Epigenetic Analysis of SV40 Minichromosomes

Lata Balakrishnan1, Barry Milavetz2

1 Department of Biology, Indiana University‐Purdue University Indianapolis, Indianapolis, Indiana, 2 Department of Biomedical Sciences, University of North Dakota School of Medicine and Health Sciences, Grand Forks
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 14F.3
DOI:  10.1002/cpmc.35
Online Posting Date:  August, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Simian virus 40 (SV40) is one of the best‐characterized members of the polyomavirus family of small DNA tumor viruses. It has a small genome of 5243 bp and utilizes cellular proteins for its molecular biology, with the exception of the T‐antigen protein, which is coded by the virus and is involved in regulating transcription and directing replication. Importantly, SV40 exists as chromatin in both the virus particle and intracellular minichromosomes. These facts, combined with high yields of virus and minichromosomes following infection and ease of manipulation, have made SV40 an extremely useful model to study all aspects of eukaryotic molecular biology. This unit describes procedures for working with SV40 and preparing SV40 chromatin from infected cells and virus particles, as well as procedures for using SV40 chromatin to study epigenetic regulation. © 2017 by John Wiley & Sons, Inc.

Keywords: Simian virus 40 (SV40); minichromosomes; viral epigenetics; chromatin immunoprecipitation; next‐generation sequencing

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of Disrupted Virus
  • Support Protocol 1: Preparation of SV40 DNA by the Hirt Procedure
  • Basic Protocol 2: Preparation of SV40 Minichromosomes from Lytically Infected Cells
  • Basic Protocol 3: Micrococcal Nuclease Digestion of SV40 DNA for Nucleosome Positioning
  • Basic Protocol 4: Chromosome Immunoprecipitation and Fragmentation of SV40 DNA for Histone Modifications and Protein Localization
  • Basic Protocol 5: Preparation of SV40 Libraries for Illumina Sequencing
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of Disrupted Virus

  Materials
  • African green monkey kidney (AGMK) cells (ATCC, cat. no. CCL‐26), 70% confluent
  • Supplemented MEM (see recipe)
  • High‐titer (1 × 107 pfu) SV40 stock (e.g., ATCC or by request from Milavetz laboratory, ; the Milavetz laboratory stock (776) was originally obtained from Dr. Daniel Nathans)
  • 100 μM PCR primers for SV40 genome, e.g.:
  • 5′‐AAAATGAAGATGGTGGGGAGAAGAA‐3′
  • 5′‐GACTCGAGGTGAAATTTGTGATGCT‐3′
  • 2× amplification buffer (SsoAdvanced Universal SYBR Green Supermix, Bio‐Rad, 172‐5274)
  • Nuclease‐free water (Ambion, AM9937)
  • T 10E buffer (see recipe)
  • 1 U/μl DNase I and 10× buffer (New England Biolabs, M0303S)
  • Chromosome isolation buffer (see recipe) with 10% glycerol
  • Agarose (Sigma, A6877)
  • TAE electrophoresis running buffer (see recipe)
  • SDS sample buffer containing 50% glycerol
  • Ethidium bromide (0.5 μg/μl) or SYBR green
  • ChIP DNA Clean and Concentrator kit (Zymo Research, D5205)
  • SV40 DNA obtained by modified Hirt procedure (Hirt, ; see Support Protocol)
  • 100 mM EGTA
  • 1 M dithiothreitol (DTT)
  • 75‐cm2 T‐flasks (T‐75 flasks; Corning, 430720U)
  • Sterile water‐jacketed 37°C culture incubator
  • 10‐, 200‐, and 1000‐μl graduated filter tips
  • Real‐time PCR machine
  • 1.5‐ml snap‐cap microcentrifuge flex tubes (Fisher Scientific, 022364111)
  • Ultracentrifuge for small volumes (e.g., Beckman TLA‐100 with TLA‐100.3 rotor)
  • 37°C heat block
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Support Protocol 1: Preparation of SV40 DNA by the Hirt Procedure

  Materials
  • African green monkey kidney (AGMK) cells (ATCC, cat. no. CCL‐26), 70% confluent
  • Supplemented MEM (see recipe)
  • Working virus stock (see protocol 1, step 3)
  • Dulbecco's phosphate‐buffered saline (DPBS; Gibco, 14190‐250), 4°C
  • Lysing solution (see recipe)
  • 5 M NaCl
  • ChIP DNA Clean and Concentrator kit (Zymo Research, D5205)
  • T 10E buffer (see recipe)
  • 75‐cm2 T‐flasks (T‐75 flasks; Corning, 430720U)
  • Sterile water‐jacketed 37°C culture incubator
  • 15‐ml centrifuge tubes (Corning, 430052)
  • 200‐ and 1000‐μl graduated filter tips
  • 1.5‐ml snap‐cap microcentrifuge flex tubes (Fisher Scientific, 022364111)
  • Refrigerated microcentrifuge (e.g., Sorvall Biofuge Fresco)

Basic Protocol 2: Preparation of SV40 Minichromosomes from Lytically Infected Cells

  Materials
  • African green monkey kidney (AGMK) cells (ATCC, cat. no. CCL‐26), 70% confluent
  • Minimum essential medium (MEM; Gibco, 11095‐098), room temperature
  • Working virus stock (see protocol 1, step 3)
  • Chromosome preparation nucleus buffer (see recipe)
  • Dulbecco's phosphate‐buffered saline (DPBS; Gibco, 14190‐250), 4°C
  • 0.05% (v/v) Triton X‐100
  • Chromosome extraction buffer (see recipe)
  • Chromosome isolation buffer (see recipe) with 10% glycerol
  • 75‐cm2 T‐flasks (T‐75 flasks; Corning, 430720U)
  • Sterile water‐jacketed 37°C culture incubator
  • 15‐ml centrifuge tubes (Corning, 430052)
  • 1.5‐ml snap‐cap microcentrifuge flex tubes (Fisher Scientific, cat. no. 022364111)
  • 200‐ and 1000‐μl graduated filter tips
  • Disposable curved rubber cell scraper (Fisher, 08‐773‐2)
  • Refrigerated centrifuge (e.g., Beckman J6‐MI)
  • Refrigerated microcentrifuge (e.g., Sorvall Biofuge Fresco)
  • Ultracentrifuge for small volumes (e.g., Beckman TLA‐100 with TLA‐100.3 rotor)

Basic Protocol 3: Micrococcal Nuclease Digestion of SV40 DNA for Nucleosome Positioning

  Materials
  • SV40 chromatin (see Basic Protocols protocol 11 and protocol 32)
  • Micrococcal nuclease (New England Biolabs, cat. no. M0247S) with BSA and 10× digestion buffer
  • 50:50 (v/v) glycerol and T 10E buffer (optional; see recipe for T 10E buffer)
  • ChIP DNA Clean and Concentrator kit (Zymo Research, D5205), including DNA binding buffer
  • Nuclease‐free water (Ambion, AM9937)
  • 200‐μl thin‐walled PCR tubes (VWR, 20170‐012)
  • Thermocycler (e.g., Eppendorf MasterCycler Personal PCR)
  • Additional reagents and equipment for real‐time PCR (see protocol 1)

Basic Protocol 4: Chromosome Immunoprecipitation and Fragmentation of SV40 DNA for Histone Modifications and Protein Localization

  Materials
  • Antibody of interest (various sources, e.g., Millipore, Abcam)
  • ChIP Assay kit (Millipore, cat. no. 17‐295), including chromatin binding buffer, protein A–agarose, and lysing solution
  • SV40 chromatin (see Basic Protocols protocol 11 and protocol 32)
  • T 10E buffer (see recipe)
  • 100 mM EGTA (optional)
  • ChIP DNA Clean and Concentrator kit (Zymo Research, D5205)
  • Nuclease‐free water (Ambion, AM9937)
  • 1.5‐ml Eppendorf LoBind tubes (Fisher Scientific, 0030108116)
  • End‐over‐end rotator
  • Microcentrifuge (e.g., Southwest Science minicentrifuge)
  • Digital sonifier with water horn (e.g., Branson model 102C; optional)
  • Additional reagents and equipment for micrococcal nuclease digestion (optional; see protocol 4)

Basic Protocol 5: Preparation of SV40 Libraries for Illumina Sequencing

  Materials
  • SV40 chromatin, purified and fragmented (see protocol 4 or 4)
  • NEBNext Ultra II DNA Library Prep Kit for Illumina (New England Biolabs), including:
  • End repair enzymes and buffer
  • NEBNext Mulitplex Oligos for Illumina (New England Biolabs, cat. no. E7335S) including:
  • Adapter and dilution buffer
  • Ligation enhancer and ligase master mix
  • USER enzyme
  • Universal and index primers
  • AMPure XP PCR purification kit (Beckman Coulter, cat. no. A63880)
  • 80% (v/v) ethanol (Sigma‐Aldrich, 459844)
  • Nuclease‐free water (Ambion, AM9937)
  • 2× amplification buffer (SsoAdvanced Universal SYBR Green Supermix, Bio‐Rad, 172‐5274)
  • SDS sample buffer containing 50% glycerol
  • TAE electrophoresis running buffer (see recipe)
  • Certified molecular‐biology‐grade agarose (Bio‐Rad, 1613101)
  • Certified low‐melting‐temperature, molecular‐biology‐grade agarose (Bio‐Rad, 1613112)
  • 100‐bp DNA ladder (e.g., New England Biolabs, N3231S)
  • Zymoclean Gel DNA Recovery kit (Zymo Research, D400)
  • 200‐μl thin‐walled PCR tubes (VWR, 20170‐012)
  • 10‐, 200‐, and 1000‐μl graduated filter tips
  • Thermocycler with heated lid (e.g., Eppendorf MasterCycler Personal PCR)
  • 1.5‐ml snap‐cap microcentrifuge flex tubes (Fisher Scientific, 022264111)
  • Magnetic stand
  • Gel imaging system (e.g., EmbiTec PrepOne Sapphire)
  • Metal spatula
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and next‐generation sequencing
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Allan, J., Fraser, R. M., Owen‐Hughes, T., & Keszenman‐Pereyra, D. (2012). Micrococcal nuclease does not substantially bias nucleosome mapping. Journal of Molecular Biology, 417, 152–164. doi: 10.1016/j.jmb.2012.01.043.
  Balakrishnan, L., Gefroh, A., & Milavetz, B. (2010). Histone H4 lysine 20 mono‐ and tri‐methylation define distinct biological processes in SV40 minichromosomes. Cell Cycle, 9, 1320–1332. doi: 10.4161/cc.9.7.11123.
  Balakrishnan, L., & Milavetz, B. (2005). Programmed remodeling of hyperacetylated histone H4 and H3 organization on the SV40 genome during lytic infection. Virology, 334, 111–123. doi: 10.1016/j.virol.2005.01.025.
  Balakrishnan, L., & Milavetz, B. (2006). Reorganization of RNA polymerase II on the SV40 genome occurs coordinately with the early to late transcriptional switch. Virology, 345, 31–43. doi: 10.1016/j.virol.2005.09.039.
  Balakrishnan, L., & Milavetz, B. (2007a). Histone hyperacetylation during SV40 transcription is regulated by p300 and RNA polymerase II translocation. Journal of Molecular Biology, 371, 1022–1037. doi: 10.1016/j.jmb.2007.06.080.
  Balakrishnan, L., & Milavetz, B. (2007b). Histone hyperacetylation in the coding region of chromatin undergoing transcription in SV40 minichromosomes is a dynamic process regulated directly by the presence of RNA polymerase II. Journal of Molecular Biology, 365, 18–30. doi: 10.1016/j.jmb.2006.09.044.
  Balakrishnan, L., & Milavetz, B. (2008). HDAC inhibitors stimulate viral transcription by multiple mechanisms. Virology Journal, 5, 43. doi: 10.1186/1743‐422X‐5‐43.
  Balakrishnan, L., & Milavetz, B. (2009). Dual agarose magnetic (DAM) ChIP. BMC Research Notes, 2, 250. doi: 10.1186/1756‐0500‐2‐250.
  Brady, J. N., Winston, V. D., & Consigli, R. A. (1977). Dissociation of polyoma virus by the chelation of calcium ions found associated with purified virions. Journal of Virology, 3, 717–724.
  Burnett, L. C., Lunn, G., & Coico, R. (2009). Biosafety: Guidelines for working with pathogenic and infectious microorganisms. Current Protocols in Microbiology, 13, 1A.1.1–1A.1.14. doi: 10.1002/9780471729259.mc01a01s13.
  Cereghini, S., & Yaniv, M. (1984). Assembly of transfected DNA into chromatin: Structural changes in the origin‐promoter‐enhancer region upon replication. EMBO Journal, 3, 1243–1253.
  Chen, K., Xi, Y., Pan, X., Li, Z., Kaestner, K., Tyler, J., … Li, W.D. (2013). ANPOS: Dynamic analysis of nucleosome position and occupancy by sequencing. Genome Research, 23, 341–351. doi: 10.1101/gr.142067.112.
  Chung, H. R., Dunkel, I., Heise, F., Linke, C., Krobitsch, S., Ehrenhofer‐Murray, A. E., … Vingron, M. (2010). The effect of micrococcal nuclease digestion on nucleosome positioning data. PLoS One, 5, e15754. doi: 10.1371/journal.pone.0015754.
  Coca‐Prados, M., & Hsu, M. T. (1979). Intracellular forms of simian virus 40 nucleoprotein complexes. II. Biochemical and electron microscopic analysis of simian virus 40 virion assembly. Journal of Virology, 31, 199–208.
  Garber, E. A., Seidman, M. M., & Levine, A. J. (1980). Intracellular SV40 nucleoprotein complexes: Synthesis to encapsidation. Virology, 107, 389–401. doi: 10.1016/0042‐6822(80)90306‐2.
  Green, M. H., Miller, H. I., & Hendler, S. (1971). Isolation of a polyoma‐nucleoprotein complex from infected mouse‐cell cultures. Proceedings of the National Academy of Sciences of the USA, 68, 1032–1036. doi: 10.1073/pnas.68.5.1032.
  Gross, L. (1953). A filterable agent, recovered from Ak leukemic extracts, causing salivary gland carcinomas in C3H mice. Proceedings of the Society for Experimental Biology and Medicine, 83, 414–421. doi: 10.3181/00379727‐83‐20376.
  Hebbes, T. R., Thorne, A. W., & Crane‐Robinson, C. (1988). A direct link between core histone acetylation and transcriptionally active chromatin. EMBO Journal, 7, 1395–1402.
  Hirt, B. (1967). Selective extraction of polyoma DNA from infected mouse cell cultures. Journal of Molecular Biology, 26, 365–369. doi: 10.1016/0022‐2836(67)90307‐5.
  Kallestad, L., Christensen, K., Woods, E., & Milavetz, B. (2014). Transcriptional repression is epigenetically marked by H3K9 methylation during SV40 replication. Clinical Epigenetics, 6, 21. doi: 10.1186/1868‐7083‐6‐21.
  Kallestad, L., Woods, E., Christensen, K., Gefroh, A., Balakrishnan, L., & Milavetz, B. (2013). Transcription and replication result in distinct epigenetic marks following repression of early gene expression. Frontiers in Genetics, 4, 140. doi: 10.3389/fgene.2013.00140.
  Kube, D., & Milavetz, B. (1996). Differential regulation by SV40 T‐antigen binding at site I defines two distinct classes of nucleosome‐free promoter. Anatomical Record, 244, 28–32. doi: 10.1002/(SICI)1097‐0185(199601)244:1%3c28::AID‐AR3%3e3.0.CO;2‐B.
  Kumar, M. A., Christensen, K., Woods, B., Dettlaff, A., Perley, D., Scheidegger, A., … Milavetz, B. (2017). Nucleosome positioning in the regulatory region of SV40 chromatin correlates with the activation and repression of early and late transcription during infection. Virology, 503, 62–69. doi: 10.1016/j.virol.2016.12.023.
  Kuo, M. H., & Allis, C. D. (1999). In vivo cross‐linking and immunoprecipitation for studying dynamic Protein: DNA associations in a chromatin environment. Methods, 19, 425–433. doi: 10.1006/meth.1999.0879.
  Langmead, B., Trapnell, C., Pop, M., & Salzberg, S. L. (2009). Ultrafast and memory‐efficient alignment of short DNA sequences to the human genome. Genome Biology, 10, R25. doi: 10.1186/gb‐2009‐10‐3‐r25.
  Maxam, A. M., & Gilbert, W. (1977). A new method for sequencing DNA. Proceedings of the National Academy of Sciences of the USA, 74, 560–564. doi: 10.1073/pnas.74.2.560.
  Mensaert, K., Denil, S., Trooskens, G., Van Criekinge, W., Thas, O., & De Meyer, T. (2014). Next‐generation technologies and data analytical approaches for epigenomics. Environmental and Molecular Mutagenesis, 55, 155–170. doi: 10.1002/em.21841.
  Meyer, C. A., & Liu, X. S. (2014). Identifying and mitigating bias in next‐generation sequencing methods for chromatin biology. Nature Reviews Genetics, 15, 709–721. doi: 10.1038/nrg3788.
  Milavetz, B. (2004). Hyperacetylation and differential deacetylation of histones H4 and H3 define two distinct classes of acetylated SV40 chromosomes early in infection. Virology, 319, 324–336. doi: 10.1016/j.virol.2003.11.010.
  Milavetz, B., Kallestad, L., Gefroh, A., Adams, N., Woods, E., & Balakrishnan, L. (2012). Virion‐mediated transfer of SV40 epigenetic information. Epigenetics, 7, 528–534. doi: 10.4161/epi.20057.
  Noll, M., & Kornberg, R. D. (1977). Action of micrococcal nuclease on chromatin and the location of histone H1. Journal of Molecular Biology, 109, 393–404. doi: 10.1016/S0022‐2836(77)80019‐3.
  Sanger, F., Nicklen, S., & Coulson, A. R. (1977). DNA sequencing with chain‐terminating inhibitors. Proceedings of the National Academy of Sciences of the USA, 74, 5463–5467. doi: 10.1073/pnas.74.12.5463.
  Stehle, T., Gamblin, S. J., Yan, Y., & Harrison, S. C. (1996). The structure of simian virus 40 refined at 3.1 A resolution. Structure, 4, 165–182. doi: 10.1016/S0969‐2126(96)00020‐2.
  Sweet, B. H., & Hilleman, M. R. (1960). The vacuolating virus, S.V. 40. Proceedings of the Society for Experimental Biology and Medicine, 105, 420–427. doi: 10.3181/00379727‐105‐26128.
  Tooze, J., & Acheson, N. H. (1981). DNA tumor viruses. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press.
  Tsubota, Y., Waqar, M. A., Burke, J. F., Milavetz, B. I., Evans, M. J., Kowalski, D., & Huberman, J. A. (1979). Association of enzymes with replicating and nonreplicating simian virus 40 chromosomes. Cold Spring Harbor Symposia on Quantitative Biology, 43, 693–704. doi: 10.1101/SQB.1979.043.01.077.
  Voytas, D. (2000). Agarose gel electrophoresis. Current Protocols in Molecular Biology, 51, 2.5A.1–2.5A.9. doi: 10.1002/0471142727.mb0205as51.
  Walter, G., & Deppert, W. (1975). Intermolecular disulfide bonds: An important structural feature of the polyoma virus capsid. Cold Spring Harbor Symposia on Quantitative Biology, 39, 255–257.
  White, M., & Eason, R. (1971). Nucleoprotein complexes in simian virus 40‐infected cells. Journal of Virology, 8, 363–371.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library