Separation and Isolation of BTV dsRNA Segments and Viral Proteins

Joseph K.‐K. Li1, I‐Jen Huang2, Emiko Hayama3

1 Department of Biology, Utah State University, Logan, Utah, 2 Taiwan Sugar Research Institute, Taiwan, China, 3 Department of Pediatric Cardiology, Tokyo Women's Medical University, Tokyo, Japan
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15C.5
DOI:  10.1002/9780471729259.mc15c05s25
Online Posting Date:  May, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Bluetongue virus (BTV) genome contains ten double‐stranded RNA segments. The sequence of the plus strand of each of the BTV genomic double‐stranded RNAs is the same as that of its mRNA, which encodes for a single viral protein, except the smallest S4 segment which can encode for two nonstructural proteins, primarily for the release assistance of the viral progeny. The separation and isolation of each BTV dsRNA segment and viral protein have provided extensive data related to its viral infection, pathology, suppression of host cellular functions, and eventual apoptosis of the infected host cells. This cytoplasmic virus is also an animal killer that costs the U.S. livestock industry at least $125 million yearly. However, this virus has no known effect on humans. Thus, it is very safe to carry out investigation with the virus, preferably in a BSL‐2 laboratory. Curr. Protoc. Microbiol. 25:15C.5.1‐15C.5.22. © 2012 by John Wiley & Sons, Inc.

Keywords: Bluetongue virus; BTV protein separation; ds‐RNA genome isolation; viral guanylyltransferase

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Rapid Selective Separation of BTV Viral Proteins and Double‐Stranded RNAs
  • Basic Protocol 2: Gel Electrophoresis of BTV Proteins
  • Support Protocol 1: Concentration and Desalting of Viral Proteins by Precipitation with Trichloroacetic Acid
  • Support Protocol 2: Desalting Viral Proteins by Spin Column Centrifugation
  • Basic Protocol 3: Baculovirus Expression and Purification of the Bluetongue Virus Guanylyltransferase
  • Alternate Protocol 1: E. coli Expression and Purification of the Bluetongue Virus Guanylyltransferase
  • Support Protocol 3: Purification of 6×His‐VP4 from E. coli
  • Support Protocol 4: Purification of Expressed Insoluble and Soluble VP4 Protein
  • Basic Protocol 4: Isolation of BTV dsRNA Segments from Infected Host Cells
  • Basic Protocol 5: Separation of BTV DS‐Stranded RNA Segments Using 2% NuSieve Agarose Gel Electrophoresis
  • Alternate Protocol 2: Separation of BTV Double‐Stranded RNA Segments using SDS‐PAGE
  • Basic Protocol 6: Purification of Individual BTV dsRNA Segments from Preparative Polyacrylamide Slab Gels
  • Basic Protocol 7: Rapid Production of Multiple Alkaline Northern Blots of BTV Viral dsRNA from a Single Polyacrylamide Gel
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Rapid Selective Separation of BTV Viral Proteins and Double‐Stranded RNAs

 Materials
  • BTV viral pellet (Basic Protocol 7 in unit 15C.4)
  • 0.2 M Tris⋅Cl, pH 8.0 (Sigma; also see appendix 2A)
  • Protein Assay Kit I (BioRad, cat. no. 500‐0001)
  • 5% to 10 % sodium dodecyl sulfate (SDS; see recipe)
  • 0.25 to 0.5 M KCl (Sigma)
  • 25:24:1 phenol/chloroform/isoamyl alcohol (appendix 2A)
  • 3 M sodium acetate, pH 5.2
  • Ethanol (ThermoFisher)
  • RNA stabilizer (Biomatrica, cat no. 93221‐001; http://www.biomatrica.com/)
  • DEPC‐treated H2O (appendix 2A), sterile
  • Phosphate‐buffered saline (PBS), pH 7.4 (Thermo Fisher Scientific; also see appendix 2A)
  • 100°C water bath
  • Biofuge‐12 microcentrifuge (Heraeus Instruments or Baxter Scientific)
  • Whatman 3MM filter paper
  • NanoDrop spectrophotometer (Model ND‐1000; Thermo Scientific)
  • Vacuum desiccator or SpeedVac evaporator

Basic Protocol 2: Gel Electrophoresis of BTV Proteins

 Materials
  • BTV viral pellets (Basic Protocol 1), purified virions, or infected cell lysates
  • 2× SDS sample buffer for Basic Protocol 2 (see recipe)
  • Silver staining kit (BioRad)
  • Additional reagents and equipment for SDS‐PAGE including gel staining (appendix 3M) and desalting protein samples (Support Protocols 1 and 2)

Support Protocol 1: Concentration and Desalting of Viral Proteins by Precipitation with Trichloroacetic Acid

 Materials
  • Trichloroacetic acid (TCA; Sigma or Mallinckrodt)
  • BTV viral pellets (Basic Protocol 1), purified virions, or infected cell lysates)
  • Acetone, cold
  • 2× SDS sample buffer (see recipe)
  • Biofuge‐12 microcentrifuge (Heraeus Instruments or Baxter Scientific)
  • Whatman 3MM filter paper

Support Protocol 2: Desalting Viral Proteins by Spin Column Centrifugation

 Materials
  • BTV viral pellets, purified virions, or infected cell lysates (see Basic Protocol 1 or unit 15C.4)
  • 2× SDS sample buffer (BioRad)
  • Nanosep 3K mini spin columns (Pall; cat no. 0D003C33)
  • Biofuge‐12 microcentrifuge (Heraeus Instruments or Baxter Scientific)

Basic Protocol 3: Baculovirus Expression and Purification of the Bluetongue Virus Guanylyltransferase

 Materials
  • Total BTV dsRNA (Basic Protocol 1)
  • M1 Primers with Pst‐1 sites:
    • 5′‐ AGTCGACCTGCAGGTTAAAACATGCCTGAG‐ 3′
    • 5′‐ AGTCGACCTGCAGGTAAGTTGTACATGCCC‐ 3′
  • 10× RT‐PCR buffer (see recipe)
  • 10 mM dNTP mix (appendix 2A)
  • Avian myeloblastosis virus reverse transcriptase (AMV‐RT)
  • Taq DNA polymerase
  • Mineral oil
  • Restriction enzymes (New England BioLab)
    • PstI
    • BamHI
  • Baculovirus expression vector pVL1392 (Invitrogen)
  • E. coli M15 (pREP4, Qiagen)
  • QIAprep Miniprep kit (Qiagen)
  • SF9 insect cells (PharMingen)
  • Linear baculoviral DNA (Baculogold from PharMingen)
  • STE buffer (see recipe)
  • Phosphate‐buffered saline (PBS, Thermo Fisher Scientific; also see appendix 2A)
  • Thermal cycler
  • Beckman GPR Centrifuge (Beckman Coulter)
  • Sonicator (VirSonic)
  • Additional reagents and equipment for purification of BTV dsRNA segments from slab gels (Schuerch et al., 1975, and Basic Protocol 6), RT‐PCR amplification (Beverly, 2001), agarose gel electrophoresis (Voytas, 2000), DNA sequencing (Shendure et al., 2011), phenol‐chloroform extraction and ethanol precipitation of DNA (Basic Protocol 1, step 8), generation of the recombinant plasmid, pVL1392BTV13M1, with the baculovirus expression vector pVL1392 and the PstI‐digested PCR product (Seidman et al., 2001), infection of insect cells (Murphy et al., 2004) to obtain VP4 production, SDS‐PAGE (appendix 3M), and immunodetection by immunoblotting (Gallagher et al., 2008)

Alternate Protocol 1: E. coli Expression and Purification of the Bluetongue Virus Guanylyltransferase

 Additional Materials (also see Basic Protocol 3)
  • Total BTV dsRNA (Basic Protocol 1)
  • M1 primers with SmaI sites:
    • 5′‐GACGTCGACCCGGGGATGCCTGAGCCA‐3′
    • 5′‐GACGTCGACCCGGGTAAGTTGTACAT‐3′
  • Restriction enzyme SmaI (New England BioLabs)
  • pQE30 (Qiagen)
  • E. coli M15 (pREP4, Qiagen)
  • 2 mM isopropyl β‐d‐thiogalactopyranoside (IPTG, BioRad)
  • LB medium (appendix 4A)
  • QIAprep Miniprep Kit (Qiagen)
  • Anti‐VP4 serum (available as a courtesy from Dr. Li's lab; joseph.li@usu.edu)
  • Additional reagents and equipment for purification of BTV dsRNA segments for preparative polyacrylamide gel segments (Schuerch et al., 1975, and Basic Protocol 6), RT‐PCR amplification (Beverly, 2001), agarose gel electrophoresis (Voytas, 2000), DNA sequencing (Shendure et al., 2011), purification of 6× His‐VP4 from E. coli (Support Protocol 3), SDS‐PAGE (appendix 3M), and immunodetection by immunoblotting (Gallagher et al., 2008)

Support Protocol 3: Purification of 6×His‐VP4 from E. coli

 Materials
  • Insoluble fraction containing 6×H‐VP4 (Basic Protocol 3)
  • Dissolving buffer (see recipe)
  • Talon metal affinity resin (Clontech, cat. no. 635502)
  • His 60 Ni Superflow resin cartridges (Clontech, cat. no. 635674 for 1 ml and 635678 for 5 ml)
  • 6×His elution buffer (see recipe)
  • 5 or 10‐ml Quik‐Snap plastic column with a pre‐packed bottom disc (Isolab, cat. no. QS‐NP; http://www.isolabgmbh.com/)
  • 5‐ or 10‐ml sterile glass or plastic syringe (Becton Dickinson)
  • Additional reagents and equipment for SDS‐PAGE (appendix 3M) and immunodetection by immunoblotting (Gallagher et al., 2008)

Support Protocol 4: Purification of Expressed Insoluble and Soluble VP4 Protein

 Materials
  • Lysate of insect (Basic Protocol 3) or E. coli cells (Alternate Protocol 1) expressing BTV V4 proteins
  • Solubilization solution for baculovirus expression system (see recipe)
  • 6 M guanidine‐HCl (Sigma)
  • STE Buffer (see recipe)
  • N‐lauroyl sarcosine (Sigma)
  • Reduced glutathione (Sigma)
  • Triton X‐100 (BioRad)
  • Sephadex G‐200 column (Pharmacia)
  • 5 to 50% discontinuous sucrose gradient in STE with a cushion of 66% sucrose (w/w)
  • 12,000‐MWCO dialysis tubing (Fisher, cat. no. 8‐667A)
  • Beckman L8‐70 ultracentrifuge (Beckman)
  • SW41 rotor and 12‐ml ultracentrifuge tubes (Beckman, cat no. 331220)

Basic Protocol 4: Isolation of BTV dsRNA Segments from Infected Host Cells

 Materials
  • BTV‐infected cells infected at different time points (unit 15C.4)
  • NTE buffer (see recipe)
  • 10% (v/v) Nonidet P‐40 (NP‐40) stock solution (Sigma or USB)
  • 10% (w/v) sodium deoxycholate (Sigma)
  • 5% (w/v) SDS (BioRad)
  • Phenol:chloroform (1:1, ThermoFisher or EM Sciences)
  • Chloroform:isoamyl alcohol (24:1, EM Sciences or ThermoFisher)
  • Ethanol (ThermoFisher)
  • Sterile DEPC‐treated distilled H2O (appendix 2A)
  • 4 M LiCl (Sigma)
  • Poly(T) resin or poly(T) mini‐column (Sigma)
  • Glycogen (Sigma)
  • NTE buffer (see recipe) containing 15% (v/v) ethanol
  • CF‐11 resin (Whatman)
  • TE buffer, pH 8.0 (appendix 2A)
  • Beckman Allegra‐6R or GPR Centrifuge (Beckman Coulter)
  • Sonicator (VirSonic 50, Virtis)
  • Sterile Kimwipes or Whatman 3MM paper (Whatman)
  • 5‐ or 10‐ml glass or plastic syringe (Becton Dickinson)

Basic Protocol 5: Separation of BTV DS‐Stranded RNA Segments Using 2% NuSieve Agarose Gel Electrophoresis

 Materials
  • 2% NuSieve agarose (FMC Bioproducts)
  • TBE buffer (appendix 2A)
  • Ethidium bromide (Sigma)
  • 2× loading buffer (BioRad)
  • Horizontal Canalco HSG Chamber (Miles Laboratories)
  • Power supply (Model 2000/200, BioRad)
  • Circulating pump (Geneline Cooler, Beckman)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, 2000)

Alternate Protocol 2: Separation of BTV Double‐Stranded RNA Segments using SDS‐PAGE

 Materials
  • Acrylamide (BioRad)
  • Bisacrylamide (BioRad)
  • Sodium dodecyl sulfate (SDS, BioRad)
  • N,N,N′,N′‐tetramethylediamine (TEMED, Eastman, http://www.eastman.com/)
  • Urea (Mallinckrodt)
  • 0.04% (w/v) ammonium persulfate (Sigma)
  • Loening E Buffer (BioRad)
  • BTV dsRNA sample (Basic Protocol 1)
  • 2× loading buffer (BioRad)
  • 0.5% ethidium bromide (Sigma)
  • BioRad vertical electrophoresis unit (BioRad)
  • Flat‐bottom gel comb
  • Power supply (Model 2000/200, BioRad)
  • Circulating pump (Geneline Cooler, Beckman)
  • Gyrotwister (Labnet)
  • Mineralight Lamp (Model UVS‐11; Ultra‐violet Products Inc.) or UV lamp (BioRad)
  • Additional reagents and equipment for polyacrylamide gel electrophoresis (appendix 3M)

Basic Protocol 6: Purification of Individual BTV dsRNA Segments from Preparative Polyacrylamide Slab Gels

 Materials
  • Acrylamide (BioRad)
  • Bisacrylamide (BioRad)
  • Sodium dodecyl sulfate (SDS, BioRad)
  • N,N,N′,N′‐tetramethylediamine (TEMED, Eastman, http://www.eastman.com/)
  • Urea (Mallinckrodt)
  • Loening E buffer (BioRad)
  • 0.04% ammonium persulfate
  • BTV dsRNA sample (Basic Protocol 1)
  • Sample buffer for Basic Protocol 6 (see recipe)
  • 0.01% (w/v) ethidium bromide
  • dsRNA elution buffer (see recipe)
  • Phenol (Mallinckrodt)
  • Chloroform–isoamyl alcohol (EM Science or Mallinckrodt)
  • Ethanol
  • Preparative slab gel apparatus (30 cm × 16 cm × 3‐5 mm, BioRad)
  • 70°C water bath
  • Eastman Chromagram sheets impregnated with fluorescent indicator (Eastman)
  • UV light (BioRad)
  • Gel Elutor (BioRad)
  • Mortar and pestle, sterile
  • Shaker
  • GF/C filters (0.2 to 0.4 µm, Gilman Sciences)
  • Additional reagents and equipment for polyacrylamide gel electrophoresis (appendix 3M)

Basic Protocol 7: Rapid Production of Multiple Alkaline Northern Blots of BTV Viral dsRNA from a Single Polyacrylamide Gel

 Materials
  • Viral dsRNA ((Alternate Protocol 3 or Basic Protocol 6)
  • 0.25 N HCl
  • 0.2 N NaOH
  • 20× SSC (appendix 2A)
  • Bio‐Trace nylon membrane for northern blots (Gelman Sciences, cat. no. 66481)
  • Electroblotting apparatus (BioRad Trans‐Blot Cell, cat. no. 170‐3930)
  • Pyrex dish (Fisher)
  • Gel agitator or gyrotwister (Labnet)
  • Whatman 3MM paper (Whatman)
  • Additional reagents and equipment for preparing a 7.5% SDS‐PAGE gel (Alternate Protocol 3) and SDS‐PAGE (appendix 3M)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •  FigureFigure 15C.5.1 Sodium dodecyl sulfatepolyacrylamide gel electrophoresis of viral proteins from virions of five highly‐purified US BTV serotypes (BTV 17, 13, 11, 10, and 2).
  •  FigureFigure 15C.5.2 Sodium dodecyl sulfatepolyacrylamide gel electrophoresis of the dsRNA segments of five Bluetongue virus serotypes with those from reovirus serotype 3. BTV serotypes are labeled across the top of the gel. Labels on the side of the gel mark the BTV dsRNA segments. 51, 52, and 53 denote segments S1, S2, and S3, respectively.

Videos

Literature Cited

Literature Cited
    Beverly, S.M. 2001. Enzymatic amplification of RNA by PCR (RT‐PCR). Curr. Protoc. Mol. Biol. 56:15.5.1‐15.5.6.
    Franklin, R.M. 1966. Purification and properties of the replicative intermediate of the RNA bacteriophage R17. Proc. Nat. Acad. Sci. U.S.A. 55:1504‐1511.
    Gallagher, S., Winston, S.E., Fuller, S.A. and Hurrell, J.G.R. 2008. Immunoblotting and immunodetection. Curr. Protoc. Mol. Biol. 83:10.8.1‐10.8.28.
    Han, Z.Y. and Harty, R.N. 2004 The NS3 protein of Bluetongue virus exhibits viroporin‐like property. J. Biol. Chem. 279:43092‐43097.
    Huang, I.‐J. and Li, J.K.‐K. 1997. Purification of the putative guanylyltransferase of bluetongue virus from both eukaryotic and prokaryotic expression system. Int. J. Bio‐Chromatogr. 3:143‐154.
    Huang, I.‐J. and Li, J.K.‐K. 2000. Bluetongue viruses and bluetongue diseases. Taiwan Sugar Res. Inst. Bull. 46:8‐13.
    Hwang, G.‐Y., Yang, Y.‐Y., Chiou, J.‐F., and Li, J.K.‐K. 1992. Sequence conservation among the cognate nonstructural Ns3/3A protein genes of six bluetongue viruses. Virus Res. 23:151‐161.
    Hwang, G.Y., Chiou, J.F., Yang, Y.Y., and Li, J.K.‐K. 1993. High‐sequence conservation among the United States bluetongue viruses cognate M2 genes which encode the nonstructural NS1 tubule protein. Virology 192:321‐327.
    Joklik, W.K. 1983. The Reoviridae. Plenum, New York.
    Kowalik, T.F., Yang, Y.‐Y., and Li, J.K.‐K. 1990. Molecular cloning and comparative sequence analyses of Bluetongue virus S1 segments by selective synthesis of specific full‐length DNA copies of ds‐RNA genes. Virology 177:820‐823.
    Li, J.K.‐K. 1987. Chromatographic purification and immunological analysis of viral polypeptides of mouse mammary tumor viruses. J. Virol. Methods 17:299‐310.
    Li, J.K.‐K. 2011. Oncolytic bluetongue viruses: Promise, progress and perspectives. Frontiers Microbiol. 2:1‐13.
    Li, J.K.‐K., Keene, J.D., Scheible, P.P., and Joklik, W.K. 1980. Nature of the 3′‐terminal sequences of the plus and minus strands of the S1 gene of reovirus serotypes 1, 2, and 3. Virology 105:41‐51.
    Li, J. K.‐K., Kowalik, T., and Parker, B. 1987. Rapid alkaline blot‐transfer of viral dsRNA. Anal. Biochem. 163:210‐218.
    Li, J.K‐K., Johnson, T., Yang, Y.Y., and Shore, V. 1989. Selective separation of virus proteins and double‐stranded RNAs by SDS‐KCl precipitation. J. Virol. Methods 26:3‐15.
    Mertens, P.P., Burroughs, J.N., and Anderson, J. 1987. Purification and properties of virus particles, infectious subviral particles, and cores of bluetongue virus serotypes 1 and 4. Virology 157:375‐386.
    Murphy, C.I., Piwnica‐Worms, H., Grünwald, S., Romanow, W.G., Francis, N. and Fan, H.‐Y. 2004. Maintenance of insect cell cultures and generation of recombinant baculoviruses. Curr. Protoc. Mol. Biol. 65:16.10.1‐16.10.19.
    Schuerch, A.R., Mitchell, W.R. and Joklik, W.K. 1975. Isolation of intact individual single‐ and double‐stranded RNA by polyacrylamide gel electrophoresis. Anal. Biochem. 65:33‐345.
    Seidman, C.E., Struhl, K., Sheen, J. and Jessen, T. 2001. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 37:1.8.1‐1.8.10.
    Shendure, J.A., Porreca, G.J., Church, G.M., Gardner, A.F., Hendrickson, C.L., Kieleczawa, J., and Slatko, B.E. 2011. Overview of DNA sequencing strategies. Curr. Protoc. Mol. Biol. 96:7.1.1‐7.1.23.
    Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
    Yang, Y.‐Y. and Li, J.K.‐K. 1993. Glycosylation of the major outer capsid protein of bluetongue virus. Virology 194:350‐354.
    Yang, Y.‐Y., Johnson, T.M., Mecham, J.O., Tam, J.P., and Li, J.K.‐K. 1992. Epitopic mapping of the immunodominant linear and conformation‐dependent antigenic determinants on the major outer capsid protein, GP5, of five US bluetongue viruses. Virology 188:530‐536.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library