Zika Virus: Quantification, Propagation, Detection, and Storage

Darrell S. Agbulos1, Larissa Barelli2, Bryan V. Giordano1, Fiona F. Hunter3

1 Centre for Biotechnology, Brock University, Ontario, 2 Entomogen Incorporated, Ontario, 3 Department of Biological Sciences, Brock University, Ontario
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15D.4
DOI:  10.1002/cpmc.19
Online Posting Date:  November, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Zika virus (ZIKV), belonging to the family Flaviviridae, genus Flavivirus, is an arthropod‐borne virus that was first discovered from the Zika forest in Uganda in 1947. Recent outbreaks in South America have linked ZIKV to cases of microcephaly and Guillain‐Barré syndrome in humans. With the increased interest in ZIKV, protocols must be established to facilitate proper research. Here we describe the laboratory techniques required to quantify, propagate, and store ZIVK. We also review the proper safety protocol for the handling of ZIKV, which is classified as a Biosafety Level 2 pathogen by the United States Centers for Disease Control and Prevention. © 2016 by John Wiley & Sons, Inc.

Keywords: Zika virus; infection; plaque assay; detection; Vero cells

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Quantification of Zika Virus by Plaque Assay
  • Basic Protocol 2: Generation and Purification of Zika Virus Stocks
  • Basic Protocol 3: Detection of Zika Virus by Real‐Time Reverse Transcription PCR
  • Support Protocol 1: Propagation of Vero E6 Cells
  • Support Protocol 2: Propagation of C6/36 Cells
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Quantification of Zika Virus by Plaque Assay

  Materials
  • Vero E6 cell line (ATCC #CRL‐1586; see protocol 4)
  • Vero E6 culture medium (see recipe)
  • Dulbecco's modified Eagle medium with 2% fetal bovine serum (DMEM/2% FBS; see recipe)
  • Dulbecco's phosphate‐buffered saline (DPBS; see recipe)
  • CMC/DMEM overlay (see recipe)
  • Samples to be assayed
  • Crystal violet solution (see recipe)
  • 6‐well tissue culture plates
  • Cell culture incubator set to 37°C and 5% CO 2
  • 37°C water bath
  • Camera, to photograph 6‐well plates

Basic Protocol 2: Generation and Purification of Zika Virus Stocks

  Materials
  • Vero E6 cell line (ATCC #CRL‐1586; see protocol 4)
  • Vero E6 culture medium (see recipe)
  • Optional: C6/36 cell line (ATCC #CRL‐1660; see protocol 5)
  • Optional: C6/C3 culture medium (see recipe)
  • DMEM/2% FBS (see recipe)
  • DPBS (see recipe)
  • Zika virus strain
  • Tris·Cl, NaCl, EDTA solution (TNE; see recipe)
  • TNE/25% glycerol (see recipe)
  • Cell culture incubator set to 37°C and 5% CO 2
  • 37°C water bath
  • 75‐cm2 tissue culture flasks (sizes vary with personal needs)
  • 10‐ml and 50‐ml conical tubes
  • Centrifuge
  • 2.0‐ml cryotubes with O‐ring
  • Optima XL‐100 K ultracentrifuge with SW 28 swinging bucket rotor
  • 5‐ml and 25‐ml serological pipets

Basic Protocol 3: Detection of Zika Virus by Real‐Time Reverse Transcription PCR

  Materials
  • Primers and probes:
    • Based on Zika virus strain MR 766 (GenBank #AY632535; Lanciotti et al., )
    • Zika 835 fwd: 5′‐TTGGTCATGATACTGCTGATTGC‐3′
    • Zika 911c rev: 5′‐CCTTCCACAAAGTCCCTATTGC‐3′
    • Zika 860 FAM probe: 5′‐CGGCATACAGCATCAGGTGCATAGGAG‐3′
    • Zika 1086 fwd: 5′‐CCGCTGCCCAACACAAG‐3′
    • Zika 1162c rev: 5′‐CCACTAACGTTCTTTTGCAGACAT‐3′
    • Zika 1107 FAM probe 5′‐AGCCTACCTTGACAAGCAGTCAGACACTCAA‐3′
  • iTaq Universal Probe One‐Step Master Mix (e.g., Bio Rad, cat. no. 1725131)
  • iTaq‐RT
  • Nuclease‐free water
  • MicroAmp Fast Optical 96‐Well Reaction Plate (e.g., ThermoFisher, cat. no. 4346907)
  • Vortex
  • Multichannel pipet
  • Optically transparent sealing film (e.g., ThermalSeal RT, Excel Scientific, cat. no. TSRT2100)
  • Real‐time PCR detection system

Support Protocol 1: Propagation of Vero E6 Cells

  Materials
  • Vero E6 cell line (ATCC #CRL‐1586)
  • DPBS (see recipe)
  • Vero E6 culture medium (see recipe)
  • 0.25% trypsin/EDTA (e.g., Invitrogen, cat. no. 25200‐072)
  • 75‐cm2 tissue culture‐treated flasks (sizes vary with personal needs)
  • Cell culture incubator set to 37°C and 5% CO 2
  • 37°C water bath
  • Centrifuge

Support Protocol 2: Propagation of C6/36 Cells

  Materials
  • C6/36 cell line (ATCC #CRL‐1660)
  • C6/36 culture medium (see recipe)
  • DPBS (see recipe)
  • 75‐cm2 tissue culture‐treated flasks (sizes vary with personal needs)
  • Cell culture incubator set to 28°C and 5% CO 2
  • 28°C water bath
  • Cell scraper (sizes vary with personal needs)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Akoua‐Koffi, C., Diarrassouba, S., Bénié, V.B., Ngbichi, J.M., Bozoua, T., and Bosson, A. 2001. Investigation surrounding a fatal case of yellow fever in Côte d'Ivoire in 1999. Bull. Soc. Pathol. Exot. 94:227‐230.
  Ammerman, N.C., Beier‐Sexton, M., and Azad, A.F. 2008. Growth and maintenance of vero cell lines. Curr. Protoc. Micro. 11:A.4E.1‐A.4E.7. doi: 10.1002/9780471729259.mca04es11.
  Atkinson, B., Hearn, P., Afrough, B., Lumley, S., Carter, D., Aarons, E.J., Simpson, A.J., Brooks, T.J., and Hewson, R. 2016. Detection of Zika virus in semen. Emerg. Infect. Dis. 22:940. doi: 10.3201/eid2205.160107.
  Brien, J.D., Lazear, H.M., and Diamond, M.S. 2013. Propagation, quantification, detection, and storage of West Nile virus. Curr. Protoc. Microbiol. 31:15D.3.1‐15D.3.18. doi: 10.1002/9780471729259.mc15d03s31.
  Caraguel, C.G.B, Stryhn, H., Gagné, N., Dohoo, I.R., and Hammell, L. 2011. Selection of a cutoff value for real‐time polymerase chain reaction results to fit a diagnostic purpose: Analytical and epidemiologic approaches. J. Vet. Diagn. Invest. 23:2‐15. doi: 10.1177/104063871102300102.
  Dick, G.W.A. 1952. Zika virus (II). Pathogenicity and physical properties. Trans. R. Soc. Trop. Med. Hyg. 46:521‐534. doi: 10.1016/0035‐9203(52)90043‐6.
  Dick, G.W.A., Kitchen, S.F., and Haddow, A.J. 1952. Zika virus (I). Isolations and serological specificity. Trans. R. Soc. Trop. Med. Hyg. 46:509‐520. doi: 10.1016/0035‐9203(52)90042‐4.
  Duffy, M.R., Chen, T.H., Hancock, W.T., Powers, A.M., Kool, J.L., Lanciotti, R.S., Pretrick, M., Marfel, M., Holzbauer, S., Dubray, C., Guillaumot, L., Griggs, A., Bel, M., Lambert, A.J., Laven, J., Kosoy, O., Panella, A., Biggerstaff, B.J., Fischer, M., and Hayes, E.B. 2009. Zika virus outbreak on Yap Island, Federated States of Micronesia. N. Engl. J. Med. 360:2536‐2543. doi: 10.1056/NEJMoa0805715.
  Fagbami, A.H. 1979. Zika virus infections in Nigeria: Virological and seroepidemiological investigations in Oyo State. J. Hyg. 83:213‐219. doi: 10.1017/S0022172400025997.
  Foy, B.D., Kobylinski, K.C., Chilson Foy, J.L., Blitvich, B.J., Travassos da Rosa, A., Haddow, A.D., Lanciotti, R.S., and Tesh, R.B. 2011. Probable non‐vector‐borne transmission of Zika virus, Colorado, USA. Emerg. Infect. Dis. 17:880‐882. doi: 10.3201/eid1705.101939.
  Kuno, G. and Chang, G.J. 2007. Full‐length sequencing and genomic characterization of Bagaza, Kedougou, and Zika viruses. Arch. Virol. 152:687‐696. doi: 10.1007/s00705‐006‐0903‐z.
  Lanciotti, R.S., Kosoy, O.L., Laven, J.J., Velez, J.O., Lambert, A.J., Johnson, A.J., Stanfield, S.M., and Duffy, M.R. 2008. Genetic and serologic properties of Zika virus associated with an epidemic, Yap State, Micronesia, 2007. Emerg. Infect. Dis. 14:1232‐1239. doi: 10.3201/http://www.sigmaaldrich.com/life‐science/custom‐oligos.htmleid1408.080287.
  Mansuy, J.M., Dutertre, M., Mengelle, C., Fourcade, C., Marchou, B., Delobel, P., Izopet, J., and Martin‐Blondel, G. 2016. Zika virus: High infectious viral load in semen, a new sexually transmitted pathogen? Lancet Infect. Dis. 16:405. doi: 10.1016/S1473‐3099(16)00138‐9.
  Marchette, N.J., Garcia, R., and Rudnick, A. 1969. Isolation of Zika virus from Aedes aegypti mosquitoes in Malaysia. Am. J. Trop. Med. Hyg. 18:411‐415.
  McCrae, A.W. and Kirya, B.G. 1982. Yellow fever and Zika virus epizootics and enzootics in Uganda. Trans. R. Soc. Trop. Med. Hyg. 76:552‐562. doi: 10.1016/0035‐9203(82)90161‐4.
  Medina, F., Medina, J.F., Colón, C., Vergne, E., Santiago, G.A., and Mũnoz‐Jordán, J.L. 2012. Dengue virus: Isolation, propagation, quantification, and storage. Curr. Protoc. Microbiol. 27:15D.2.1‐15D.2.24. doi: 10.1002/9780471729259.mc15d02s27.
  Musso, D., Roche, C., Robin, E., Nhan, T., Teissier, A., and Cao‐Lormeau, V. 2015. Potential sexual transmission of Zika virus. Emerg. Infect. Dis. 21:359‐361. doi: 10.3201/eid2102.141363.
  Oster, A.M., Russell, K., Stryker, J.E., Friedman, A., Kachur, R.E, Peterson, E.E., Jamieson, D.J., Cohn, A.C., and Brooks, J.T. 2016. Update: Interim guidance for prevention of sexual transmission of Zika virus—United States, 2016. MMWR Morb. Mortal. Wkly. Rep. 65:323‐325. doi: 10.15585/mmwr.mm6512e3.
  Smithburn, K.C. 1952. Neutralizing antibodies against certain recently isolated viruses in the sera of human beings residing in East Africa. J. Immunol. 69:223‐234.
  World Health Organization [WHO]. 2016. Zika virus fact sheet. Accessed on 4/5/2016. http://www.who.int/mediacentre/factsheets/zika/en/.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library