Grabe, N., Lahrmann, B., Gissmann, L., Quint, W., Bosch, F.X., de Sanjose, S., Pawlita, M., Retrospective International, S., Group, H.P.V.T.T.S., Retrospective International, S., and Group, H.P.V.T.T.S. 2014. Pathogenic role of the eight probably/possibly carcinogenic HPV types 26, 53, 66, 67, 68, 70, 73 and 82 in cervical cancer. J. Pathol. 234:441‐451. doi: 10.1002/path.4405.
  Hirsch‐Behnam, A., Delius, H., and de Villiers, E.M. 1990. A comparative sequence analysis of two human papillomavirus (HPV) types 2a and 57. Virus Res. 18:81‐97. doi: 10.1016/0168‐1702(90)90091‐O.
  Huang, S.L., Chao, A., Hsueh, S., Chao, F.Y., Huang, C.C., Yang, J.E., Lin, C.Y., Yan, C.C., Chou, H.H., Huang, K.G., Huang, H.J., Wu, T.I., Tseng, M.J., Qiu, J.T., Lin, C.T., Chang, T.C., and Lai, C.H. 2006. Comparison between the Hybrid Capture II Test and an SPF1/GP6+ PCR‐based assay for detection of human papillomavirus DNA in cervical swab samples. J. Clin. Microbiol. 44:1733‐1739. doi: 10.1128/JCM.44.5.1733‐1739.2006.
  IARC. 2012. IARC Monographs on the Evaluation of Carcinogenic Risks to Humans Volume 100B: A Review of Human Carcinogens: Biological Agents. IARC Monogr. Eval. Carcinog. Risks. Hum. 100:1‐441.
  Kandyala, R., Raghavendra, S.P., and Rajasekharan, S.T. 2010. Xylene: An overview of its health hazards and preventive measures. J. Oral Maxillofac. Pathol 14:1‐5. doi: 10.4103/0973‐029X.64299.
  Kearse, M., Moir, R., Wilson, A., Stones‐Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., and Drummond, A. 2012. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647‐1649. doi: 10.1093/bioinformatics/bts199.
  Kleter, B., van Doorn, L.J., ter Schegget, J., Schrauwen, L., van Krimpen, K., Burger, M., ter Harmsel, B., and Quint, W. 1998. Novel short‐fragment PCR assay for highly sensitive broad‐spectrum detection of anogenital human papillomaviruses. Am. J. Pathol. 153:1731‐1739. doi: 10.1016/S0002‐9440(10)65688‐X.
  Kleter, B., van Doorn, L.J., Schrauwen, L., Molijn, A., Sastrowijoto, S., ter Schegget, J., Lindeman, J., ter Harmsel, B., Burger, M., and Quint, W. 1999. Development and clinical evaluation of a highly sensitive PCR‐reverse hybridization line probe assay for detection and identification of anogenital human papillomavirus. J. Clin. Microbiol. 37:2508‐2517.
  Kocjan, B.J., Seme, K., and Poljak, M. 2011. Comparison of the Abbott RealTime High Risk HPV test and INNO‐LiPA HPV Genotyping Extra test for the detection of human papillomaviruses in formalin‐fixed, paraffin‐embedded cervical cancer specimens. J. Virol. Methods 175:117‐119. doi: 10.1016/j.jviromet.2011.04.006.
  Kocjan, B.J., Maver, P.J., Hosnjak, L., Zidar, N., Odar, K., Gale, N., and Poljak, M. 2012. Comparative evaluation of the Abbott RealTime High Risk HPV test and INNO‐LiPA HPV Genotyping Extra test for detecting and identifying human papillomaviruses in archival tissue specimens of head and neck cancers. Acta Dermatovenerol Alp Pannonica Adriat 21:73‐75.
  Kocjan, B.J., Hosnjak, L., and Poljak, M. 2015. Commercially available kits for manual and automatic extraction of nucleic acids from formalin‐fixed, paraffin‐embedded (FFPE) tissues. Acta Dermatovenerol Alp Pannonica Adriat 24:47‐53.
  Kocjan, B.J., Hosnjak, L., and Poljak, M. 2016. Detection of alpha human papillomaviruses in archival formalin‐fixed, paraffin‐embedded (FFPE) tissue specimens. J. Clin. Virol. 76 (Suppl 1):S88‐97. doi: 10.1016/j.jcv.2015.10.007.
  Lillsunde Larsson, G., Carlsson, J., Karlsson, M.G., and Helenius, G. 2015. Evaluation of HPV Genotyping Assays for Archival Clinical Samples. J. Mol. Diagn. 17:293‐301. doi: 10.1016/j.jmoldx.2014.12.004.
  Matsukura, T. and Sugase, M. 2001. Relationships between 80 human papillomavirus genotypes and different grades of cervical intraepithelial neoplasia: Association and causality. Virology 283:139‐147. doi: 10.1006/viro.2001.0865.
  Melchers, W.J., Bakkers, J.M., Wang, J., de Wilde, P.C., Boonstra, H., Quint, W.G., and Hanselaar, A.G. 1999. Short fragment polymerase chain reaction reverse hybridization line probe assay to detect and genotype a broad spectrum of human papillomavirus types. Clinical evaluation and follow‐up. Am. J. Pathol. 155:1473‐1478. doi: 10.1016/S0002‐9440(10)65462‐4.
  Nazarenko, I., Kobayashi, L., Giles, J., Fishman, C., Chen, G., and Lorincz, A. 2008. A novel method of HPV genotyping using hybrid vapture sample preparation method combined with GP5+/6+ PCR and multiplex detection on Luminex XMAP. J. Virol. Methods. 154:76‐81. doi: 10.1016/j.jviromet.2008.09.002. PMID:18835300.
  Quint, W.G., Scholte, G., van Doorn, L.J., Kleter, B., Smits, P.H., and Lindeman, J. 2001. Comparative analysis of human papillomavirus infections in cervical scrapes and biopsy specimens by general SPF(10) PCR and HPV genotyping. J. Pathol. 194:51‐58. doi: 10.1002/path.855.
  Schiffman, M., Clifford, G., and Buonaguro, F.M. 2009. Classification of weakly carcinogenic human papillomavirus types: Addressing the limits of epidemiology at the borderline. Infect. Agents Cancer 4:8. doi: 10.1186/1750‐9378‐4‐8.
  Schiffman, M., Wentzensen, N., Wacholder, S., Kinney, W., Gage, J.C., and Castle, P.E. 2011. Human papillomavirus testing in the prevention of cervical cancer. J. Natl. Cancer Inst. 103:368‐383. doi: 10.1093/jnci/djq562.
  Schwarz, E., Durst, M., Demankowski, C., Lattermann, O., Zech, R., Wolfsperger, E., Suhai, S., and zur Hausen, H. 1983. DNA sequence and genome organization of genital human papillomavirus type 6b. EMBO J. 2:2341‐2348.
  Seedorf, K., Krammer, G., Durst, M., Suhai, S., and Rowekamp, W.G. 1985. Human papillomavirus type 16 DNA sequence. Virology 145:181‐185. doi: 10.1016/0042‐6822(85)90214‐4.
  Srinivasan, M., Sedmak, D., and Jewell, S. 2002. Effect of fixatives and tissue processing on the content and integrity of nucleic acids. Am. J. Pathol. 161:1961‐1971. doi: 10.1016/S0002‐9440(10)64472‐0.
  Steinau, M., Patel, S.S., and Unger, E.R. 2011. Efficient DNA extraction for HPV genotyping in formalin‐fixed, paraffin‐embedded tissues. J. Mol. Diagn. 13:377‐381. doi: 10.1016/j.jmoldx.2011.03.007.
  Tieben, L.M., ter Schegget, J., Minnaar, R.P., Bouwes Bavinck, J.N., Berkhout, R.J., Vermeer, B.J., Jebbink, M.F., and Smits, H.L. 1993. Detection of cutaneous and genital HPV types in clinical samples by PCR using consensus primers. J. Virol. Methods 42:265‐279. doi: 10.1016/0166‐0934(93)90038‐S.
  Touchman, J.W. 2009. DNA Sequencing: An Outsourcing Guide. Current Protocols Essential Laboratory Techniques 2:1‐19.doi: 10.1002/9780470089941.
  Van Doorslaer, K., Tan, Q., Xirasagar, S., Bandaru, S., Gopalan, V., Mohamoud, Y., Huyen, Y., and McBride, A.A. 2013. The Papillomavirus Episteme: A central resource for papillomavirus sequence data and analysis. Nucleic. Acids Res. 41:D571‐578. doi: 10.1093/nar/gks984.
  Van Doorslaer, K. and Burk, R.D. 2010. Evolution of human papillomavirus carcinogenicity. Adv. Virus. Res. 77:41‐62. doi: 10.1016/B978‐0‐12‐385034‐8.00002‐8.
  Xiao, Y., Sheng, Z.M., and Taubenberger, J.K. 2015. Isolating Viral and Host RNA Sequences from Archival Material and Production of cDNA Libraries for High‐Throughput DNA Sequencing. Curr. Protoc. Microbiol. 37:1E 8 1‐16. doi: 10.1002/9780471729259.
  Hildesheim, A., Schiffman, M.H., Gravitt, P.E., Glass, A.G., Greer, C.E., Zhang, T., Scott, D.R., Rush, B.B., Lawler, P., Sherman, M.E., Kurman, Robert J. and Michele Manos, M. 1994. Persistence of type‐specific human papillomavirus infection among cytologically normal women. J. Infect. Dis. 169:235‐240. doi: 10.1093/infdis/169.2.235.
Internet Resources
  https://pave.niaid.nih.gov/#search/pv_specific_blast
  The PapillomaVirus Episteme (PaVE) provides highly organized and curated papillomavirus genomics information, and tools, to the scientific community. The PaVE consists of a database and Web applications. The PaVE Blast page can be used to genotype the DNA amplified throughout the protocol
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library