Insertion of a GFP Reporter Gene in Influenza Virus

Jasmine T. Perez1, Adolfo García‐Sastre2, Balaji Manicassamy1

1 Department of Microbiology, University of Chicago, Chicago, Illinois, 2 Department of Microbiology, Mount Sinai School of Medicine, New York, New York
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15G.4
DOI:  10.1002/9780471729259.mc15g04s29
Online Posting Date:  May, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The incorporation of a fluorescent reporter gene into a replication‐competent influenza A virus (IAV) has made it possible to trace IAV infection in vivo. This protocol describes the process of inserting a green fluorescent protein (GFP) reporter into the IAV genome using the established reverse genetics system. The strategy begins with the reorganization of segment eight of the IAV genome, during which the open reading frames of nonstructural protein 1 (NS1) and the nuclear export protein (NEP) are separated to allow for GFP fusion to the NS1 protein. The NS1, GFP, and NEP open reading frames (ORF) are then cloned into the IAV rescue system backbone. Upon construction of the GFP‐encoding segment eight rescue plasmid, recombinant NS1‐GFP influenza virus can be rescued via co‐transfection with the remaining seven rescue plasmids. The generated NS1‐GFP IAV can subsequently be used to visualize infected cells, both in vitro and in vivo. Curr. Protoc. Microbiol. 29:15G.4.1‐15G.4.16. © 2013 by John Wiley & Sons, Inc.

Keywords: influenza A virus; recombinant virus; reverse genetics; GFP reporter; nonstructural protein 1 (NS1)

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Construction of NS Segment Containing GFP Reporter
  • Basic Protocol 2: Rescue of Infectious Recombinant NS1‐GFP IAV
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Construction of NS Segment Containing GFP Reporter

  Materials
  • RNA polymerase I driven (pPol‐I) NS plasmid for IAV PR/8/34 (Dr. Adolfo Garcia‐Sastre; e‐mail: Adolfo.Garcia‐Sastre@mssm.edu)
  • QuikChange site‐directed mutagenesis kit (Agilent)
  • Primers (see Table 15.4.1 for sequence):
    • 5′‐SDM‐NS‐SAnull‐F
    • 3′‐SDM‐NS‐SAnull‐R
    • 5′‐INFU‐NCR‐NS1‐F
    • 3′‐INFU‐NS1‐noSTOP‐R
    • 5′‐INFU‐GFP‐F
    • 3′‐INFU‐GFP‐2A‐R
    • 5′‐INFU‐NEPex1/2‐F
    • 3′‐INFU‐NEP‐NCR‐R
    • 5′‐Sequencing
    • 3′‐Sequencing
  • LB agar plates supplemented with 100 µg/ml ampicillin (see recipe)
  • LB medium supplemented with 100 µg/ml ampicillin (see recipe)
  • QIAprep spin miniprep kit (Qiagen)
  • PFU Ultra DNA polymerase (Agilent)
  • 10 mM dNTPs (dATP, dCTP, dGTP, dTTP; see recipe)
  • Infusion cloning kit (Clontech)
  • 1% Agarose‐TAE gel (see recipe)
  • 10 mg/ml ethidium bromide (Fisher)
  • 6× DNA Loading Dye (Fermentas)
  • 1‐kb Plus DNA ladder (Fermentas)
  • 1× TAE (e.g., Fisher)
  • QIAquick gel extraction kit (Qiagen)
  • DNase‐RNase‐free water (Molecular Biology grade)
  • pMAXGFP vector (Amaxa)
  • RNA polymerase I/polymerase II bidirectional (pDZ) vector for IAV rescues (Dr. Adolfo Garcia‐Sastre; e‐mail: Adolfo.Garcia‐Sastre@mssm.edu)
  • SapI restriction enzyme (New England Biolabs)
  • XbaI restriction enzyme (New England Biolabs)
  • 37°C incubator (rotating and nonrotating)
  • 15‐ml polypropylene tubes (e.g., BD‐Falcon)
  • Thin‐walled 0.2‐ml PCR tubes
  • Thermal cycler
  • Horizontal gel apparatus and associated parts for agarose gels (e.g., Bio‐Rad)
  • Power supply (e.g., BioRad)
  • UV transilluminator
  • Razor blades
  • 1.7‐ml microcentrifuge tubes
    Table 5.0.1   MaterialsPrimers Used for Generating NS1‐GFP Influenza Virus

    5′‐SDM‐NS‐SAnull‐F CACCATTGCCTTCTCTCCCGGGACATACTGCTGAGG
    3′‐SDM‐NS‐SAnull‐R CCTCAGCAGTATGTCCCGGGAGAGAAGGCAATGGTG
    5′‐INFU‐NCR‐NS1‐F CGACCTCCGAAGTTGGGGGGGAGCAAAAGCAGG
    3′‐INFU‐NS1‐noSTOP‐R GGCGGGCATGCCGGACCCAACTTCGCTTCTAATTGTTCC
    5′‐INFU‐GFP‐F GGGTCCGGCATGCCCGCCATGAAGATCGAGTGCC
    3′‐INFU‐GFP‐2A‐R TTCTTCCACATCGCCCGCCTGTTTCAGCAGGCTAAAGTTGGTCGCGCCGCTGCCGGCGAATGCGATCGGGGTCTT
    5′‐INFU‐NEPex1/2‐F GGCGATGTGGAAGAAAACCCGGGCCCGATGGATCCAAACACTGTGTCAAGCTTTCAGGACATACTGCTGAGGATGTC
    3′‐INFU‐NEP‐NCR‐R GCATTTTGGGCCGCCGGGTTATTAGTAGAAACAAGG
    5′ sequencing CGGTACCCGGGGATCCTCTAG
    3′ sequencing GCGACCTCCCGGCCCCGGGG

Basic Protocol 2: Rescue of Infectious Recombinant NS1‐GFP IAV

  Materials
  • Human embryonic kidney (HEK) 293 cells (ATCC# CRL‐1574)
  • 1× Dulbecco's modified Eagle medium (Invitrogen)
  • Fetal bovine serum (FBS), heat inactivated (Hyclone, Invitrogen)
  • 100× penicillin/streptomycin solution (Cellgro)
  • Madin Darby canine kidney (MDCK) cells (ATCC# CCL‐34)
  • 1× MDCK growth medium (see recipe)
  • Opti‐MEM reduced serum medium (Invitrogen)
  • RNA polymerase I/polymerase II bidirectional (pDZ) vectors for IAV PR8 strain rescues (Dr. Adolfo Garcia‐Sastre; e‐mail: Adolfo.Garcia‐Sastre@mssm.edu):
    • pDZ‐PB2
    • pDZ‐PB1
    • pDZ‐PA
    • pDZ‐HA
    • pDZ‐NP
    • pDZ‐NA
    • pDZ‐M
    • pDZ‐NS
    • pDZ‐NS‐GFP (from protocol 1, step 22)
  • Lipofectamine 2000 (Invitrogen)
  • 1× infection medium (see recipe)
  • 1 mg/ml TPCK‐trypsin (trypsin from bovine pancreas; see recipe)
  • 2× plaque assay medium (see recipe)
  • 1.2% agar (see recipe)
  • 1× phosphate‐buffered saline (PBS), sterile (Invitrogen)
  • 35% bovine serum albumin (BSA), sterile (MP Biomedical)
  • 15‐cm tissue culture treated dishes
  • Water‐jacketed, 37°C, 5% CO 2 humidified incubator
  • 6‐well tissue culture treated dishes
  • 15‐ml polypropylene tubes (e.g., BD‐Falcon)
  • 56°C water bath
  • 200‐µl pipet tips, sterile
  • Marker
  • Fluorescence microscope
  • 2‐ml cryovials
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Basler, C.F. and Aguilar, P.V. 2008. Progress in identifying virulence determinants of the 1918 H1N1 and the Southeast Asian H5N1 influenza A viruses. Antiviral Res. 79:166‐178.
   Cox, N.J., Neumann, G., Donis, R.O., and Kawaoka, Y. 2005. Orthomyxoviruses: Influenza. In Topley and Wilson's Microbiology and Microbial Infections pp. 634‐698. Hodder Arnold Press, London.
   Donnelly, M.L., Hughes, L.E., Luke, G., Mendoza, H., ten Dam, E., Gani, D., and Ryan, M.D. 2001. The ‘cleavage’ activities of foot‐and‐mouth disease virus 2A site‐directed mutants and naturally occurring ‘2A‐like’ sequences. J. Gen. Virol. 82:1027‐1041.
   Fiore, A.E., Shay, D.K., Broder, K., Iskander, J.K., Uyeki, T.M., Mootrey, G., Bresee, J.S., and Cox, N.S. 2008. Prevention and control of influenza: Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2008. MMWR Recomm. Rep. 57:1‐60.
   Fodor, E., Devenish, L., Engelhardt, O.G., Palese, P., Brownlee, G.G., and Garcia‐Sastre, A. 1999. Rescue of influenza A virus from recombinant DNA. J. Virol. 73:9679‐9682.
   Hoffmann, E., Neumann, G., Kawaoka, Y., Hobom, G., and Webster, R.G. 2000. A DNA transfection system for generation of influenza A virus from eight plasmids. Proc. Natl. Acad. Sci. U.S.A. 97:6108‐6113.
   Manicassamy, B., Manicassamy, S., Belicha‐Villanueva, A., Pisanelli, G., Pulendran, B., and Garcia‐Sastre, A. 2010. Analysis of in vivo dynamics of influenza virus infection in mice using a GFP reporter virus. Proc. Natl. Acad. Sci. U.S.A. 107:11531‐11536.
   Mathews, J.D., Chesson, J.M., McCaw, J.M., and McVernon, J. 2009. Understanding influenza transmission, immunity and pandemic threats. Influenza Resp. Viruses 3:143‐149.
   Neumann, G. and Kawaoka, Y. 2006. Host range restriction and pathogenicity in the context of influenza pandemic. Emerg. Infect. Dis. 12:881‐886.
   Neumann, G., Watanabe, T., Ito, H., Watanabe, S., Goto, H., Gao, P., Hughes, M., Perez, D.R., Donis, R., Hoffmann, E., Hobom, G., and Kawaoka, Y. 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc. Natl. Acad. Sci. U.S.A. 96:9345‐9350.
   Palese, P. and Shaw, M.L. 2007. Orthomyxoviridae: The viruses and their replication. In Fields Virology (D.M.K.P.M. Howley, ed.) pp. 1647‐1689. Lippincott Williams & Wilkins, Philadelphia.
   Pappas, C., Aguilar, P.V., Basler, C.F., Solorzano, A., Zeng, H., Perrone, L.A., Palese, P., Garcia‐Sastre, A., Katz, J.M., and Tumpey, T.M. 2008. Single gene reassortants identify a critical role for PB1, HA, and NA in the high virulence of the 1918 pandemic influenza virus. Proc. Natl. Acad. Sci. U.S.A. 105:3064‐3069.
   Quinlivan, M., Zamarin, D., Garcia‐Sastre, A., Cullinane, A., Chambers, T., and Palese, P. 2005. Attenuation of equine influenza viruses through truncations of the NS1 protein. J. Virol. 79:8431‐8439.
   Webster, R.G., Bean, W.J., Gorman, O.T., Chambers, T.M., and Kawaoka, Y. 1992. Evolution and ecology of influenza A viruses. Microbiol. Rev. 56:152‐179.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library