Human Parainfluenza Virus Type 3 (HPIV‐3): Construction and Rescue of an Infectious, Recombinant Virus Expressing the Enhanced Green Fluorescent Protein (EGFP)

Jason P. Roth1, Joseph K.‐K. Li2, Dale L. Barnard3

1 Southeast Poultry Research Laboratory, Agricultural Research Services, United States Department of Agriculture, Athens, Georgia, 2 Department of Biology, Utah State University, Logan, Utah, 3 Institute for Antiviral Research, Department of Animal, Dairy, and Veterinary Sciences, Utah State University, Logan, Utah
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15F.1
DOI:  10.1002/9780471729259.mc15f01s17
Online Posting Date:  May, 2010
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The ability to rescue an infectious, recombinant RNA virus from a cDNA clone has led to new opportunities for measuring viral replication from a viral expressed reporter gene. In this protocol, the process of inserting the enhanced green fluorescent protein (EGFP) gene into the human parainfluenza virus type 3 (HPIV‐3) antigenome and rescuing a recombinant, infectious virus is described. The first step in this process includes the generation of a cDNA clone copied from viral RNA isolated from an HPIV‐3 wild‐type infection. Next, the EGFP gene is inserted into the viral genome so that it is expressed independently during virus replication. Third, the viral support genes that are responsible for viral replication are cloned into T7 expression plasmids. Finally, an infectious, rHPIV3‐EGFP virus is rescued from the cDNA clone with assistance from the viral support genes. Ultimately, cells infected with the rHPIV3‐EGFP virus will emit green fluorescence that can be photographed and quantitated. Curr. Protoc. Microbiol. 17:15F.1.1‐15F.1.22. © 2010 by John Wiley & Sons, Inc.

Keywords: parainfluenza virus; infectious clone; in vitro drug screening; in vivo drug screening; EGFP

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Construction of a Full‐Length Recombinant HPIV‐3 cDNA Clone Containing the EGFP Gene
  • Basic Protocol 2: Cloning of HPIV‐3 Support Genes
  • Basic Protocol 3: Rescuing Infectious, Recombinant HPIV‐3 Viruses
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of a Full‐Length Recombinant HPIV‐3 cDNA Clone Containing the EGFP Gene

  Materials
  • HPIV‐3 virus (e.g., Strain 14702)
  • MA‐104 cells (ATCC)
  • QIAamp viral RNA mini kit (Qiagen)
  • ProSTAR First‐Strand RT‐PCR kit (Stratagene)
  • Primers (see Table 15.1.1 for sequence details):
    • 5.3‐kb forward
    • 5.3‐kb reverse
    • 6.1‐kb forward
    • 6.1‐kb reverse
    • 4.2‐kb forward
    • 4.2‐kb reverse
    • M13/pUC sequencing primer (‐40) (NEB)
    • M13/pUC reverse sequencing primer (‐48) (NEB)
    • 6.1‐kb Mut‐forward
    • 6.1‐kb Mut‐reverse
    • EGFP‐forward
    • EGFP‐reverse
    • Term‐forward
    • Term‐reverse
    • Rib‐forward
    • Rib‐reverse
  • Enzymes:
    • PfuTurbo Hotstart DNA polymerase (Stratagene)
    • T4 DNA ligase (NEB)
    • T4 DNA polymerase (NEB)
    • Sequenase version 2.0 DNA polymerase (USB)
    • Calf intestine alkaline phosphatase (CIP; NEB)
  • 2‐Log DNA ladder (NEB)
  • QIAEX II gel extraction kit (Qiagen)
  • QIAquick PCR purification kit (Qiagen)
  • Plasmids
    • pUC19 (NEB)
    • pEGFP (BD Biosciences Clontech)
    • pACYC177 (NEB)
  • Restriction enzymes (NEB)
    • SmaI
    • AatII
    • BstEII
    • DrdI
    • KpnI
    • DraIII
    • SphI
    • PacI
  • Electrocomp GeneHogs E. coli (Invitrogen)
  • imMedia Amp Blue (Invitrogen)
  • imMedia Amp liquid (Invitrogen)
  • QIAprep Spin miniprep kit (Qiagen)
  • QuikChange XL site‐directed mutagenesis (Stratagene)
  • imMedia Amp Agar (Invitrogen)
  • Subcloning efficiency DH5α chemically competent E. coli (Invitrogen)
  • TE buffer (e.g., Thermo Fisher Scientific, cat. no. BP2474; or see appendix 2A)
  • EndoFree plasmid maxi kit (Qiagen)
  • 0.1‐ml thin‐walled PCR tubes (BioRad)
  • Thermal cycler (e.g., GENEMate)
  • 37°, 60°, and 65°C water baths
  • Electroporation apparatus (e.g., Gene Pulser, Bio‐Rad)
  • 37°C incubators (rotating and non‐rotating)
  • Sterile 14‐ml snap‐cap culture tubes (Fisher)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, )
    Table 5.0.1   MaterialsPrimers Used in the Cloning of the rHPIV‐EGFP cDNA Clone

    Event/primer Sequence (5′ to 3′) Highlights
    Viral genomic cDNA synthesis
    5.3‐kb‐forward CCGACGTCTTAATTAATACGACTCACTATAGGACCAAACAAGAGAAGAAACTT Bold: AatII and PacI restriction sites Underlined: T7 promoter sequence
    5.3‐kb‐reverse GGTCACCACAAGAGTTAGA Bold: natural BstEII restriction site
    6.1‐kb‐forward TCTAACTCTTGTGGTGACC Bold: natural BstEII restriction site
    6.1‐kb‐reverse ATTCATCCCAAGGGCAATA
    4.2‐kb‐forward AGAATGGTTATTCACCTGTTC
    4.2‐kb‐reverse GAGAAGCACTCTGTGTGGTAT Bold: mutated DraIII restriction site Mutations underlined: A to C and T to G
    Site‐directed mutagenesis
    6.1‐kb Mut‐forward CTTAGGAGCAAAGCGTGCTCAG AAAATGGACACTG Bold: A to G mutation
    6.1‐kb Mut‐reverse CAGTGTCCATTTTCTGAGCACGC TTTGCTCCTAAG Reverse complement of 6.1‐kb Mut‐forward
    EGFP gene amplification
    EGFP‐forward TTGACTAGAAGGTCAAGAACC TGCAGGTCGACTCTAGAGGAT Bold: DrdI restriction site
    EGFP‐reverse TTGACCTTCTAGTCAATGTCTTTAATCCTAAGTTTTTCTTATTTATTAACCGGCGCTCAGTTGGAAT Bold: DrdI restriction site Underlined: HPIV‐3 gene transcriptional end, intercistronic, and gene transcriptional start signals
    Customized polylinkers
    Term‐forward TTTTTGTGCGCCCAATACGCAAACCGCC TCTCCCCGCGCGTTGGCCGTTAATTAA GAGGGTGACCCTGCACAGAGTGCC Italics: Vaccinia virus termination sequence Bold: PacI, BstEII, and DraIII restriction sites
    Term‐reverse TTTTTGTAAAAAACCCCTCAAGACCCGTTTAGAGGCCCCAAGGGGTTATGCTAGTTAGGTACCCGGGCACTCTGTGCAG Italics: Vaccinia virus termination sequence Underlined: T7 termination sequence Bold: KpnI, SmaI, and DraIII restriction sites
    Rib‐forward ACCACACAGAGTGCTTCTCTTGTTTGGTGGGTCGGCATGGCATCTCCACCTCCTCGCGGTCCGACCT Bold: DraIII restriction site Italics: Final 28 nucleotides of the HPIV‐3 genome Underlined: Antigenomic hepatitis delta virus ribozyme sequence
    Rib‐reverse GGCCGGTACCTCCCTTAGCCATCCGAGTGGACGACGTCCTCCTTCGGATGCCCAGGTCGGACCGCGA Bold: KpnI restriction site Underlined: Antigenomic hepatitis delta virus ribozyme sequence
    SphI adapter
    Adapter‐forward GTGACCGCGCATGCCCACAGA Bold: SphI restricton site Underlined: BstEII and DraIII restriction sites
    Adapter‐reverse GTGGGCATGCGCG Bold: SphI restricton site Underlined: BstEII and DraIII restriction sites

Basic Protocol 2: Cloning of HPIV‐3 Support Genes

  Materials
  • Template (see Table 15.1.2)
  • Primers (20 µM; see Table 15.1.2 for sequence details):
    • NP‐forward
    • NP‐reverse
    • P‐forward
    • P‐reverse
    • L‐forward
    • L‐reverse
    • M13/pUC sequencing primer (‐40) (NEB)
    • M13/pUC reverse sequencing primer (‐48) (NEB)
  • Enzymes:
    • PfuTurbo Hotstart DNA polymerase (Stratagene)
    • T4 DNA ligase (NEB)
  • QIAquick PCR purification kit (Qiagen)
  • Plasmids:
    • pUC19 (NEB)
    • pTNT (Promega)
  • Restriction enzymes (NEB):
    • SmaI
    • KpnI
    • SalI
  • Subcloning efficiency DH5α chemically competent E. coli (Invitrogen)
  • Electrocomp GeneHogs E. coli (Invitrogen)
  • imMedia Amp Blue (Invitrogen)
  • imMedia Amp liquid (Invitrogen)
  • QIAprep Spin miniprep kit (Qiagen)
  • QIAEX II gel extraction kit (Qiagen)
  • imMedia Amp agar (Invitrogen)
  • EndoFree plasmid maxi kit (Qiagen)
  • 0.1‐ml thin‐walled PCR tubes
  • Thermal cycler (e.g., GENEMate)
  • 37°C and 65°C water baths
  • Electroporation apparatus (e.g., Gene Pulser, Bio‐Rad)
  • 37°C incubators (rotating and non‐rotating)
  • Additional reagents and equipment for performing agarose gel electrophoresis (Voytas, )
    Table 5.0.2   MaterialsPrimers Used in the Cloning of the HPIV‐3 Support Genes and PCR Condition

    Nucleocapsid gene (NP) Phosphoprotein gene (P) a Large protein gene (L)
    Forward primer (5′ to 3′) GAAGGTCAAGAAAA GGGAACTCT TGATGGAAAGCG ACGCTAAA GCGTGCTCAGAAAA TGGACA
    Reverse primer (5′ to 3′) TTGATTCGATTAGTT GCTTCCA GGATCATTGGCAATT GTTGA CCTTAGGCTTAAAG ATAAAGGTTAGGA
    Primer concentration 20 µM 20 µM 20 µM
    Template Genomic 5.3‐kb cDNA segment Genomic 5.3‐kb cDNA segment pUC19‐J
    Annealing temperature 51°C 51°C 51°C
    Extension time 2 min 2 min 7 min
    Cycles 30 30 30
    Approximate size 1.5 kb 1.8 kb 7.0 kb

     aUnderlined: T to C mutation to silence the expression of the virus C protein in the forward primer.

Basic Protocol 3: Rescuing Infectious, Recombinant HPIV‐3 Viruses

  Materials
  • HeLa cells (ATCC #CCL‐2)
  • Minimum essential medium with Earle's balanced salts (MEM; Hyclone, cat. no. SH30024.02)
  • Standard fetal bovine serum (FBS; Hyclone, cat. no. SH30088.03)
  • 10 mM non‐essential amino acids solution in MEM (NEAA; Invitrogen, cat. no. 11140050)
  • 100 mM sodium pyruvate solution in MEM (Invitrogen, cat. no. 11360070)
  • vTF7‐3 (Dr. Bernard Moss's laboratory; )
  • Opti‐MEM I reduced‐serum medium (Gibco, cat. no. 11058‐021)
  • Plasmids:
    • pUC19‐J (see protocol 1)
    • pTNT‐NP (see protocol 2)
    • pTNT‐P (see protocol 2)
    • pTNT‐L (see protocol 2)
  • Lipofectamine 2000 transfection reagent (Invitrogen, cat. no. 11668019)
  • Cytosine β‐D‐arabinofuranoside (Ara‐C; Sigma, cat. no. C1768)
  • MA‐104 cells (ATCC)
  • 2% agarose (see recipe)
  • 2× MEM (see recipe)
  • 12‐well plates (Costar no. 3513, Corning)
  • Water‐jacketed, 37°C, 5% CO 2 humidified incubator (e.g., Isotemp, Thermo Fisher Scientific)
  • Cell scrapers (Fisher Scientific, cat. no. 08‐773‐3)
  • 25‐cm2 flasks
  • 1‐ml pipets
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bukreyev, A., Yang, L., Zaki, S.R., Shieh, W.J., Rollin, P.E., Murphy, B.R., Collins, P.L., and Sanchez, A. 2006. A single intranasal inoculation with a paramyxovirus‐vectored vaccine protects guinea pigs against a lethal‐dose Ebola virus challenge. J. Virol. 80:2267‐2279.
   Calain, P. and Roux, L. 1995. Functional characterisation of the genomic and antigenomic promoters of Sendai virus. Virology 212:163‐173.
   Durbin, A.P., Hall, S.L., Siew, J.W., Whitehead, S.S., Collins, P.L., and Murphy, B.R. 1997a. Recovery of infectious human parainfluenza virus type 3 from cDNA. Virology 235:323‐332.
   Durbin, A.P., Siew, J.W., Murphy, B.R., and Collins, P.L. 1997b. Minimum protein requirements for transcription and RNA replication of a minigenome of human parainfluenza virus type 3 and evaluation of the rule of six. Virology 234:74‐83.
   Friedman, H., Macarak, E., MacGregor, R., Wolfe, J., and Kefalides, N. 1981. Virus infection of endothelial cells. J. Infect. Dis. 143:266‐273.
   Fuerst, T.R., Niles, E.G., Studier, F.W., and Moss, B. 1986. Eukaryotic transient‐expression system based on recombinant vaccinia virus that synthesizes bacteriophage T7 RNA polymerase. Proc. Natl. Acad. Sci. U.S.A. 83:8122‐8126.
   Galinski, M.S. 1991. Annotated nucleotide and protein sequences for selected paramyxoviridae. In The Paramyxoviruses (D.W. Kingsbury, ed.) pp. 537‐568. Plenum Press, New York.
   Garcin, D., Pelet, T., Calain, P., Roux, L., Curran, J., and Kolakofsky, D. 1995. A highly recombinogenic system for the recovery of infectious Sendai paramyxovirus from cDNA: Generation of a novel copy‐back nondefective interfering virus. EMBO J. 14:6087‐6094.
   Hoffman, M.A. and Banerjee, A.K. 1997. An infectious clone of human parainfluenza virus type 3. J. Virol. 71:4272‐4277.
   Kato, A., Sakai, Y., Shioda, T., Kondo, T., Nakanishi, M., and Nagai, Y. 1996. Initiation of Sendai virus multiplication from transfected cDNA or RNA with negative or positive sense. Genes Cells 1:569‐579.
   Lamb, R.A. and Kolakofsky, D. 2001. Paramyxoviridae: The viruses and their replication. In Fundamental Virology (D.M. Knipe and P.M. Howley, eds.) pp. 689‐724. Lippincott Williams & Wilkins, Philadelphia.
   Mao, H., Thakur, C.S., Chattopadhyay, S., Silverman, R.H., Gudkov, A., and Banerjee, A.K. 2008. Inhibition of human parainfluenza virus type 3 infection by novel small molecules. Antiviral Res. 77:83‐94.
   Marschall, M., Freitag, M., Weiler, S., Sorg, G., and Stamminger, T. 2000. Recombinant green fluorescent protein‐expressing human cytomegalovirus as a tool for screening antiviral agents. Antimicrob. Agents Chemother. 44:1588‐1597.
   Ohsawa, K., Yamada, A., Takeuchi, K., Watanabe, Y., Miyata, H., and Sato, H. 1998. Genetic characterization of parainfluenza virus 3 derived from guinea pigs. J. Vet. Med. Sci. 60:919‐922.
   Perrotta, A.T. and Been, M.D. 1991. A pseudoknot‐like structure required for efficient self‐cleavage of hepatitis delta virus RNA. Nature 350:434‐436.
   Radecke, F., Spielhofer, P., Schneider, H., Kaelin, K., Huber, M., Dotsch, C., Christiansen, G., and Billeter, M.A. 1995. Rescue of measles viruses from cloned DNA. EMBO J. 14:5773‐5784.
   Roth, J.P., Li, J.K., Smee, D.F., Morrey, J.D., and Barnard, D.L. 2009. A recombinant, infectious human parainfluenza virus type 3 expressing the enhanced green fluorescent protein for use in high‐throughput antiviral assays. Antiviral Res. 82:12‐21.
   Shirakura, M., Fukumura, M., Inoue, M., Fujikawa, S., Maeda, M., Watabe, K., Kyuwa, S., Yoshikawa, Y., and Hasegawa, M. 2003. Sendai virus vector‐mediated gene transfer of glial cell line‐derived neurotrophic factor prevents delayed neuronal death after transient global ischemia in gerbils. Exp. Anim. 52:119‐127.
   Stokes, A., Tierney, E.L., Murphy, B.R., and Hall, S.L. 1992. The complete nucleotide sequence of the JS strain of human parainfluenza virus type 3: Comparison with the Wash/47885/57 prototype strain. Virus Res. 25:91‐103.
   Storey, D., Dimock, K., and Kang, C. 1984. Structural characterization of virion proteins and genomic RNA of human parainfluenza virus 3. J. Virol. 52:761‐766.
   Tapparel, C., Maurice, D., and Roux, L. 1998. The activity of Sendai virus genomic and antigenomic promoters requires a second element past the leader template regions: A motif (GNNNNN)3 is essential for replication. J. Virol. 72:3117‐3128.
   Towner, J.S., Paragas, J., Dover, J.E., Gupta, M., Goldsmith, C.S., Huggins, J.W., and Nichol, S.T. 2005. Generation of eGFP expressing recombinant Zaire Ebola virus for analysis of early pathogenesis events and high‐throughput antiviral drug screening. Virology 332:20‐27.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Molec. Biol. 51:2.5A.1‐2.5A.9.
   Wertz, G.W., Perepelitsa, V.P., and Ball, L.A. 1998. Gene rearrangement attenuates expression and lethality of a nonsegmented negative strand RNA virus. Proc. Natl. Acad. Sci. U.S.A. 95:3501‐3506.
   Wyatt, L.S., Moss, B., and Rozenblatt, S. 1995. Replication‐deficient vaccinia virus encoding bacteriophage T7 RNA polymerase for transient gene expression in mammalian cells. Virology 210:202‐205.
   Yonemitsu, Y., Kitson, C., Ferrari, S., Farley, R., Griesenbach, U., Judd, D., Steel, R., Scheid, P., Zhu, J., Jeffery, P.K., Kato, A., Hasan, M.K., Nagai, Y., Masaki, I., Fukumura, M., Hasegawa, M., Geddes, D.M., and Alton, E.W. 2000. Efficient gene transfer to airway epithelium using recombinant Sendai virus. Nat. Biotechnol. 18:970‐973.
   Zhan, X., Hurwitz, J.L., Krishnamurthy, S., Takimoto, T., Boyd, K., Scroggs, R.A., Surman, S., Portner, A., and Slobod, K.S. 2007. Respiratory syncytial virus (RSV) fusion protein expressed by recombinant Sendai virus elicits B‐cell and T‐cell responses in cotton rats and confers protection against RSV subtypes A and B. Vaccine 25:8782‐8793.
   Zhang, L., Bukreyev, A., Thompson, C.I., Watson, B., Peeples, M.E., Collins, P.L., and Pickles, R.J. 2005. Infection of ciliated cells by human parainfluenza virus type 3 in an in vitro model of human airway epithelium. J. Virol. 79:1113‐1124.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library