Coronaviruses: Propagation, Quantification, Storage, and Construction of Recombinant Mouse Hepatitis Virus

Julian Leibowitz1, Gili Kaufman1, Pinghua Liu1

1 Texas A&M College of Medicine, College Station, Texas
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15E.1
DOI:  10.1002/9780471729259.mc15e01s21
Online Posting Date:  May, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The focus of this protocol is mouse hepatitis virus (MHV), with occasional references to other coronaviruses. Many of these protocols can be easily adapted to other coronaviruses. Protocols for propagating MHV in DBT and 17CL‐1 cells; the storage and titration of viral stocks; purification of MHV on sucrose gradients; and the generation of recombinant viruses by a cDNA assembly method and by targeted recombination will be presented. Protocols are also included for the propagation of DBT, 17CL‐1, and L2 cells used for growing and titrating MHV, and for the growth of BHK‐R cells and FCWF cells. The latter two cell lines are used for regenerating infectious MHV by an in vitro cDNA assembly protocol and by a targeted recombination protocol, respectively, allowing reverse genetic manipulation of these viruses. An additional protocol for the maintenance of the large plasmids used for generating recombinant MHVs will also be presented. Curr. Protoc. Microbiol. 21:15E.1.1‐15E.1.46. © 2011 by John Wiley & Sons, Inc.

Keywords: coronavirus; reverse genetics; plaque assay; virus purification; targeted recombination; mouse hepatitis virus

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Plaque Assay to Determine Viral Infectivity
  • Alternate Protocol 1: Endpoint Dilution Assay to Determine Viral Infectivity
  • Support Protocol 1: Preparation of Monolayer Cultures of DBT, 17CL‐1, L2, BHK‐R, and FCWF Cells
  • Support Protocol 2: Freezing of DBT, 17CL‐1, L2, BHK‐R, and FCWF Cells
  • Support Protocol 3: Thawing Frozen DBT, 17CL‐1, L2, BHK‐R, and FCWF Cells
  • Basic Protocol 2: Growth and Characterization of MHV Stock Virus
  • Support Protocol 4: Characterization of MHV Stock Virus
  • Basic Protocol 3: Purification of MHV by Equilibrium Ultracentrifugation Through Sucrose Gradients
  • Alternate Protocol 2: Purification of MHV by Velocity and Equilibrium Ultracentrifugation Through Potassium Tartrate Gradients
  • Basic Protocol 4: Generation of Recombinant MHV from cDNA
  • Support Protocol 5: Plasmid Propagation and Maintenance
  • Basic Protocol 5: Generation of Recombinant Viruses by Targeted Recombination
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Plaque Assay to Determine Viral Infectivity

  Materials
  • L2 cells (not commercially available; cells can be obtained from most investigators working with MHV, including the authors)
  • DME10 (see recipe)
  • MHV stock to be titered ( protocol 6)
  • DME2 (see recipe)
  • DME0 (see recipe)
  • 1.6% agarose (see recipe)
  • 2× DME2 (see recipe)
  • 0.1% (w/v) crystal violet in 70% ethanol
  • 6‐well tissue culture plates
  • 37°C, 3% CO 2 incubator
  • Sterile tubes with caps, 1.5 to 5 ml in size, for serial dilutions of virus
  • Platform rocker

Alternate Protocol 1: Endpoint Dilution Assay to Determine Viral Infectivity

  • 96‐well tissue culture plates
  • Inverted phase‐contrast microscope

Support Protocol 1: Preparation of Monolayer Cultures of DBT, 17CL‐1, L2, BHK‐R, and FCWF Cells

  Materials
  • Felis catus whole fetus (FCWF) cells growing in culture (ATCC, cat. no. CRL‐2787)
  • L2 cells (not commercially available; cells can be obtained from most investigators working with MHV, including the authors)
  • DBT cells (not commercially available; cells can be obtained from most investigators working with MHV, including the authors)
  • 17CL‐1 cells (not commercially available; cells can be obtained from most investigators working with MHV, including the authors)
  • BHK‐R cells (not commercially available; cells can be obtained from Dr. Kathryn Holmes, University of Colorado Medical School; )
  • DME0 (see recipe)
  • DME10 (see recipe)
  • DME10 (see recipe) supplemented with 800 µg/ml G418 (for BHK‐R cells)
  • DME10/FBS (for FCWF cells; see recipe for DME10 but use FBS where calf serum is called for)
  • Trypsin/EDTA solution (see recipe)
  • Inverted tissue culture microscope
  • 25‐ and 75‐cm2 tissue culture flasks with filter caps
  • 15‐ and 50‐ml conical polypropylene tubes with screw cap
  • Additional reagents and equipment for counting cells using a hemacytometer ( appendix 4A)
NOTE: All culture incubations should be performed in a humidified 37°C, 5% CO 2 incubator unless otherwise specified. L2 cells should be incubated in 3% CO 2.NOTE: All cell cultures are cultured in DME10 except for FCWF cells, which are cultured in DME10 prepared with 10% fetal bovine serum in place of the usual calf serum.

Support Protocol 2: Freezing of DBT, 17CL‐1, L2, BHK‐R, and FCWF Cells

  Materials
  • 75‐cm2 flask with 80% to 90% confluent cells ( protocol 3)
  • DME0 (see recipe)
  • 10% DMSO/20% serum
  • Isopropanol
  • Liquid N 2
  • Tabletop centrifuge (e.g., IEC Clinical)
  • Cryogenic tubes
  • Cryo 1°C “Mr. Frosty” Freezing Container (Nalgene)
  • Liquid N 2 freezer
  • Additional reagents and equipment for culturing and trypsinizing cells ( protocol 3)

Support Protocol 3: Thawing Frozen DBT, 17CL‐1, L2, BHK‐R, and FCWF Cells

  Materials
  • Vial of frozen cells ( protocol 4)
  • DME10 (see recipe)
  • 15‐ml conical centrifuge tube (e.g., BD Falcon)
  • Tabletop centrifuge (e.g., IEC Clinical)
  • 2‐ml disposable pipets
  • 75‐cm2 tissue culture flasks

Basic Protocol 2: Growth and Characterization of MHV Stock Virus

  Materials
  • Virus‐infected L2 cells ( protocol 1)
  • DME2 (see recipe)
  • DME10 (see recipe)
  • DME0 (see recipe)
  • DBT cells (not commercially available; cells can be obtained from most investigators working with MHV, including the authors)
  • Sterile 5‐ml snap‐cap tubes
  • 25‐, 75‐, and 175‐cm2 tissue culture flasks with filter caps
  • 15‐ml and 50‐ml conical polypropylene centrifuge tubes (e.g., BD Falcon)
  • Cup sonicator
  • Tabletop centrifuge, 4°C
  • Additional reagents and equipment for plaque assay ( protocol 1)

Support Protocol 4: Characterization of MHV Stock Virus

  • Viral stocks to be titered, including a reference “wild‐type” stock
  • Two rulers: a flat 6‐in (∼15‐cm)' plastic ruler that has a centimeter/millimeter scale and a 12‐in. (∼30‐cm) ruler with a similar scale
  • Either an overhead projector or an imaging system allowing you to photograph the plates, saving the image to a tiff file, combined with a computer projection system allowing you to subsequently project the recorded images

Basic Protocol 3: Purification of MHV by Equilibrium Ultracentrifugation Through Sucrose Gradients

  Materials
  • Virus‐infected cell supernatants (e.g., protocol 6)
  • Sucrose gradient solutions (see recipe): 20%, 30%, and 60% sucrose, chilled before use
  • MOPS‐saline‐EDTA (MSE) buffer (see recipe)
  • Disinfectant
  • Ultraclear ultracentrifuge tubes:
    • SW28 tubes, 3.5‐in. high × 1‐in. diameter (Beckman, part number 344058)
    • SW41 tubes, 3.5‐in. high × 9/16‐in. diameter (Beckman, part number 344059)
  • Precooled Beckman SW28 and SW41 rotors or equivalent. For radiolabeled samples when only relatively small volumes of virus will be purified, only an SW41 rotor is required.
  • Ultracentrifuge rated to accept the SW28 and SW41 rotors
  • Cup sonicator
  • Gradient maker, available from Hoefer Scientific and GE Healthcare (we have found the 30‐ml size, i.e., the Hoefer SG30, to be the most useful
  • No.‐00 rubber stopper pierced through the center with a 21‐G 1.5‐in. needle
  • Ring stand with small three‐finger clamp
  • 22‐G needle and 3‐ml syringe
  • Refractometer
  • Metal probe (16‐ to 18‐G, 4‐ to 6‐in. length)
  • Thin Tygon tubing (∼0.045‐ to 0.065‐in. inside diameter; must fit snugly over the probe)
  • Peristaltic pump

Alternate Protocol 2: Purification of MHV by Velocity and Equilibrium Ultracentrifugation Through Potassium Tartrate Gradients

  • Potassium tartrate gradient solutions (see recipe): 5%, 10%, 15%, 25%, and 40% potassium tartrate

Basic Protocol 4: Generation of Recombinant MHV from cDNA

  Materials
  • Plasmids A to G containing cDNAs that represent the entire MHV‐A59 genome ( protocol 11)
  • 10 U/µl restriction enzymes AhdI, BglI, BsmBI, MluI, and SfiI (New England Biolabs)
  • 10× NEBuffer 2 and 3 (New England Biolabs)
  • 100× (10 mg/ml) bovine serum albumin (BSA; New England Biolabs, cat. no. B9001S)
  • 0.8% agarose gel (Voytas, )
  • 10 U/µl calf intestinal alkaline phosphatase (CIAP; New England Biolabs) or 1 U/µl shrimp alkaline phosphatase
  • 500 mM EDTA (see recipe)
  • 3 M sodium acetate, pH 5.2 ( appendix 2A)
  • Chloroform
  • Isopropanol
  • 70% ethanol
  • 95% ethanol
  • Nuclease‐free water (e.g., DEPC‐treated; appendix 2A)
  • 3 U/µl T4 DNA ligase and 10× ligation buffer (Promega, cat. no. M180B)
  • QiaQuick gel extraction kit (Qiagen, cat. no. 28704)
  • Lambda HindIII markers (Invitrogen, cat. no. 15612‐013)
  • 10 µM ATP
  • 100 mM dithiothreitol (DTT)
  • Primers for N gene:
    • A59SP6 Ng(+):
    • 5′TCGGCCTCGATGGCCATTTAGGTGACACTATAGATGTCTTTTGTTCCTGGGCAAG3′
    • A59Ng3′ (‐): 5′TCCGGA(TTT) 8TTACACATTAGAGTCATCTTCTAACC3′
  • 100% ethanol
  • BHK‐R cells (not commercially available; cells can be obtained from Dr. Kathryn Holmes, University of Colorado Medical School; )
  • DBT cells (not commercially available; cells can be obtained from most investigators working with MHV, including the authors)
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • RNAeasy kit (Qiagen)
  • 16°, 50°, 55°, and 65°C water baths
  • SpeedVac evaporator (Savant Instruments; or equivalent centrifugal vacuum evaporator)
  • Dark Reader light box (Clare Chemical Research, http://www.clarechemical.com/)
  • Orange viewing glasses for Dark Reader (Clare Chemical Research, http://www.clarechemical.com/)
  • Razor blade
  • NanoDrop spectrophotometer (http://www.nanodrop.com)
  • Ambion mMESSAGE mMACHINE High Yield Capped DNA Kit [Applied Biosystems; use T7 kit (cat. no. AM1344) for transcription of the ligated full‐length cDNA and the SP6 kit (cat. no. AM1340) for transcription of the N gene RNA]
  • 25‐, 75‐ and 175‐cm2 tissue culture flasks
  • Electroporator with 4‐mm‐gap cuvettes
  • 50‐ and 15‐ml conical polypropylene centrifuge tubes (e.g., BD Falcon)
  • Cup sonicator
  • Tabletop centrifuge (e.g., IEC Clinical), 4°C
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), the polymerase chain reaction (PCR; Kramer and Coen, ), culturing/passaging cell lines ( protocol 3), and plaque purification of viruses ( protocol 6)

Support Protocol 5: Plasmid Propagation and Maintenance

  Materials
  • Bacteria containing the desired plasmids (either glycerol stocks or plates <6 weeks old); plasmids can be obtained from Ralph Baric, University of North Carolina ( ), and initially should be transformed into Top 10 cells (Invitrogen, cat. no. C44040‐03) as described below
  • LB plates containing 50 µg/ml ampicillin or 30 µg/ml kanamycin (also see Table 15.1.4)
  • 2× YT broth (see recipe) containing appropriate selection antibiotic
  • Plasmid Midiprep kit (BioRad, cat. no. 732‐6120; alternatively use Promega Wizard kit)
  • Restriction enzymes AdhI, BglI, BsmBI, MluI, SfiI (New England Biolabs; see Table 15.1.4)
  • 0.8% and 1% agarose gels prepared with TAE buffer (Voytas, )
  • 1 mg/ml ethidium bromide (see recipe)
  • 30°C incubator
  • Tabletop centrifuge, 4°C
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Basic Protocol 5: Generation of Recombinant Viruses by Targeted Recombination

  Materials
  • FCWF cells (ATCC, cat. no. CRL‐2787)
  • DME10/FBS (for FCWF cells; see recipe for DME10 but use FBS where calf serum is called for)
  • DME0 (see recipe)
  • DME2 (see recipe)
  • PacI restriction enzyme (New England Biolabs)
  • 0.8% agarose gel in TAE buffer (Voytas, )
  • 3 M ammonium acetate, pH 5.2 ( appendix 2A)
  • 70% and 96% (v/v) ethanol
  • QuickClean 5M PCR Purification Kit (Genscript, cat. no. L00198; optional)
  • Turbo DNase kit (Applied Biosystems)1% agarose gel in TBE buffer (Voytas, )
  • DBT cells (not commercially available; cells can be obtained from most investigators working with MHV, including the authors)
  • Recipient virus fMHV (Dr. Paul Masters, Wadsworth Laboratory, Albany, N.Y.; )
  • Dulbecco's phosphate buffered saline (DPBS; e.g., Invitrogen) without calcium and magnesium
  • RNeasy mini kit (Qiagen)
  • SuperScript III Reverse Transcriptase kit (Invitrogen)
  • 25‐, 75‐, and 175‐cm2 tissue culture flasks with filter cap
  • Platform rocker
  • 15‐ and 50‐ml conical polypropylene tubes with screw caps
  • Cup sonicator
  • Tabletop centrifuges (e.g., IEC Clinical), 4°C and room temperature
  • Cryogenic tubes
  • mMESSAGE mMACHINE High Yield Capped RNA T7 Transcription Kit (Applied Biosystems)
  • Cell Line Nucleofector Kit V (Amaxa Biosystems; http://www.lonzabio.com)
  • Nucleofector (Amaxa Biosystems; http://www.lonzabio.com)
  • Cup sonicator
  • Cryogenic tubes
  • Additional reagents and equipment for preparation/passaging of cell cultures, including trypsinization ( protocol 3), agarose gel electrophoresis (Voytas, ), counting cells using a hemacytometer ( appendix 4A), plaque purification ( protocol 1), and expansion of plaques to produce stocks ( protocol 6)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Almazan, F., Gonzalez, J.M., Penzes, Z., Izeta, A., Calvo, E., Plana‐Duran, J., and Enjuanes, L. 2000. Engineering the largest RNA virus genome as an infectious bacterial artificial chromosome. Proc. Natl. Acad. Sci. U.S.A. 97:5516‐5521.
   Casais, R., Thiel, V., Siddell, S.G., Cavanagh, D., and Britton, P. 2001. Reverse genetics system for the avian coronavirus infectious bronchitis virus. J. Virol. 75:12359–12369.
   Dominguez, S.R., O'Shea, T.J., Oko, L.M., and Holmes, K.V. 2007. Detection of group 1 coronaviruses in bats in North America. Emerg. Infect. Dis. 13:1295‐1300.
   Donaldson, E.F., Yount, B., Sims, A.C., Burkett, S., Pickles, R.J., and Baric, R.S. 2008. Systematic assembly of a full‐length infectious clone of human coronavirus NL63. J. Virol. 82:11948‐11957.
   Dveksler, G.S., Pensiero, M.N., Cardellichio, C.B., Williams, R.K., Jiang, G., Holmes, K.V., and Dieffenbach, C.W. 1991. Cloning of the mouse hepatitis virus (MHV) receptor: Expression in human and hamster cell lines confers susceptibility to MHV. J. Virol. 65:6881‐6891.
   Fu, L., Gonzales, D.M., Sarma, J.D., and Lavi, E. 2004. A combination of mutations in the S1 part of the spike glycoprotein gene of coronavirus MHV‐A59 abolishes demyelination. J. Neurovirol. 10:41‐51.
   Johnson, R.F., Feng, M., Liu, P., Millership, J.J., Yount, B., Baric, R.S., and Leibowitz, J.L. 2005. Effect of mutations in the mouse hepatitis virus 3′(+)42 protein binding element on RNA replication. J. Virol. 79:14570‐14585.
   Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1–15.1.14.
   Kuo, L., Godeke, G.J., Raamsman, M.J., Masters, P.S., and Rottier, P.J. 2000. Retargeting of coronavirus by substitution of the spike glycoprotein ectodomain: Crossing the host cell species barrier. J. Virol. 74:1393‐1406.
   Lau, S.K., Woo, P.C., Li, K.S., Huang, Y., Tsoi, H.W., Wong, B.H., Wong, S.S., Leung, S.Y., Chan, K.H., and Yuen, K.Y. 2005. Severe acute respiratory syndrome coronavirus‐like virus in Chinese horseshoe bats. Proc. Natl. Acad. Sci. U.S.A. 102:14040‐14045.
   Lau, S.K., Li, K.S., Huang, Y., Shek, C.T., Tse, H., Wang, M., Choi, G.K., Xu, H., Lam, C.S., Guo, R., Chan, K.H., Zheng, B.J., Woo, P.C., and Yuen, K.Y. 2010. Ecoepidemiology and complete genome comparison of different strains of severe acute respiratory syndrome‐related Rhinolophus bat coronavirus in China reveal bats as a reservoir for acute, self‐limiting infection that allows recombination events. J. Virol. 84:2808‐2819.
   Li, W., Shi, Z., Yu, M., Ren, W., Smith, C., Epstein, J.H., Wang, H., Crameri, G., Hu, Z., Zhang, H., Zhang, J., McEachern, J., Field, H., Daszak, P., Eaton, B.T., Zhang, S., and Wang, L.F. 2005a. Bats are natural reservoirs of SARS‐like coronaviruses. Science 310:676‐679.
   Li, W., Zhang, C., Sui, J., Kuhn, J.H., Moore, M.J., Luo, S., Wong, S.K., Huang, I.C., Xu, K., Vasilieva, N., Murakami, A., He, Y., Marasco, W.A., Guan, Y., Choe, H., and Farzan, M. 2005b. Receptor and viral determinants of SARS‐coronavirus adaptation to human ACE2. EMBO J. 24:1634‐1643.
   Lorusso, A., Decaro, N., Schellen, P., Rottier, P.J., Buonavoglia, C., Haijema, B.J., and de Groot, R.J. 2008. Gain, preservation, and loss of a group 1a coronavirus accessory glycoprotein. J. Virol. 82:10312‐10317.
   Ontiveros, E., Kuo, L., Masters, P.S., and Perlman, S. 2001. Inactivation of expression of gene 4 of mouse hepatitis virus strain JHM does not affect virulence in the murine CNS. Virology 289:230‐238.
   Reed, L.J. and Muench, H. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hygiene 27:493‐497.
   Robb, J.A. and Bond, C.W. 1979. Pathogenic murine coronaviruses I. Characterization and biologic behavior in vitro and virus‐specific intracellular RNA of strongly neurotopic JHMV and weakly neurotopic A59V viruses. Virology 94:352‐370.
   Stephensen, C.B., Casebolt, D.B., and Gangopadhyay, N.N. 1999. Phylogenetic analysis of a highly conserved region of the polymerase gene from 11 coronaviruses and development of a consensus polymerase chain reaction assay. Virus Res. 60:181‐189.
   Thiel, V. and Siddell, S.G. 2005. Reverse genetics of coronaviruses using vaccinia virus vectors. In Coronavirus Genome Structure and Replication, Vol. 287 (D. Brian and R. Baric, eds.) pp. 199‐227. Springer, New York.
   Thiel, V., Herold, J., Schelle, B., and Siddell, S.G. 2001. Infectious RNA transcribed in vitro from a cDNA copy of the human coronavirus genome cloned in vaccinia virus. J. Gen. Virol. 82:1273‐1281.
   Vijaykrishna, D., Smith, G.J., Zhang, J.X., Peiris, J.S., Chen, H., and Guan, Y. 2007. Evolutionary insights into the ecology of coronaviruses. J. Virol. 81:4012‐4020.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:10.4.1‐10.4.8.
   Wesseling, J.G., Vennema, H., Godeke, G.J., Horzinek, M.C., and Rottier, P.J. 1994. Nucleotide sequence and expression of the spike (S) gene of canine coronavirus and comparison with the S proteins of feline and porcine coronaviruses. J. Gen. Virol. 75:1789‐1794.
   Wilson, L., McKinlay, C., Gage, P., and Ewart, G. 2004. SARS coronavirus E protein forms cation‐selective ion channels. Virology 330:322‐331.
   Youn, S., Leibowitz, J.L., and Collisson, E.W. 2005. In vitro assembled, recombinant infectious bronchitis viruses demonstrate that the 5a open reading frame is not essential for replication. Virology 332:206‐215.
   Yount, B., Curtis, K.M., and Baric, R.S. 2000. Strategy for systematic assembly of large RNA and DNA genomes: Transmissible gastroenteritis virus model. J. Virol. 74:10600‐10611.
   Yount, B., Denison, M.R., Weiss, S.R., and Baric, R.S. 2002. Systematic assembly of a full‐length infectious cDNA of mouse hepatitis virus strain A59. J. Virol. 76:11065‐11078.
   Yount, B., Curtis, K.M., Fritz, E.A., Hensley, L.E., Jahrling, P.B., Prentice, E., Denison, M.R., Geisbert, T.W., and Baric, R.S. 2003. Reverse genetics with a full‐length infectious cDNA of severe acute respiratory syndrome coronavirus. Proc. Natl. Acad. Sci. U.S.A. 100:12995‐13000.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library