Human Cytomegalovirus: Bacterial Artificial Chromosome (BAC) Cloning and Genetic Manipulation

Anne M. Paredes1, Dong Yu1

1 Department of Molecular Microbiology, Washington University School of Medicine, St. Louis, Missouri
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14E.4
DOI:  10.1002/9780471729259.mc14e04s24
Online Posting Date:  February, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The understanding of human cytomegalovirus (HCMV) biology was long hindered by the inability to perform efficient viral genetic analysis. This hurdle was recently overcome when the genomes of multiple HCMV strains were cloned as infectious bacterial artificial chromosomes (BACs). The BAC system takes advantage of the single-copy F plasmid of E. coli that can stably carry large pieces of foreign DNA. In this system, a recombinant HCMV virus carrying a modified F plasmid is first generated in eukaryotic cells. Recombinant viral genomes are then isolated and recovered in E. coli as BAC clones. BAC-captured viral genomes can be manipulated using prokaryotic genetics, and recombinant virus can be reconstituted from BAC transfection in eukaryotic cells. The BAC reverse genetic system provides a reliable and efficient method to introduce genetic alterations into the viral genome in E.coli and subsequently analyze their effects on virus biology in eukaryotic cells. Curr. Protoc. Microbiol. 24:14E.1.1-14E.1.33. © 2012 by John Wiley & Sons, Inc.

Keywords: human cytomegalovirus; HCMV; betaherpesvirus; herpesvirus; bacterial artificial chromosome; BAC; mutagenesis; virus reconstitution

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Isolation of an HCMV Genome as a BAC Clone
  • Basic Protocol 2: Reconstitution of Infectious Virus from BAC Clones
  • Basic Protocol 3: Seamless Genetic Manipulation of the BAC-Cloned Viral Genome by Linear Fragment-Based Homologous Recombination (Linear Recombination)
  • Support Protocol: Generation of Electrocompetent, Recombination-Ready E. coli for Linear Recombination
  • Basic Protocol 4: Rapid Tagging of a Viral ORF in an HCMV BAC Clone by FLP-Mediated Site-Specific Recombination
  • Basic Protocol 5: Develop a Protein Genetics–Based Inducible System to Manipulate Viral Protein Stability and Activity by Tagging Its ORF with a ddFKBP Tag
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolation of an HCMV Genome as a BAC Clone

 Materials
  • Primary human fibroblasts
  • Plasmid expressing HCMV protein pp71 (e.g., pYD-C21; Baldick et al., 1997; Yu et al., 2002)
  • Supplemented DMEM (see recipe)
  • 20% (w/v) d-sorbitol solution in 50 mM Tris×Cl (pH 7.2), 1 mM MgCl2, sterile
  • TE buffer (10 mM Tris×Cl, 0.1 mM EDTA, pH 8.0), sterile
  • 2× lysis buffer (see recipe)
  • Tris-equilibrated phenol
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 70% and 100% ethanol, ice cold
  • BAC vector, such as pYD-C223 derived from pYD-C29 (Yu et al., 2002)
  • Commercial electrocompetent E. coli DH10B cells (e.g., Invitrogen MegaX)
  • LB agar plates (appendix 4A)
  • Commercial kit for purifying BAC DNA or low-copy number plasmid DNA (e.g., Clontech Nucleobond Xtra Midi DNA purification kit)
  • PmeI
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
  • 3 M potassium acetate, pH 5.5 (appendix 2A)
  • Agarose gel
  • Dulbecco's modified Eagle's medium with 4.5 g/liter of glucose (DMEM; e.g., D5796 from Sigma)
  • Dulbecco's modified phosphate-buffered saline (DPBS, e.g., Hyclone, cat. no. SH30028.03)
  • Trypsin solution (0.05% trypsin, 0.005% penicillin, 0.01% streptomycin in DPBS), sterile
  • DMEM/agarose overlay solution, sterile (see recipe)
  • 1000× (2 mg/ml) puromycin in water, filter sterilized
  • Hirt solution I (10 mM Tris×Cl, 10 mM EDTA, pH 8.0), sterile
  • Proteinase K
  • 10% sodium dodecyl sulfate (SDS; appendix 2A), sterile
  • 5 M NaCl, sterile (appendix 2A)
  • 10 mM Tris×Cl buffer, pH 8.0 (appendix 2A), sterile
  • SOC medium (see recipe)
  • LB medium (appendix 4A)
  • 1000× (15 mg/ml) chloramphenicol in ethanol, filter sterilized
  • Bacteria freezing solution (65% glycerol, 0.1 M MgSO4, 25 mM Tris×Cl, pH 8.0), sterile
  • Miniprep solution I (50 mM Tris×Cl, 10 mM EDTA, pH 8.0; appendix 2A)
  • Miniprep solution II (200 mM NaOH, 1% SDS; appendix 2A)
  • Miniprep solution III (3.0 M potassium acetate buffer, pH 5.5; appendix 2A)
  • Isopropanol
  • 1 mg/ml RNase A (appendix 2A)
  • 10- and 15-cm tissue culture plates
  • 37°C, 5% CO2 humidified incubator
  • 15- and 50-ml conical polypropylene centrifuge tubes
  • Refrigerated multipurpose centrifuge (e.g., Eppendorf model 5810R)
  • 1 × 3 1/2–in. ultra-clear centrifuge tubes (Beckman)
  • 5-ml serological pipets, sterile
  • Ultracentrifuge with SW28 swinging bucket rotor or equivalent (Beckman)
  • Wide-orifice pipet tips, sterile
  • 1.5-ml microcentrifuge tubes
  • Microcentrifuge
  • Spectrophotometer
  • 1-, 2-, and 4-mm gap electroporation cuvettes
  • Electroporator (e.g., Bio-Rad Gene Pulsar Xcell)
  • 6-well tissue culture dishes
  • Light microscope
  • Inverted fluorescence tissue culture microscope
  • Cell scraper, sterile
  • Tube rotator
  • Additional reagents and equipment for PCR (appendix 3D)

Basic Protocol 2: Reconstitution of Infectious Virus from BAC Clones

 Materials
  • Bacterial culture of viral BAC clone (see Basic Protocol 1)
  • Nucleobond Xtra Midi DNA purification kit (Clontech)
  • 10 mM Tris×Cl, pH 8.0 (appendix 2A)
  • 3 M potassium acetate, pH 5.5 (appendix 2A)
  • 70% and 100% ethanol, ice cold and room temperature
  • EcoRI
  • 0.6% agarose gel
  • 15-cm plates of nearly confluent primary human fibroblasts
  • Supplemented DMEM, prewarmed
  • HCMV BAC DNA
  • pp71-expressing plasmid (e.g., pYD-C21)
  • Plasmid expressing Cre recombinase (e.g., GS403; Smith and Enquist, 1999)
  • Trypsin
  • Centrifuge
  • 1.5-ml microcentrifuge tubes
  • Wide-orifice pipet tips
  • Refrigerated microcentrifuge
  • Spectrophotometer
  • 10-cm tissue culture plates
  • 4-mm electroporation cuvette
  • Electroporator (e.g., BioRad Gene Pulsar)
  • 37°C cell culture incubator
  • Light microscope
  • 15- and 50-ml conical polypropylene centrifuge tubes

Basic Protocol 3: Seamless Genetic Manipulation of the BAC-Cloned Viral Genome by Linear Fragment-Based Homologous Recombination (Linear Recombination)

 Materials
  • Plasmid pYD-C255 carrying Kan/galK dual selection cassette (Qian et al., 2008)
  • 5′ Primer: 50-bp viral homologous sequence + CCTGTTGACAATTAATCATCG
  • 3′ Primer: 50-bp viral homologous sequence + CTCAGCAAAAGTTCGATTTA
  • Advantage HD polymerase (Clontech)
  • DpnI restriction enzyme
  • Agarose gel
  • Commercial kit for PCR purification or gel extraction (e.g., Invitrogen PureLink PCR purification kit or Quick Gel extraction kit)
  • Electroporation-competent SW102 E. coli cells (Warming et al., 2005) containing HCMV BAC clone (see Support Protocol)
  • SOC medium (see recipe)
  • LB plates containing 15 µg/ml chloramphenicol and 25 µg/ml kanamycin
  • LB plates with 40 µg/ml ampicillin
  • MacConkey indicator plates (see recipe)
  • DNA fragment with altered gene
  • 1× M9 solution (see recipe)
  • DOG-negative selection plates (see recipe)
  • 37°C water bath shaker
  • Electroporator
  • 1.5-ml microcentrifuge tubes
  • Refrigerated microcentrifuge
  • 10-ml culture tubes
  • Additional reagents and equipment for PCR (appendix 3D) and BAC DNA minipreparations (see Basic Protocol 1)

Support Protocol: Generation of Electrocompetent, Recombination-Ready E. coli for Linear Recombination

 Materials
  • SW102 E. coli cells (Warming et al., 2005) that contain the HCMV BAC clone grown on LB plates
  • LB medium (appendix 4A)
  • Sterile water, ice cold
  • 10% (v/v) glycerol solution in water, sterile, ice cold
  • 15-ml culture tubes
  • 1-liter culture flasks
  • 42°C water bath shaker
  • 500-ml flasks, sterile
  • Spectrophotometer
  • Refrigerated supercentrifuge and rotor
  • 50-ml conical tubes
  • Refrigerated benchtop centrifuge

Basic Protocol 4: Rapid Tagging of a Viral ORF in an HCMV BAC Clone by FLP-Mediated Site-Specific Recombination

 Materials
  • Plasmid pYD-C744 that carries the 3xFLAG-FRT-Kan/galK-FRT cassette (Perng and Yu, unpub. observ.)
  • 5′ Primer: 50-bp viral homology + (ATG)GACTACAAAGACCATGACGG
  • 3′ Primer: 50-bp viral homology + (CTA)CGGGAAGTTCCTATTCTCTA
  • Advantage HD polymerase (Clontech)
  • SW105 E. coli cells that encode the arabinose-inducible FLP recombinase (Warming et al., 2005) and carry the HCMV BAC clone
  • LB medium (appendix 4A)
  • 10% (w/v) l (+)-arabinose solution in water, sterile
  • LB plates with 15 µg/ml chloramphenicol
  • LB plates with 25 µg/ml kanamycin
  • Thermal cycler
  • Shaking incubator
  • Spectrophotometer
  • Additional reagents and equipment for PCR (appendix 3D), linear recombination (see Basic Protocol 3), and miniprep of BAC DNA (see Basic Protocol 1)

Basic Protocol 5: Develop a Protein Genetics–Based Inducible System to Manipulate Viral Protein Stability and Activity by Tagging Its ORF with a ddFKBP Tag

 Materials
  • Plasmid pYD-C630 that carries the cassette composed of the coding sequence of ddFKBP (110aa FKBP12 F36V L106P variant) (Banaszynski et al., 2006) followed by FRT-Kan/galK-FRT (Perng et al., 2011)
  • 5′ Primer: 50-bp viral homology sequence + ATGGGAGTGCAGGTGGAAACCATC
  • 3′ Primer: 50-bp viral homology sequence + GCTGGAGCTCCACCGCGGGAAGTTC
  • Advantage HD polymerase (Clontech)
  • SW105 E. coli cells that encode the arabinose-inducible FLP recombinase (Warming et al., 2005) and contain the HCMV BAC clone (see Support Protocol)
  • 1000× (1 mM) Shield-1 (Shld1; Cheminpharma) solution in ethanol, stored at –20°C
  • Anti-FKBP12 mouse monoclonal antibody (BD Bioscience, cat. no. 610808)
  • 1 × 3 1/2–in. ultra-clear centrifuge tubes
  • 5-ml pipets
  • Centrifuge with a SW28 swinging bucket rotor (or equivalent)
  • Additional reagents and equipment for PCR (appendix 3D), linear recombination (see Basic Protocol 3), miniprep BAC DNA (see Basic Protocol 1), arabinose induction and FLP/FRT recombination (see Basic Protocol 4)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •  FigureFigure 14E.4.1 pYD-C223 BAC vector. pac, puromycin N-acetyltransferase conferring puromycin resistance; IRES, internal ribosome entry site; cam, chloramphenicol acetyltransferase conferring chloramphenicol resistance.
  •  FigureFigure 14E.4.2 BAC-based reverse genetic system for HCMV. P, PmeI; N, NotI; S, SacI; L, loxP; SeqL and SeqR, left and right viral homology arms, respectively.
  •  FigureFigure 14E.4.3 Primer pairs used for PCR analysis to confirm that the isolated viral BAC clone carries the BAC vector sequence at the correct locus as well as distal regions of the HCMV genome.
  •  FigureFigure 14E.4.4 Two-step lambda-mediated linear recombination in E. coli to engineer seamless genetic alteration in the viral BAC clone.
  •  FigureFigure 14E.4.5 Linear recombination followed by FLP/FRT recombination to tag a viral ORF in the HCMV BAC clone.
  •  FigureFigure 14E.4.6 ddFKBP tagging-based protein genetic approach to study the function of HCMV proteins during infection.

Videos

Literature Cited

Literature Cited
    Adler, H., Messerle, M., Wagner, M., and Koszinowski, U.H. 2000. Cloning and mutagenesis of the murine gammaherpesvirus 68 genome as an infectious bacterial artificial chromosome. J. Virol. 74:6964-6974.
    Baldick, C.J. Jr., Marchini, A., Patterson, C.E., and Shenk, T. 1997. Human cytomegalovirus tegument protein pp71 (ppUL82) enhances the infectivity of viral DNA and accelerates the infectious cycle. J. Virol. 71:4400-4408.
    Banaszynski, L.A., Chen, L.C., Maynard-Smith, L.A., Ooi, A.G, and Wandless, T.J. 2006. A rapid, reversible, and tunable method to regulate protein function in living cells using synthetic small molecules. Cell 126:995-1004.
    Borenstein, R. and Frenkel, N. 2009. Cloning human herpes virus 6A genome into bacterial artificial chromosomes and study of DNA replication intermediates. Proc. Natl. Acad. Sci. U.S.A. 106:19138-19143.
    Borst, E.M., Hahn, G., Koszinowski, U.H., and Messerle, M. 1999. Cloning of the human cytomegalovirus (HCMV) genome as an infectious bacterial artificial chromosome in Escherichia coli: A new approach for construction of HCMV mutants. J. Virol. 73:8320-8329.
    Cha, T.A., Tom, E., Kemble, G.W., Duke, G.M., Mocarski, E.S., and Spaete, R.R. 1996. Human cytomegalovirus clinical isolates carry at least 19 genes not found in laboratory strains. J. Virol. 70:78-83.
    Cui, X., McGregor, A., Schleiss, M.R., and McVoy, M.A. 2008. Cloning the complete guinea pig cytomegalovirus genome as an infectious bacterial artificial chromosome with excisable origin of replication. J. Virol. Methods 149:231-239.
    Delecluse, H.J., Hilsendegen, T., Pich, D., Zeidler, R., and Hammerschmidt, W. 1998. Propagation and recovery of intact, infectious Epstein-Barr virus from prokaryotic to human cells. Proc. Natl. Acad. Sci. U.S.A. 95:8245-8250.
    Dolan, A., Cunningham, C., Hector, R.D., Hassan-Walker, A.F., Lee, L., Addison, C., Dargan, D.J., McGeoch, D.J., Gatherer, D., Emery, V.C., Griffiths, P.D., Sinzger, C., McSharry, B.P., Wilkinson, G.W., and Davison, A.J. 2004. Genetic content of wild-type human cytomegalovirus. J. Gen. Virol. 85:1301-1312.
    Fehr, A.R. and Yu, D. 2010. Human cytomegalovirus gene UL21a encodes a short-lived cytoplasmic protein and facilitates virus replication in fibroblasts. J. Virol. 84:291-302.
    Fehr, A.R. and Yu, D. 2011. Human cytomegalovirus early protein pUL21a promotes efficient viral DNA synthesis and the late accumulation of immediate-early transcripts. J. Virol. 85:663-674.
    Glass, M., Busche, A., Wagner, K., Messerle, M., and Borst, E.M. 2009. Conditional and reversible disruption of essential herpesvirus proteins. Nat. Methods 6:577-579.
    Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-369.
    Horsburgh, B.C., Hubinette, M.M., Qiang, D., MacDonald, M.L., and Tufaro, F. 1999. Allele replacement: An application that permits rapid manipulation of herpes simplex virus type 1 genomes. Gene Ther. 6:922-930.
    Iwamoto, M., Bjorklund, T., Lundberg, C., Kirik, D., and Wandless, T.J. 2010. A general chemical method to regulate protein stability in the mammalian central nervous system. Chem. Biol. 17:981-988.
    Lee, E.C., Yu, D., Martinez de Velasco, J., Tessarollo, L., Swing, D.A., Court, D.L., Jenkins, N.A., and Copeland, N.G. 2001. A highly efficient Escherichia coli-based chromosome engineering system adapted for recombinogenic targeting and subcloning of BAC DNA. Genomics 73:56-65.
    Luckow, V.A., Lee, S.C., Barry, G.F., and Olins, P.O. 1993. Efficient generation of infectious recombinant baculoviruses by site-specific transposon-mediated insertion of foreign genes into a baculovirus genome propagated in Escherichia coli. J. Virol. 67:4566-4579.
    MacCormac, L.P., and Grundy, J.E. 1999. Two clinical isolates and the Toledo strain of cytomegalovirus contain endothelial cell tropic variants that are not present in the AD169, Towne, or Davis strains. J. Med. Virol. 57:298-307.
    Marchini, A., Liu, H., and Zhu, H. 2001. Human cytomegalovirus with IE-2 (UL122) deleted fails to express early lytic genes. J. Virol. 75:1870-1878.
    McGregor, A. and Schleiss, M.R. 2001. Molecular cloning of the guinea pig cytomegalovirus (GPCMV) genome as an infectious bacterial artificial chromosome (BAC) in Escherichia coli. Mol. Genet. Metab. 72:15-26.
    Messerle, M., Crnkovic, I., Hammerschmidt, W., Ziegler, H., and Koszinowski, U.H. 1997. Cloning and mutagenesis of a herpesvirus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. U.S.A. 94:14759-14763.
    Murphy, E., Yu, D., Grimwood, J., Schmutz, J., Dickson, M., Jarvis, M.A., Hahn, G., Nelson, J.A., Myers, R.M., and Shenk, T.E. 2003. Coding potential of laboratory and clinical strains of human cytomegalovirus. Proc. Natl. Acad. Sci. U.S.A. 100:14976-14981.
    Patterson, C.E. and Shenk, T. 1999. Human cytomegalovirus UL36 protein is dispensable for viral replication in cultured cells. J. Virol. 73:7126-7131.
    Perng, Y.C., Qian, Z., Fehr, A.R., Xuan, B., and Yu, D. 2011. The human cytomegalovirus gene UL79 is required for the accumulation of late viral transcripts. J. Virol. 85:4841-4852.
    Qian, Z., Xuan, B., Hong, T.T., and Yu, D. 2008. The full-length protein encoded by human cytomegalovirus gene UL117 is required for the proper maturation of viral replication compartments. J. Virol. 82:3452-3465.
    Qian, Z., Leung-Pineda, V., Xuan, B., Piwnica-Worms, H., and Yu, D. 2010. Human cytomegalovirus protein pUL117 targets the mini-chromosome maintenance complex and suppresses cellular DNA synthesis. PLoS Pathog. 6:e100814.
    Saeki, Y., Ichikawa, T., Saeki, A., Chiocca, E.A., Tobler, K., Ackermann, M., Breakefield, X.O., and Fraefel, C. 1998. Herpes simplex virus type 1 DNA amplified as bacterial artificial chromosome in Escherichia coli: Rescue of replication-competent virus progeny and packaging of amplicon vectors. Hum. Gene Ther. 9:2787-2794.
    Shizuya, H., Birren, B., Kim, U.J., Mancino, V., Slepak, T., Tachiiri, Y., and Simon, M. 1992. Cloning and stable maintenance of 300-kilobase-pair fragments of human DNA in Escherichia coli using an F-factor-based vector. Proc. Natl. Acad. Sci. U.S.A. 89:8794-8797.
    Skaletskaya, A., Bartle, L.M., Chittenden, T., McCormick, A.L., Mocarski, E.S., and Goldmacher, V.S. 2001. A cytomegalovirus-encoded inhibitor of apoptosis that suppresses caspase-8 activation. Proc. Natl. Acad. Sci. U.S.A. 98:7829-7834.
    Smith, G.A. and Enquist, L.W. 1999. Construction and transposon mutagenesis in Escherichia coli of a full-length infectious clone of pseudorabies virus, an alphaherpesvirus. J. Virol. 73:6405-6414.
    Smith, G.A. and Enquist, L.W. 2000. A self-recombining bacterial artificial chromosome and its application for analysis of herpesvirus pathogenesis. Proc. Natl. Acad. Sci. U.S.A. 97:4873-4878.
    Stanton, R.J., Baluchova, K., Dargan, D.J., Cunningham, C., Sheehy, O., Seirafian, S., McSharry, B.P., Neale, M.L., Davies, J.A., Tomasec, P., Davison, A.J., and Wilkinson, G.W. 2010. Reconstruction of the complete human cytomegalovirus genome in a BAC reveals RL13 to be a potent inhibitor of replication. J. Clin. Invest. 120:3191-3208.
    Tandon, R. and Mocarski, E.S. 2011. Cytomegalovirus pUL96 is critical for the stability of pp150-associated nucleocapsids. J. Virol. 85:7129-7141.
    Tang, H., Kawabata, A., Yoshida, M., Oyaizu, H., Maeki, T., Yamanishi, K., and Mori, Y. 2010. Human herpesvirus 6 encoded glycoprotein Q1 gene is essential for virus growth. Virology 407:360-367.
    Tischer, B.K. von Einem, J., Kaufer, B., and Osterrieder, N. 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40:191-197.
    Waldman, W.J., Sneddon, J.M., Stephens, R.E., and Roberts, W.H. 1989. Enhanced endothelial cytopathogenicity induced by a cytomegalovirus strain propagated in endothelial cells. J. Med. Virol. 28:223-230.
    Warming, S., Costantino, N., Court, D.L., Jenkins, N.A., and Copeland, N.G. 2005. Simple and highly efficient BAC recombineering using galK selection. Nucleic Acids Res. 33:e36.
    Xuan, B., Qian, Z., Torigoi, E., and Yu, D. 2009. Human cytomegalovirus protein pUL38 induces ATF4 expression, inhibits persistent JNK phosphorylation, and suppresses endoplasmic reticulum stress-induced cell death. J. Virol. 83:3463-3474.
    Yu, D., Ellis, H.M., Lee, E.C., Jenkins, N.A., Copeland, N.G., and Court, D.L. 2000. An efficient recombination system for chromosome engineering in Escherichia coli. Proc. Natl. Acad. Sci. U.S.A. 97:5978-5983.
    Yu, D., Smith, G.A., Enquist, L.W., and Shenk, T. 2002. Construction of a self-excisable bacterial artificial chromosome containing the human cytomegalovirus genome and mutagenesis of the diploid TRL/IRL13 gene. J. Virol. 76:2316-2328.
    Yu, D., Silva, M.C., and Shenk, T. 2003. Functional map of human cytomegalovirus AD169 defined by global mutational analysis. Proc. Natl. Acad. Sci. U.S.A. 100:12396-12401.
    Zhou, F.C., Zhang, Y.J., Deng, J.H., Wang, X.P., Pan, H.Y., Hettler, E., and Gao, S.J. 2002. Efficient infection by a recombinant Kaposi's sarcoma-associated herpesvirus cloned in a bacterial artificial chromosome: Application for genetic analysis. J. Virol. 76:6185-6196.
    Zhou, F., Li, Q., and Gao, S.J. 2009. A sequence-independent in vitro transposon-based strategy for efficient cloning of genomes of large DNA viruses as bacterial artificial chromosomes. Nucleic Acids Res. 37:e2.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library