PA‐seq for Global Identification of RNA Polyadenylation Sites of Kaposi's Sarcoma–Associated Herpesvirus Transcripts

Ting Ni1, Vladimir Majerciak1, Zhi‐Ming Zheng2, Jun Zhu3

1 These authors should be considered co–first authors, 2 Tumor Virus RNA Biology Section, Gene Regulation and Chromosome Biology Laboratory, Center for Cancer Research, National Cancer Institute, National Institutes of Health, Frederick, Maryland, 3 Corresponding author
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14E.7
DOI:  10.1002/cpmc.1
Online Posting Date:  May, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Kaposi's sarcoma–associated herpesvirus (KSHV) is a human oncovirus linked to the development of several malignancies in immunocompromised patients. Like other herpesviruses, KSHV has a large DNA genome encoding more than 100 distinct gene products. Despite being transcribed and processed by cellular machinery, the structure and organization of KSHV genes in the virus genome differ from what is observed in cellular genes from the human genome. A typical feature of KSHV expression is the production of polycistronic transcripts initiated from different promoters but sharing the same polyadenylation site (pA site). This represents a challenge in determination of the 3′ end of individual viral transcripts. Such information is critical for generation of a virus transcriptional map for genetic studies. Here we present PA‐seq, a high‐throughput method for genome‐wide analysis of pA sites of KSHV transcripts in B lymphocytes with latent or lytic KSHV infection. Besides identification of all viral pA sites, PA‐seq also provides quantitative information about the levels of viral transcripts associated with each pA site, making it possible to determine the relative expression levels of viral genes at various stages of infection. Due to the indiscriminate nature of PA‐seq, the pA sites of host transcripts are also concurrently mapped in the testing samples. Therefore, this technology can simultaneously estimate the expression changes of host genes and RNA polyadenylation upon KSHV infection. © 2016 by John Wiley & Sons, Inc.

Keywords: herpesvirus; KSHV; PA‐seq; polyadenylation; transcript

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Primary effusion lymphoma (PEL) cell lines: JSC‐1 (Cannon et al., ), BCBL‐1 (Renne et al., ), BCBL1‐TREx‐vector/Rta (Nakamura et al., ); cell lines may be obtained upon request from the corresponding authors
  • Complete RPMI 1640 medium (see recipe)
  • Activators of KSHV lytic cycle:
  • Valproic acid, sodium salt (Sigma‐Aldrich, cat. no. P4543)
  • n‐Butyric acid, sodium salt (Sigma‐Aldrich, cat. no. B‐5887)
  • Doxycycline hyclate (Sigma‐Aldrich, cat. no. D9891)
  • Phosphate‐buffered saline, pH 7.4 (PBS, Thermo Fisher Scientific, cat. no. 10010‐023)
  • RNAlater RNA Stabilization Reagent (Qiagen, cat. no. 76104)
  • TRIzol reagent (Thermo Fisher Scientific, cat. no. 15596‐026)
  • RNeasy Mini kit (Qiagen, cat. no. 74104)
  • RNeasy MinElute Cleanup Kit (Qiagen, cat. no. 74204)
  • RNase‐Free DNase Set (contains DNase I, RNase‐free RDD buffer and RNase‐free H 2O, Qiagen, cat. no. 79254)
  • Agencourt RNAClean XP magnetic beads (Beckman Coulter, cat. no. A63987)
  • 70%, 80%, and 100% ethanol (freshly prepared)
  • Nuclease‐free H 2O (Ambion, cat. no. AM9932)
  • 3 M sodium acetate, pH 5.2 (RNase‐free; Thermo Fisher Scientific, cat. no. R1181)
  • GlycoBlue coprecipitant (15 mg/ml, Ambion, cat. no. AM9516)
  • Dry ice
  • 5× fragmentation buffer (see recipe)
  • dNTP mix, 10 mM each dNTP (Bioline, cat. no. BIO‐39029)
  • 10 μM BdUT3VN primer: 5′‐bio‐T 16dUTTTVN‐3′ (‘bio’denotes duo biotin group, ‘dU’ stands for deoxyuridine, ‘V’ represents any nucleotide except T, and ‘N’ denotes any nucleotide; synthesized by Integrated DNA Technologies (IDT)
  • SuperScript II Reverse Transcriptase kit (contains reverse transcriptase, 5× first‐strand buffer and 0.5 M DTT, Thermo Fisher Scientific, cat. no. 18064‐014)
  • Recombinant RNasin Ribonuclease Inhibitor (Promega, cat. no. N2515)
  • 10× second‐strand buffer (see recipe)
  • E. coli DNA Polymerase I (NEB, cat. no. M0209L)
  • RNase H (NEB, cat. no. M0297L)
  • Dynabeads MyOne Streptavidin C1 magnetic beads (Thermo Fisher Scientific, cat. no. 65001)
  • 2× Binding and Wash (B&W) Buffer (see recipe)
  • 10 mM Tris·Cl, pH 7.4 ( appendix 2A)
  • APex Heat‐Labile Alkaline Phosphatase (Epicentre, cat. no. AP49100) and 10× APex buffer
  • TE1 buffer: 10 mM Tris·Cl, pH 8.0/0.1 mM EDTA
  • USER (Uracil‐Specific Excision Reagent) enzyme (NEB, cat. no. M5505L)
  • DNA Clean & Concentrator 5 kit (ZYMO Research, cat. no. D4014)
  • TaqMan probe for β‐actin (ACTB) (Thermo Fisher Scientific, cat. no. 4331182, probe set Hs01060665_g1)
  • TaqMan Gene Expression Master Mix (Thermo Fisher Scientific, cat. no. 4369016)
  • 10× NEBuffer 2 (NEB, cat. no. B7002S)
  • T4 DNA polymerase (NEB, cat. no. M0203L)
  • Exo‐Minus Klenow DNA polymerase (Epicentre, cat. no. KL11101K) and 10× buffer
  • dNTP mix: 2.5 mM each dNTP
  • 25 μM dATP (Bioline, cat. no. BIO‐39036)
  • Illumina‐compatible indexed adaptors (NEXTflex DNA Barcodes, BIOO Scientific, cat. no. 514104):
  • TruSeq Universal Adaptor:
  • 5′‐AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT‐3′
  • TruSeq Indexed Adaptor:
  • 5′‐GATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG‐3′ (‘NNNNNN' denotes the index, of which each index has a unique sequence according to the vendor's manual)
  • T4 DNA ligase, high concentration (NEB, cat. no. M0202M)
  • E‐Gel EX Agarose Gels, 2% (Thermo Fisher Scientific, cat. no. G4020‐02)
  • Zymoclean Gel DNA Recovery Kit (ZYMO Research, cat. no. D4008)
  • TE buffer. pH 8.0 ( appendix 2A)
  • Illumina‐compatible NEXTflex PCR Primer 1: 5′‐AATGATACGGCGACCACCGAGATCTACAC‐3′ (IDT, HPLC‐grade)
  • Illumina‐compatible NEXTflex PCR Primer 2: 5′‐CAAGCAGAAGACGGCATACGAGAT‐3′ (IDT, HPLC‐grade)
  • Phusion High‐Fidelity DNA polymerase (NEB, cat. no. M0530L) and 5× buffer
  • 1% (v/v) Tween 20, for molecular biology (Sigma‐Aldrich, cat. no. P9416‐50ML)
  • Nuclease‐free 1.7‐ml graduated microcentrifuge tubes (GeneMates, cat. no. C‐3262‐1)
  • Centrifuge and microcentrifuge, refrigerated
  • 15‐ml conical centrifuge tubes (e.g., Corning Falcon)
  • Magnetic stand
  • TissueLyser LT (Qiagen, cat. no. 85600) with steel bead
  • MagneSphere Technology Magnetic Separation Stand, 1.5 ml (twelve‐position; Promega, cat. no. Z5342)
  • Nanodrop microspectrophotometer (Thermo Fisher Scientific, cat. no. A30221) or equivalent
  • MicroAmp Reaction Tube with Cap, 0.2 ml, autoclaved (Thermo Fisher Scientific, cat. no. N8010612)
  • Veriti PCR Thermocycler (Thermo Fisher Scientific, cat. no. 4375786)
  • PCR cooler (e.g., Eppendorf)
  • End‐over‐end rotator
  • Eppendorf Thermomixer (Eppendorf, cat. no. 22670107)
  • StepOnePlus Real‐Time PCR System (Thermo Fisher Scientific, cat. no. 4376600)
  • Qubit 3.0 Fluorometer (Thermo Fisher Scientific, cat. no. Q33216)
  • HiSeq 2500 Ultra‐High‐Throughput Sequencing System (Illumina)
  • Burrows‐Wheeler Aligner (BWA), free download from http://bio‐bwa.sourceforge.net/
  • Integrative Genomics Viewer (IGV), free download from https://www.broadinstitute.org/igv/
  • F‐Seq, free download from http://fureylab.web.unc.edu/software/fseq/
  • SAMtools, free download from http://samtools.sourceforge.net/
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and the polymerase chain reaction (Kramer and Coen, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Ajiro, M. and Zheng, Z.M. 2014. Oncogenes and RNA splicing of human tumor viruses. Emerg. Microbes. Infect. 3:e63. doi: 10.1038/emi.2014.62.
  Arias, C., Weisburd, B., Stern‐Ginossar, N., Mercier, A., Madrid, A.S., Bellare, P., Holdorf, M., Weissman, J.S., and Ganem, D. 2014. KSHV 2.0: A comprehensive annotation of the Kaposi's sarcoma‐associated herpesvirus genome using next‐generation sequencing reveals novel genomic and functional features. PLoS Pathog. 10:e1003847. doi: 10.1371/journal.ppat.1003847.
  Beaudoing, E., Freier, S., Wyatt, J.R., Claverie, J.M., and Gautheret, D. 2000. Patterns of variant polyadenylation signal usage in human genes. Genome Res. 10:1001‐1010. doi: 10.1101/gr.10.7.1001.
  Cai, X., Lu, S., Zhang, Z., Gonzalez, C.M., Damania, B., and Cullen, B.R. 2005. Kaposi's sarcoma‐associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc. Natl. Acad. Sci. U.S.A. 102:5570‐5575. doi: 10.1073/pnas.0408192102.
  Cannon, J.S., Ciufo, D., Hawkins, A.L., Griffin, C.A., Borowitz, M.J., Hayward, G.S., and Ambinder, R.F. 2000. A new primary effusion lymphoma‐derived cell line yields a highly infectious Kaposi's sarcoma herpesvirus‐containing supernatant. J. Virol. 74:10187‐10193. doi: 10.1128/JVI.74.21.10187‐10193.2000.
  Cesarman, E., Chang, Y., Moore, P.S., Said, J.W., and Knowles, D.M. 1995. Kaposi's sarcoma–associated herpesvirus‐like DNA sequences in AIDS‐related body‐cavity‐based lymphomas. N. Engl. J. Med. 332:1186‐1191. doi: 10.1056/NEJM199505043321802.
  Chang, Y. and Moore, P.S. 1996. Kaposi's Sarcoma (KS)‐associated herpesvirus and its role in KS. Infect. Agents Dis. 5:215‐222.
  Chang, Y., Cesarman, E., Pessin, M.S., Lee, F., Culpepper, J., Knowles, D.M., and Moore, P.S. 1994. Identification of herpesvirus‐like DNA sequences in AIDS‐associated Kaposi's sarcoma. Science 266:1865‐1869. doi: 10.1126/science.7997879.
  Chen, F., MacDonald, C.C., and Wilusz, J. 1995. Cleavage site determinants in the mammalian polyadenylation signal. Nucleic Acids Res. 23:2614‐2620. doi: 10.1093/nar/23.14.2614.
  Gil, A. and Proudfoot, N.J. 1987. Position‐dependent sequence elements downstream of AAUAAA are required for efficient rabbit beta‐globin mRNA 3′ end formation. Cell 49:399‐406. doi: 10.1016/0092‐8674(87)90292‐3.
  Hafez, D., Ni, T., Mukherjee, S., Zhu, J., and Ohler, U. 2013. Genome‐wide identification and predictive modeling of tissue‐specific alternative polyadenylation. Bioinformatics 29:i108‐i116. doi: 10.1093/bioinformatics/btt233.
  Jan, C.H., Friedman, R.C., Ruby, J.G., and Bartel, D.P. 2011. Formation, regulation and evolution of Caenorhabditis elegans 3′UTRs. Nature 469:97‐101. doi: 10.1038/nature09616.
  Kahvejian, A., Svitkin, Y.V., Sukarieh, R., M'Boutchou, M.N., and Sonenberg, N. 2005. Mammalian poly(A)‐binding protein is a eukaryotic translation initiation factor, which acts via multiple mechanisms. Genes Dev. 19:104‐113. doi: 10.1101/gad.1262905.
  Kramer, M.F. and Coen, D.M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Li, H. and Durbin, R. 2009. Fast and accurate short read alignment with Burrows‐Wheeler transform. Bioinformatics 25:1754‐1760. doi: 10.1093/bioinformatics/btp324.
  Majerciak, V. and Zheng, Z.M. 2013. Detection of viral RNA splicing in diagnostic virology. In Advanced Techniques in Diagnostic Microbiology (Y.‐W. Tang and C.W. Stratton, eds.) pp. 693‐748. Springer, New York.
  Majerciak, V., Yamanegi, K., and Zheng, Z.M. 2006. Gene structure and expression of Kaposi's sarcoma‐associated herpesvirus ORF56, ORF57, ORF58, and ORF59. J. Virol. 80:11968‐11981. doi: 10.1128/JVI.01394‐06.
  Majerciak, V., Pripuzova, N., McCoy, J.P., Gao, S.J., and Zheng, Z.M. 2007. Targeted disruption of Kaposi's sarcoma‐associated herpesvirus ORF57 in the viral genome is detrimental for the expression of ORF59, K8alpha, and K8.1 and the production of infectious virus. J. Virol. 81:1062‐1071. doi: 10.1128/JVI.01558‐06.
  Majerciak, V., Ni, T., Yang, W., Meng, B., Zhu, J., and Zheng, Z.M. 2013. A viral genome landscape of RNA polyadenylation from KSHV latent to lytic infection. PLoS. Pathog. 9:e1003749. doi: 10.1371/journal.ppat.1003749.
  Mandel, C.R., Bai, Y., and Tong, L. 2008. Protein factors in pre‐mRNA 3′‐end processing. Cell. Mol. Life Sci. 65:1099‐1122. doi: 10.1007/s00018‐007‐7474‐3.
  Mangone, M., Manoharan, A.P., Thierry‐Mieg, D., Thierry‐Mieg, J., Han, T., Mackowiak, S.D., Mis, E., Zegar, C., Gutwein, M.R., Khivansara, V., Attie, O., Chen, K., Salehi‐Ashtiani, K., Vidal, M., Harkins, T.T., Bouffard, P., Suzuki, Y., Sugano, S., Kohara, Y., Rajewsky, N., Piano, F., Gunsalus, K.C., and Kim, J.K. 2010. The landscape of C. elegans 3′UTRs. Science 329:432‐435. doi: 10.1126/science.1191244.
  Murthy, K.G. and Manley, J.L. 1995. The 160‐kD subunit of human cleavage‐polyadenylation specificity factor coordinates pre‐mRNA 3′‐end formation. Genes Dev. 9:2672‐2683. doi: 10.1101/gad.9.21.2672.
  Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S.L., and Jung, J.U. 2003. Global changes in Kaposi's sarcoma‐associated virus gene expression patterns following expression of a tetracycline‐inducible Rta transactivator. J. Virol. 77:4205‐4220. doi: 10.1128/JVI.77.7.4205‐4220.2003.
  Ni, T., Yang, Y., Hafez, D., Yang, W., Kiesewetter, K., Wakabayashi, Y., Ohler, U., Peng, W., and Zhu, J. 2013. Distinct polyadenylation landscapes of diverse human tissues revealed by a modified PA‐seq strategy. BMC Genomics 14:615. doi: 10.1186/1471‐2164‐14‐615.
  Ozsolak, F., Kapranov, P., Foissac, S., Kim, S.W., Fishilevich, E., Monaghan, A.P., John, B., and Milos, P.M. 2010. Comprehensive polyadenylation site maps in yeast and human reveal pervasive alternative polyadenylation. Cell 143:1018‐1029. doi: 10.1016/j.cell.2010.11.020.
  Proudfoot, N.J. 2011. Ending the message: Poly(A) signals then and now. Genes Dev. 25:1770‐1782. doi: 10.1101/gad.17268411.
  Renne, R., Zhong, W., Herndier, B., McGrath, M., Abbey, N., Kedes, D., and Ganem, D. 1996. Lytic growth of Kaposi's sarcoma‐associated herpesvirus (human herpesvirus 8) in culture. Nat. Med. 2:342‐346. doi: 10.1038/nm0396‐342.
  Russo, J.J., Bohenzky, R.A., Chien, M.C., Chen, J., Yan, M., Maddalena, D., Parry, J.P., Peruzzi, D., Edelman, I.S., Chang, Y., and Moore, P.S. 1996. Nucleotide sequence of the Kaposi sarcoma‐associated herpesvirus (HHV8). Proc. Natl. Acad. Sci. U.S.A. 93:14862‐14867. doi: 10.1073/pnas.93.25.14862.
  Soulier, J., Grollet, L., Oksenhendler, E., Cacoub, P., Cazals‐Hatem, D., Babinet, P., d'Agay, M.F., Clauvel, J.P., Raphael, M., Degos, L., and Sigaux, F. 1995. Kaposi's sarcoma‐associated herpesvirus‐like DNA sequences in multicentric Castleman's disease. Blood 86:1276‐1280.
  Takagaki, Y. and Manley, J.L. 1997. RNA recognition by the human polyadenylation factor CstF. Mol. Cell Biol. 17:3907‐3914. doi: 10.1128/MCB.17.7.3907.
  Tang, S. and Zheng, Z.M. 2002. Kaposi's sarcoma‐associated herpesvirus K8 exon 3 contains three 5¢‐splice sites and harbors a K8.1 transcription start site. J. Biol. Chem. 277:14547‐14556. doi: 10.1074/jbc.M111308200.
  Tian, B., Hu, J., Zhang, H., and Lutz, C.S. 2005. A large‐scale analysis of mRNA polyadenylation of human and mouse genes. Nucleic Acids Res. 33:201‐212. doi: 10.1093/nar/gki158.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Wang, X. and Zheng, Z.M. 2016. Construction of a transcription map for papillomaviruses. Curr. Protoc. Microbiol. 40:14B.6.1‐14B.6.29. doi: 10.1002/9780471729259.mc14b06s40.
  Wang, X., Meyers, C., Wang, H.K., Chow, L.T., and Zheng, Z.M. 2011. Construction of a full transcription map of human papillomavirus type 18 during productive viral infection. J. Virol. 85:8080‐8092. doi: 10.1128/JVI.00670‐11.
  Wilusz, J., Shenk, T., Takagaki, Y., and Manley, J.L. 1990. A multicomponent complex is required for the AAUAAA‐dependent cross‐linking of a 64‐kilodalton protein to polyadenylation substrates. Mol. Cell Biol. 10:1244‐1248. doi: 10.1128/MCB.10.3.1244.
  Yang, L., Duff, M.O., Graveley, B.R., Carmichael, G.G., and Chen, L.L. 2011. Genomewide characterization of non‐polyadenylated RNAs. Genome Biol. 12:R16.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library