In Vitro Replication Assay for Merkel Cell Polyomavirus (MCPyV)

Friederike Neumann1, Manja Czech‐Sioli1, Adam Grundhoff2, Nicole Fischer1

1 Institute for Medical Microbiology, Virology and Hygiene; University Medical Center Hamburg‐Eppendorf, Hamburg, 2 Heinrich‐Pette Institute, Leibniz Institute for Experimental Virology, Hamburg
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14F.2
DOI:  10.1002/9780471729259.mc14f02s38
Online Posting Date:  August, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Merkel cell polyomavirus (MCPyV) genomes are clonally integrated in tumor cells of ∼95% of all Merkel cell carcinoma (MCC) cases. The virus is highly prevalent; however, where the virus persists and which cell types are permissive for MCPyV replication is still unknown. As a consequence, very little information is available about the life cycle and no fully permissive in vitro replication system has been established. Recently, semi‐permissive replication systems based on wild‐type MCPyV genomes recovered from the skin of healthy donors or synthetic MCPyV genomes constructed from consensus sequences have been established. The transfection of this intramolecular re‐circularized MCPyV DNA into some human cell lines recapitulates efficient DNA replication of the viral genome, viral gene expression as well as moderate levels of virus particle formation. However, serial transmission of infectious virus is still restricted in these cells. © 2015 by John Wiley & Sons, Inc.

Keywords: human polyomavirus; viral DNA replication; HIRT extract; in vitro replication assay; real‐time PCR; synthetic MCPyV genome

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of MCPyV Genomic DNA for Transfection
  • Basic Protocol 2: Polyomavirus DNA Replication Assay by Southern Blot Analysis
  • Alternate Protocol 1: Polyomavirus DNA Replication Assay by Real‐Time PCR Analysis
  • Support Protocol 1: Generation of Radiolabeled Hybridization Probe by Random Priming
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of MCPyV Genomic DNA for Transfection

  Materials
  • Proviral MCPyV genome: MCV‐Syn (Neumann et al., ; GenBank JN707599.1) or pCMV‐R17a (Schowalter et al., ; GenBank HM011555.1) or pMCV‐HF (Feng et al., ; GenBank JF813003.1)
  • Restriction enzymes:
    • SacI and buffer (Thermo Scientific, cat. no. FD1133) for MCV‐Syn
    • EcoRI and buffer (Thermo Scientific) for pCMV‐R17a
    • BsrFI and buffer (Thermo Scientific) for pMCV‐HF
  • Ultrapure agarose (Life Technologies, cat. no. 16500)
  • 0.5× TBE buffer (see recipe)
  • RedSafe nucleic acid staining solution (Bulldog Bio, cat. no. 21141)
  • 1‐kb DNA marker (GeneRuler 1 kb, Thermo Scientific, cat. no. SM0313)
  • NucleoSpin Gel and PCR Clean‐up kit (Macherey Nagel, cat. no. 740609.50)
  • T4 DNA ligase and buffer, high concentration (NEB, cat. no. M0202T)
  • GenElute Five‐Minute Plasmid Miniprep Kit (Sigma‐Aldrich, cat. no. PFM250‐1KT)
  • PFSK‐1 cells (ATCC #CRL‐2060), 293 cells (ATCC #CRL‐1573), H1299 cells (ATCC #CRL‐5803), or HCT116 cells (ATCC #CCL‐247)
  • Cell culture medium (for PFSK‐1 cells: RPMI medium supplemented with 10% FBS, 10 U/ml penicillin/streptomycin, and 1% L‐glutamine; for 293, H1299, and HCT116 cells: DMEM medium supplemented with 10% FBS and 10 U/ml penicillin/streptomycin)
  • pUC18 plasmid
  • GFP‐expressing plasmid
  • Transfection reagent (X‐tremeGENE HP DNA transfection reagent, GE Healthcare, cat. no. 06366244001)
  • Trypsin
  • PBS
  • 2% Fetal bovine serum (FBS)
  • 1.5‐ and 2‐ml microcentrifuge tubes
  • 37°, 55°, and 65°C block heaters or water baths
  • Agarose gel electrophoresis chamber and power supply
  • 16°C heat block or PCR thermal cycler
  • NanoDrop spectrophotometer
  • 100/20–mm cell culture dishes for adherent cells
  • 37°C, 5% CO 2 humidified incubator
  • 12‐well plates
  • Fluorescence activated cell sorter (FACS)
  • Fluorescent microscope
  • Tabletop centrifuge

Basic Protocol 2: Polyomavirus DNA Replication Assay by Southern Blot Analysis

  Materials
  • Cell pellets (see protocol 1, step 16)
  • HIRT buffer (see recipe)
  • 5 M NaCl solution
  • 25 mg/ml Proteinase K
  • Saturated phenol in TE buffer, pH 7.5 to 8.0
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • Absolute and 70% (v/v) ethanol
  • TE buffer (see recipe)
  • EcoRI (if using MCV‐Syn)
  • DpnI
  • Re‐circularized MCPyV DNA or proviral MCV‐Syn construct
  • SacI, optional
  • 14 × 14–cm 0.8% agarose gel containing RedSafe
  • Depurination buffer (see recipe)
  • Denaturation buffer (see recipe)
  • Neutralization buffer (see recipe)
  • Amersham Hybond‐N+ nylon membrane (GE Healthcare, cat. no. RPN303B)
  • 20× SSC (see recipe)
  • Hybridization buffer (Ultrahyb, Ambion, cat. no. AM8670)
  • Radiolabeled hybridization probe (see Support Protocol)
  • 2× wash buffer (see recipe), 42°C
  • 0.2× wash buffer (see recipe)
  • 1.5‐ml microcentrifuge tubes
  • Microcentrifuge
  • 37°C heating block
  • Spectrophotometer
  • Electrophoresis apparatus and power source
  • Lightbox and gel photography equipment
  • Platform shaker
  • Whatman 3MM paper
  • Parafilm or plastic wrap
  • UV crosslinker (STRATAGENE UV Stratalinker 1800 Crosslinker)
  • Hybridization tubes
  • 42°C hybridization oven
  • X‐ray film, optional
  • Phosphorimager and screen
NOTE: Perform all centrifugation steps at room temperature unless stated otherwise.

Alternate Protocol 1: Polyomavirus DNA Replication Assay by Real‐Time PCR Analysis

  Materials
  • DNA pellets (see protocol 1)
  • DNeasy Blood and Tissue Kit (Qiagen, cat. no. 69504) containing:
    • Buffer AE
  • DpnI restriction enzyme and 10× buffer (Thermo Scientific, cat. no. FD1704)
  • 3 M sodium acetate
  • 2‐Propanol
  • 70% ethanol
  • Qubit dsDNA BR Assay Kit (Molecular Probes, cat. no. Q32850)
  • VP1‐specific oligonucleotides (VP1 3914‐Fw: 5′‐CATTTAGCATTGGCAGAGA‐3′; VP1 4108‐Rev: 5′‐TAAAGGAGGAGTGGAAGT‐3′)
  • VP1‐specific Taqman probe (VP1_6‐FAM: 5′‐FAM‐GATCTGGAGATGATCCCTTTGGCTG‐BHQ1)
  • GAPDH‐specific oligonucleotides (GAPDH_Fw: 5′‐TGTGTCCCTCAATATGGTCCTGTC‐3′; GAPDH_Rev: 5′‐ATGGTGGTGAAGACGCCAGTG‐3′)
  • GAPDH‐specific Taqman probe (GAPDH_VIC: 5′‐VIC‐GTGGCGCTGAGTACGTCGTGGAGTC‐BHQ1)
  • Rotor‐Gene Multiplex PCR Kit (Qiagen, cat. no. 204772)
  • 1.5‐ml microcentrifuge tubes
  • 37°C and 56°C heating blocks
  • Refrigerated benchtop centrifuge
  • Filter tips
  • Rotor‐Gene Q (Qiagen)

Support Protocol 1: Generation of Radiolabeled Hybridization Probe by Random Priming

  Materials
  • Religated MCPyV DNA
  • LT‐specific oligonucleotides (LT_F 1‐25: 5′‐ATGGATTTAGTCCTAAATAGGAAAG;
    • LT_R 234‐211: 5′‐ CTCATCAAACATAGAGAAGTCAC)
  • Taq polymerase (Platinum Taq, Life Technologies, cat. no. 11304‐011)
  • RedSafe nucleic acid staining solution (Bulldog Bio, cat. no. 21141)
  • Ultrapure agarose (Life Technologies, cat. no. 16500)
  • 0.5× TBE buffer (see recipe)
  • NucleoSpin Gel and PCR Clean‐up (Macherey Nagel, cat. no. 740609.50)
  • TE buffer (see recipe)
  • Rediprime II DNA Labeling System (GE healthcare, cat. no. RPN1633)
  • 32P dCTP (Hartmann, cat. no. SRP‐205)
  • 0.2 M EDTA
  • PCR thermal cycler
  • Spectrophotometer (Nanodrop)
  • 37° and 95°C heating blocks
  • Tabletop centrifuge
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Allander, T. , Andreasson, K. , Gupta, S. , Bjerkner, A. , Bogdanovic, G. , Persson, M.A. , Dalianis, T. , Ramqvist, T. , and Andersson, B. 2007. Identification of a third human polyomavirus. J. Virol. 81:4130‐4136.
   Buck, C.B. , Phan, G.Q. , Raiji, M.T. , Murphy, P.M. , McDermott, D.H. , and McBride, A.A. 2012. Complete genome sequence of a tenth human polyomavirus. J. Virol. 86:10887
   Carter, J.J. , Daugherty, M.D. , Qi, X. , Bheda‐Malge, A. , Wipf, G.C. , Robinson, K. , Roman, A. , Malik, H.S. , and Galloway, D.A. 2013. Identification of an overprinting gene in Merkel cell polyomavirus provides evolutionary insight into the birth of viral genes. Proc. Natl. Acad. Sci. U.S.A. 110:12744‐12749.
   Chang, Y. and Moore, P.S. 2012. Merkel cell carcinoma: A virus‐induced human cancer. Annu. Rev. Pathol. 7:123‐144.
   Damak, S. and Bullock, D.W. 1993. A simple two‐step method for efficient blunt‐end ligation of DNA fragments. Biotechniques 15:448‐450, 452.
   DeCaprio, J.A. and Garcea, R.L. 2013. A cornucopia of human polyomaviruses. Nat. Rev. Microbiol. 11:264‐276.
   Feng, H. , Kwun, H.J. , Liu, X. , Gjoerup, O. , Stolz, D.B. , Chang, Y. , and Moore, P.S. 2011. Cellular and viral factors regulating Merkel cell polyomavirus replication. PLoS One 6:e22468.
   Feng, H. , Shuda, M. , Chang, Y. , and Moore, P.S. 2008. Clonal integration of a polyomavirus in human Merkel cell carcinoma. Science 319:1096‐1100.
   Ferenczy, M.W. , Marshall, L.J. , Nelson, C.D. , Atwood, W.J. , Nath, A. , Khalili, K. , and Major, E.O. 2012. Molecular biology, epidemiology, and pathogenesis of progressive multifocal leukoencephalopathy, the JC virus‐induced demyelinating disease of the human brain. Clin. Microbiol. Rev. 25:471‐506.
   Gardner, S.D. , Field, A.M. , Coleman, D.V. , and Hulme, B. 1971. New human papovavirus (B.K.) isolated from urine after renal transplantation. Lancet 1:1253‐1257.
   Gaynor, A.M. , Nissen, M.D. , Whiley, D.M. , Mackay, I.M. , Lambert, S.B. , Wu, G. , Brennan, D.C. , Storch, G.A. , Sloots, T.P. , and Wang, D. 2007. Identification of a novel polyomavirus from patients with acute respiratory tract infections. PLoS Pathog. 3:e64.
   Haycox, C.L. , Kim, S. , Fleckman, P. , Smith, L.T. , Piepkorn, M. , Sundberg, J.P. , Howell, D.N. , and Miller, S.E. 1999. Trichodysplasia spinulosa: A newly described folliculocentric viral infection in an immunocompromised host. J. Investig. Dermatol. Symp. Proc. 4:268‐271.
   Higuchi, R. , Fockler, C. , Dollinger, G. , and Watson, R. 1993. Kinetic PCR analysis: Real‐time monitoring of DNA amplification reactions. Biotechnology (N.Y.) 11:1026‐1030.
   Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365‐369.
   Ho, J. , Jedrych, J.J. , Feng, H. , Natalie, A.A. , Grandinetti, L. , Mirvish, E. , Crespo, M.M. , Yadav, D. , Fasanella, K.E. , Proksell, S. , Kuan, S.F. , Pastrana, D.V. , Buck, C.B. , Shuda, Y. , Moore, P.S. , and Chang, Y. 2015. Human polyomavirus 7‐associated pruritic rash and viremia in transplant recipients. J. Infect. Dis. 211:1560‐1565.
   Knowles, W.A. 2006. Discovery and epidemiology of the human polyomaviruses BK virus (BKV) and JC virus (JCV). Adv. Exp. Med. Biol. 577:19‐45.
   Korup, S. , Rietscher, J. , Calvignac‐Spencer, S. , Trusch, F. , Hofmann, J. , Moens, U. , Sauer, I. , Voigt, S. , Schmuck, R. , and Ehlers, B. 2013. Identification of a novel human polyomavirus in organs of the gastrointestinal tract. PLoS One 8:e58021.
   Kuypers, D.R. 2012. Management of polyomavirus‐associated nephropathy in renal transplant recipients. Nat. Rev. Nephrol. 8:390‐402.
   Lim, E.S. , Reyes, A. , Antonio, M. , Saha, D. , Ikumapayi, U.N. , Adeyemi, M. , Stine, O.C. , Skelton, R. , Brennan, D.C. , Mkakosya, R.S. , Manary, M.J. , Gordon, J.I. , and Wang, D. 2013. Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing. Virology 436:295‐303.
   Mishra, N. , Pereira, M. , Rhodes, R.H. , An, P. , Pipas, J.M. , Jain, K. , Kapoor, A. , Briese, T. , Faust, P.L. , and Lipkin, W.I. 2014. Identification of a novel polyomavirus in a pancreatic transplant recipient with retinal blindness and vasculitic myopathy. J. Infect. Dis. 210:1595‐1599.
   Neumann, F. , Borchert, S. , Schmidt, C. , Reimer, R. , Hohenberg, H. , Fischer, N. , and Grundhoff, A. 2011. Replication, gene expression and particle production by a consensus Merkel Cell Polyomavirus (MCPyV) genome. PLoS One 6:e29112.
   Padgett, B.L. , Walker, D.L. , ZuRhein, G.M. , Eckroade, R.J. , and Dessel, B.H. 1971. Cultivation of papova‐like virus from human brain with progressive multifocal leucoencephalopathy. Lancet 1:1257‐1260.
   Rennspiess, D. , Pujari, S. , Keijzers, M. , Abdul‐Hamid, M.A. , Hochstenbag, M. , Dingemans, A.M. , Kurz, A.K. , Speel, E.J. , Haugg, A. , Pastrana, D.V. , Buck, C.B. , De Baets, M.H. , and Zur Hausen, A. 2015. Detection of human polyomavirus 7 in human thymic epithelial tumors. J. Thorac. Oncol. 10:360‐366.
   Sauvage, V. , Foulongne, V. , Cheval, J. , Ar Gouilh, M. , Pariente, K. , Dereure, O. , Manuguerra, J.C. , Richardson, J. , Lecuit, M. , Burguiere, A. , Caro, V. , and Eloit, M. 2011. Human polyomavirus related to African green monkey lymphotropic polyomavirus. Emerg. Infect. Dis. 17:1364‐1370.
   Schowalter, R.M. , Pastrana, D.V. , and Buck, C.B. 2011. Glycosaminoglycans and sialylated glycans sequentially facilitate Merkel cell polyomavirus infectious entry. PLoS Pathog. 7:e1002161.
   Schowalter, R.M. , Pastrana, D.V. , Pumphrey, K.A. , Moyer, A.L. , and Buck, C.B. 2010. Merkel cell polyomavirus and two previously unknown polyomaviruses are chronically shed from human skin. Cell Host Microbe 7:509‐515.
   Scuda, N. , Hofmann, J. , Calvignac‐Spencer, S. , Ruprecht, K. , Liman, P. , Kuhn, J. , Hengel, H. , and Ehlers, B. 2011. A novel human polyomavirus closely related to the African green monkey‐derived lymphotropic polyomavirus. J. Virol. 85:4586‐4590.
   Seo, G.J. , Chen, C.J. , and Sullivan, C.S. 2009. Merkel cell polyomavirus encodes a microRNA with the ability to autoregulate viral gene expression. Virology 383:183‐187.
   Shuda, M. , Feng, H. , Kwun, H.J. , Rosen, S.T. , Gjoerup, O. , Moore, P.S. , and Chang, Y. 2008. T antigen mutations are a human tumor‐specific signature for Merkel cell polyomavirus. Proc. Natl. Acad. Sci. U.S.A. 105:16272‐16277.
   Siebrasse, E.A. , Reyes, A. , Lim, E.S. , Zhao, G. , Mkakosya, R.S. , Manary, M.J. , Gordon, J.I. , and Wang, D. 2012. Identification of MW polyomavirus, a novel polyomavirus in human stool. J. Virol. 86:10321‐10326.
   Southern, E.M. 1975. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol. 98:503‐517.
   van der Meijden, E ., Janssens, R.W. , Lauber, C. , Bouwes Bavinck, J.N. , Gorbalenya, A.E. , and Feltkamp, M.C. 2010. Discovery of a new human polyomavirus associated with trichodysplasia spinulosa in an immunocompromized patient. PLoS Pathog. 6:e1001024.
   Yu, G. , Greninger, A.L. , Isa, P. , Phan, T.G. , Martinez, M.A. , de la Luz Sanchez, M. , Contreras, J.F. , Santos‐Preciado, J.I. , Parsonnet, J. , Miller, S. , DeRisi, J.L. , Delwart, E. , Arias, C.F. , and Chiu, C.Y. 2012. Discovery of a novel polyomavirus in acute diarrheal samples from children. PLoS One 7:e49449.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library