Quantitative Analysis of HSV Gene Expression during Lytic Infection

Anne‐Marie W. Turner1, Jesse H. Arbuckle1, Thomas M. Kristie1

1 Laboratory of Viral Diseases, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, Maryland
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14E.5
DOI:  10.1002/9780471729259.mc14e05s35
Online Posting Date:  November, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Herpes Simplex Virus (HSV) is a human pathogen that establishes latency and undergoes periodic reactivation, resulting in chronic recurrent lytic infection. HSV lytic infection is characterized by an organized cascade of three gene classes; however, successful transcription and expression of the first, the immediate early class, is critical to the overall success of viral infection. This initial event of lytic infection is also highly dependent on host cell factors. This unit uses RNA interference and small molecule inhibitors to examine the role of host and viral proteins in HSV lytic infection. Methods detailing isolation of viral and host RNA and genomic DNA followed by quantitative real‐time PCR allow characterization of impacts on viral transcription and replication, respectively. Western blots can be used to confirm quantitative PCR results. This combination of protocols represents a starting point for researchers interested in virus‐host interactions during HSV lytic infection. © 2014 by John Wiley & Sons, Inc.

Keywords: Herpes Simplex Virus; lytic infection; RNAi; small molecule inhibitors; qPCR; western blot

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Transfection of siRNAS
  • Basic Protocol 2: Small Molecule Inhibitors
  • Support Protocol 1: Cell Passage and Plating of MRC‐5
  • Basic Protocol 3: HSV Absorption and Infection
  • Basic Protocol 4: RNA Isolation Using Commercial RNA Isolation Kits
  • Alternate Protocol 1: RNA Isolation by TRIzol Extraction
  • Support Protocol 2: DNase Treatment of TRIzol‐Isolated RNA
  • Basic Protocol 5: Generation of cDNA for Quantitative Real‐Time PCR
  • Basic Protocol 6: Isolation of Viral DNA Using Phenol/Chloroform Extraction
  • Alternate Protocol 2: Isolation of Viral DNA Using Commercial DNA Isolation Kits
  • Basic Protocol 7: Analysis of Viral RNA/DNA by Quantitative Real‐Time PCR
  • Basic Protocol 8: Analysis of Viral Protein Expression by Western Blot
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Transfection of siRNAS

  Materials
  • Cells (MRC‐5, ATCC# CCL‐171)
  • DMEM/10% FBS (see recipe)
  • Gene‐targeting siRNA (Dharmacon ON‐TARGETplus Smartpools)
  • Non‐targeting siRNA control (Dharmacon ON‐TARGETplus Non‐targeting Pool, cat. no. D‐001810‐10‐05)
  • Opti‐MEM (Life Technologies, cat. no. 31985‐062)
  • HiPerFect Transfection Reagent (Qiagen, cat. no. 301704)
  • 6‐well plates
  • 37°C incubator

Basic Protocol 2: Small Molecule Inhibitors

  Materials
  • Cells of interest (MRC‐5, ATCC# CCL‐171)
  • DMEM/10% FBS (see recipe)
  • 0.5 M stock of TCP in DMSO (Sigma‐Aldrich, cat. no. P8511)
  • Vehicle control (solvent used for suspending inhibitor, e.g., DMSO)
  • 6‐well plates

Support Protocol 1: Cell Passage and Plating of MRC‐5

  Materials
  • MRC‐5 cells (ATCC# CCL‐171)
  • DMEM/10% FBS (see recipe)
  • Dulbecco's phosphate buffered saline without Mg2+ or Ca2+ (DPBS)
  • 0.25% trypsin‐EDTA with or without phenol red (Life Technologies, cat. no. 25200‐056)
  • 10% DMSO
  • Trypan blue (optional)
  • 37°C water bath
  • Sterile 15‐ml conical tubes
  • Centrifuge
  • Aspirator
  • 25‐, 75‐, and 175‐cm2vented flasks
  • Pipets
  • Cell counter or hemacytometer

Basic Protocol 3: HSV Absorption and Infection

  Materials
  • Cells of interest
  • 0.25% trypsin‐EDTA with or without phenol red (Life Technologies, cat. no. 25200‐056)
  • DMEM/10% FBS (see recipe)
  • HSV‐1 virus stock (see unit for more information)
  • Infection medium (see recipe)
  • Small molecule inhibitor and vehicle control (optional)
  • Dulbecco's phosphate buffered saline without Mg2+ or Ca2+ (DPBS)
  • Hemacytometer or automated cell counter
  • 37°C, 5% CO 2 incubator equipped with a rocking platform

Basic Protocol 4: RNA Isolation Using Commercial RNA Isolation Kits

  Materials
  • HSV‐1 infected cells/tissue of interest and controls
  • Dulbecco's phosphate buffered saline without Mg2+ or Ca2+ (DPBS)
  • Total RNA isolation kit, for example:
    • Isolate II RNA mini kit (Bioline, cat. no. BIO‐52072)
    • RNeasy Mini Kit (Qiagen, cat. no. 74104)
  • Reducing agent (typically beta‐mercaptoethanol)
  • 70% ethanol
  • Nuclease‐free water
  • 0.1‐ml micro‐sized glass Dounce tissue homogenizer (Wheaton, cat. no. 357844)
  • Nuclease‐free 1.5‐ml tubes

Alternate Protocol 1: RNA Isolation by TRIzol Extraction

  Materials
  • HSV‐1‐infected cells or tissue of interest
  • Dulbecco's phosphate buffered saline without Mg2+ or Ca2+ (DPBS)
  • TRIzol (Life Technologies, cat. no. 15596‐026)
  • Chloroform (Sigma Aldrich, cat. no. 496189)
  • 100% isopropanol
  • 70% ethanol
  • Nuclease‐free water
  • Phase Lock Gel Heavy 2‐ml tubes (5 PRIME, cat. no. 2302830)
  • Refrigerated centrifuge
  • BioMasher II Closed System disposable homogenizer (Kimble Chase, cat. no. 749625‐0030)
  • 1.5‐ml nuclease‐free tubes
NOTE: The use of this protocol with Phase Lock tubes does not allow for recovery of DNA or protein and should be used exclusively for RNA extraction.CAUTION: This protocol involves work with TRIzol, which contains phenol and guanidine isothiocynate, and chloroform. Wear appropriate personal protective equipment when working with these chemicals. Fumes from TRIzol and chloroform are hazardous. All steps involving TRIzol and chloroform should be performed in a chemical fume hood. Dispose of TRIzol/chloroform waste as per your institution's protocols.

Support Protocol 2: DNase Treatment of TRIzol‐Isolated RNA

  Materials
  • TURBO DNA‐free Kit (Life Technologies, cat. no. AM1907)
  • TRIzol‐isolated experimental RNA (see protocol 6)
  • 37°C water bath
  • 1.5‐ml nuclease‐free tubes
  • Microcentrifuge

Basic Protocol 5: Generation of cDNA for Quantitative Real‐Time PCR

  Materials
  • DNase‐treated experimental RNA (see protocol 7)
  • Maxima First Strand cDNA Synthesis Kit for RT‐qPCR (Thermo Scientific, cat. no. K1642)
  • Nuclease‐free water
  • Spectrophotometer
  • 0.2‐ml thin‐walled PCR tubes with lids
  • Thermal cycler

Basic Protocol 6: Isolation of Viral DNA Using Phenol/Chloroform Extraction

  Materials
  • HSV‐1 infected cells or tissue of interest
  • Dulbecco's phosphate buffered saline without Mg2+ or Ca2+ (DPBS)
  • 2× DNA extraction buffer (see recipe)
  • 20 mg/ml RNase A (Life Technologies, cat. no. 12091‐021)
  • 20 mg/ml proteinase K solution (Roche Applied Science, cat. no. 03115887001)
  • 25:24:1 (v/v) phenol/chloroform/isoamyl alcohol (Roche Applied Science, cat. no. 03117979001)
  • 3 M sodium acetate, pH 5.2
  • Isopropanol
  • 70% ethanol
  • 10 mM Tris·Cl, pH 8.0
  • Cell scraper (Sarstedt, cat. no. 83.1830)
  • 1.5‐ml nuclease‐free tubes
  • Refrigerated centrifuge
  • 0.1‐ml micro‐sized glass Dounce tissue homogenizer (Wheaton, cat. no. 357844)
  • Thermomixer
  • Phase Lock Gel Heavy 2‐ml tubes (5 PRIME, cat. no. 2302830)
  • End‐over‐end rotator
  • Spectrophotometer

Alternate Protocol 2: Isolation of Viral DNA Using Commercial DNA Isolation Kits

  Additional Materials (also see protocol 9)
  • DNA isolation kit commercially available from:
    • ZR Genomic DNA‐Tissue Miniprep (Zymo Research, cat. no. D3050) or
    • QIAamp DNA Mini Kit (Qiagen, cat. no. 51304)

Basic Protocol 7: Analysis of Viral RNA/DNA by Quantitative Real‐Time PCR

  Materials
  • cDNA generated from experimental RNA or isolated DNA
  • Nuclease‐free water
  • Universal Sybr Green Mastermix (Roche Applied Sciences, cat. no. 04673484001)
  • Gene‐specific primers (see Table 14.5.1)
  • Nuclease‐free 1.5‐ml tubes
  • 96‐well PCR plate
  • PCR plate sealing film
  • Quantitative real‐time PCR instrument
Table 4.0.1   MaterialsRecommended qPCR Primer Sets

Gene Class Primer sequences (5′–3′) Source
ICP4 (RS1) Immediate Early F: GAAGTTGTGGACTGGGAAGG Ottosen et al. ( )
R: GTTGCCGTTTATTGCGTCTT
ICP0 Immediate Early F: CCCACTATCAGGTACACCAGCTT Liang et al. ( )
R: CTGCGCTGCGACACCTT
ICP22 (U S1) Immediate Early F: TTTGGGGAGTTTGACTGGAC Ottosen et al. ( )
R: CAGACACTTGCGGTCTTCTG
ICP27 (U L54) Immediate Early F: GCATCCTTCGTGTTTGTCATTCTG Liang et al. ( )
R: GCATCTTCTCTCCGACCCCG
ICP8 (U L29) Early F: GGGCGCAACTTTCGCAATCAATTC Arbuckle and Kristie ( )
R: GGCCGACAGAAACCCGTTGTTAAA
U L30 Early F: TCCAGCGACGTCGAGTTTAACTGT Arbuckle and Kristie ( )
R: ACATGAGCTTGTATGCCGGTAGGT
U L23 (TK) Early F: GCGTCGGTCACGGCATAAG Kent et al. ( )
R: GGGTGAGATATCGGCCGGG
U L52 Early F: GCCCTCCTCACAAACTCTCTACTG Peng et al. ( )
R: CCGTCCCCAATAAACAAAAGG
gD (U S6) Late F: GTCAGCGAGGATAACCTGGGG Arbuckle and Kristie ( )
R: GGGAGGGCGTACTTACAGGAGC
gC (U L44) Late F: TGATTATCGGCGAGGTGAC
R: ACAAACTCCACGGGGTTACG
GAPDH Control F: TTCGACAGTCAGCCGCATCTTCTT Cliffe and Knipe ( )
R: CAGGCGCCCAATACGACCAAATC
TBP Control F: TGACCCCCATCACTCCTGC Liang et al. ( )
R: CGTGGTTCGTGGCTCTCTTATC
HPRT Control F: ATTGTAATGACCAGTCAACAGGG
R: GCATTGTTTTGCCAGTGTCAA
UbC Control F: CGGGATTTGGGTCGCAGTTCTTG
R: CGATGGTGTCACTGGGCTCAAC

Basic Protocol 8: Analysis of Viral Protein Expression by Western Blot

  Materials
  • HSV‐1 infected cells (siRNA/drug treated and corresponding control)
  • Dulbecco's phosphate buffered saline without Mg2+ or Ca2+ (DPBS)
  • RIPA lysis buffer (see recipe)
  • Bradford dye reagent concentrate (BioRad, cat. no. 500‐0006)
  • 4× reducing sample buffer (see recipe)
  • Sterile water
  • 10× Tris/glycine/SDS buffer (BioRad, cat. no. 161‐0732)
  • Criterion Tris·Cl 4% to 20% acrylamide gels (BioRad, cat. no. 345‐0033)
  • Precision Plus protein standards (BioRad, cat. no. 161‐0373)
  • 10× Tris glycine transfer buffer (BioRad, cat. no. 161‐0743)
  • Methanol
  • TBS containing 5% milk (see recipe)
  • Primary and secondary antibodies
  • TBST (see recipe)
  • Pierce SuperSignal West Dura Substrate (Thermo Scientific, cat. no. 34075)
  • Stripping solution (see recipe)
  • Cell scraper (Sarstedt, cat. no. 83.1830)
  • Nuclease‐free 1.5‐ml tubes
  • Refrigerated centrifuge
  • 95°C heating block
  • Criterion gel box
  • Syringe with needle
  • Millipore Immobilon‐P PVDF membranes (Millipore, cat. no. IPVH00010)
  • Whatman 3MM Chr cellulose filter paper
  • Platform rocker
  • Transfer module
  • X‐ray film or appropriate imager
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Arbuckle, J. and Kristie, T. 2014. Epigenetic repression of herpes simplex virus infection by the nucleosome remodeler CHD3. mBio 5:e01027‐e01013.
   Cliffe, A.R. and Knipe, D.M. 2008. Herpes Simplex Virus ICP0 promotes both histone removal and acetylation on viral DNA during lytic infection. J. Virol. 82:12030‐12038.
   Conn, K. and Schang, L. 2013. Chromatin dynamics during lytic infection with herpes simplex virus 1. Viruses 5:1758‐1786.
   Huang, J. , Kent, J.R. , Placek, B. , Whelan, K.A. , Hollow, C.M. , Zeng, P.‐Y. , Fraser, N.W. , and Berger, S.L. 2006. Trimethylation of histone H3 lysine 4 by Set1 in the lytic infection of human herpes simplex virus 1. J. Virol. 80:5740‐5746.
   Kent, J.R. , Zeng, P.‐Y. , Atanasiu, D. , Gardner, J. , Fraser, N.W. , and Berger, S.L. 2004. During lytic infection herpes simplex virus type 1 is associated with histones bearing modifications that correlate with active transcription. J. Virol. 78:10178‐10186.
   Kristie, T.M. , Liang, Y. , and Vogel, J.L. 2010. Control of α‐herpesvirus IE gene expression by HCF‐1 coupled chromatin modification activities. Biochim. Biophys. Acta 1799:257‐265.
   Liang, Y. , Vogel, J.L. , Narayanan, A. , Peng, H. , and Kristie, T.M. 2009. Inhibition of the histone demethylase LSD1 blocks [alpha]‐herpesvirus lytic replication and reactivation from latency. Nat. Med. 15:1312‐1317.
   Liang, Y. , Quenelle, D. , Vogel, J.L. , Mascaro, C. , Ortega, A. , and Kristie, T.M. 2013a. A novel selective LSD1/KDM1A inhibitor epigenetically blocks herpes simplex virus lytic replication and reactivation from latency. mBio 4:e00558‐12.
   Liang, Y. , Vogel, J.L. , Arbuckle, J.H. , Rai, G. , Jadhav, A. , Simeonov, A. , Maloney, D.J. , and Kristie, T.M. 2013b. Targeting the JMJD2 histone demethylases to epigenetically control herpesvirus infection and reactivation from latency. Sci. Transl. Med. 5:167ra165.
   Narayanan, A. , Ruyechan, W.T. , and Kristie, T.M. 2007. The coactivator host cell factor‐1 mediates Set1 and MLL1 H3K4 trimethylation at herpesvirus immediate early promoters for initiation of infection. Proc. Natl. Acad. Sci. U.S.A. 104:10835‐10840.
   Oh, H.S. , Bryant, K.F. , Nieland, T.J.F. , Mazumder, A. , Bagul, M. , Bathe, M. , Root, D.E. , and Knipe, D.M. 2014. A targeted RNA interference screen reveals novel epigenetic factors that regulate herpesviral gene expression. mBio 5:e01086‐13.
   Ottosen, S. , Herrera, F.J. , Doroghazi, J.R. , Hull, A. , Mittal, S. , Lane, W.S. , and Triezenberg, S.J. 2006. Phosphorylation of the VP16 transcriptional activator protein during herpes simplex virus infection and mutational analysis of putative phosphorylation sites. Virology 345:468‐481.
   Peng, H. , Nogueira, M.L. , Vogel, J.L. , and Kristie, T.M. 2010. Transcriptional coactivator HCF‐1 couples the histone chaperone Asf1b to HSV‐1 DNA replication components. Proc. Natl. Acad. Sci. U.S.A. 107:2461‐2466.
   Pignatti, P.F. and Cassai, E. 1980. Analysis of herpes simplex virus nucleoprotein complexes extracted from infected cells. J. Virol. 36:816‐828.
   Spandidos, A. , Wang, X. , Wang, H. , Dragnev, S. , Thurber, T. , and Seed, B. 2008. A comprehensive collection of experimentally validated primers for polymerase chain reaction quantitation of murine transcript abundance. BMC Genomics 9:633.
   Spandidos, A. , Wang, X. , Wang, H. , and Seed, B. 2010. PrimerBank: A resource of human and mouse PCR primer pairs for gene expression detection and quantification. Nucl. Acids Res. 38:D792‐D799.
   Wang, X. and Seed, B. 2003. A PCR primer bank for quantitative gene expression analysis. Nucl. Acids Res. 31:e154.
Key Reference
   Fields, B.N. , Knipe, D.M. , and Howley, P.M. 2007. Fields Virology, 5th ed. Wolters Kluwer Health/Lippincott Williams & Wilkins, Philadelphia, Penna.
  Field Virology is considered the comprehensive reference for the field of virology. Chapter 66 contains information related to the history, molecular biology, and clinical significance of HSV‐1 and HSV‐2.
Internet Resources
   http://www.youtube.com/playlist?list=PL2C46600596D9A876
  YouTube Video Series “Real Time Quantitative PCR Analysis” by americanbiotech.
   http://pathmicro.med.sc.edu/pcr/realtime‐home.htm.
  Hunt, Margaret. Real Time PCR. Microbiology and Immunology On‐line, University of South Carolina School of Medicine.
   http://pga.mgh.harvard.edu/primerbank/
  Harvard PrimerBank.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library