Poliovirus: Generation and Characterization of Mutants

Cecily P. Burrill1, Vanessa R. Strings1, Michael B. Schulte1, Raul Andino1

1 Department of Microbiology and Immunology, University of California, San Francisco, California
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15H.2
DOI:  10.1002/9780471729259.mc15h02s29
Online Posting Date:  May, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Poliovirus (PV) is the prototypical picornavirus. It is a non‐enveloped RNA virus with a small (∼7.5‐kb) genome of positive polarity. cDNA clones of several strains are available, and infectious virus can be produced by the transfection of in vitro–transcribed viral genomes into an appropriate host cell. The ease of genetic studies in poliovirus is a primary reason that it has long served as a model to study RNA virus biology, pathogenesis, and evolution. Protocols for the generation and characterization of PV mutants are presented. Curr. Protoc. Microbiol. 29:15H.2.1‐15H.2.32. © 2013 by John Wiley & Sons, Inc.

Keywords: poliovirus; picornavirus; viral genetics; one‐step growth curve; viral translation; viral replication

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Generation of Mutant cDNA Plasmids by Overlap PCR and Restriction Cloning
  • Basic Protocol 2: One‐Step Growth Curves
  • Basic Protocol 3: Drug‐Resistance Curves
  • Basic Protocol 4: Assaying Translation and Replication with PLuc Replicon
  • Basic Protocol 5: In Vitro Translation and Replication (IVTR) Assay with S10 HeLa Extracts
  • Support Protocol 1: Generation of S10 HeLa Extracts for IVTR Assay
  • Support Protocol 2: Generation of Initiation Factors for IVTR Assay
  • Basic Protocol 6: Assaying Replication by Strand‐Specific qPCR
  • Basic Protocol 7: Immunoprecipitation of PV Virions
  • Basic Protocol 8: Assaying Translation by Western Blot
  • Basic Protocol 9: Assaying Translation by 35S‐Met Labeling
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Generation of Mutant cDNA Plasmids by Overlap PCR and Restriction Cloning

  Materials
  • 10 µM For PCR primer
  • 10 µM Rev PCR primer
  • 10 µM For mutagenesis primer
  • 10 µM Rev mutagenesis primer
  • Herculase II Fusion DNA polymerase and 5× reaction buffer
  • dNTP mix (10 mM each dNTP)
  • 10 ng/µl cDNA plasmid template
  • Nuclease‐free water
  • 6× DNA loading dye
  • 1% agarose TAE gels and running buffer (Voytas, )
  • DNA ladder (e.g., GeneRuler 1 kb Plus, Fermentas)
  • Gel and PCR cleanup kit (e.g., Nucleospin Gel and PCR Clean‐up, Machery‐Nagel)
  • Restriction enzymes and buffers
  • BSA (if needed; provided with enzymes)
  • ≥10 µg cDNA plasmid vector
  • 5 U/µl Antarctic phosphatase and 10× reaction buffer (NEB)
  • Quick ligation kit (NEB; includes Quick T4 DNA ligase and 2× Quick ligation reaction buffer)
  • SURE electroporation‐competent cells (Agilent)
  • LB‐amp medium (50 to 100 µg/ml)
  • LB‐amp agar plates (50 to 100 µg/ml)
  • Mini‐prep kit (e.g., NucleoSpin plasmid, Machery‐Nagel)
  • NanoDrop spectrophotometer
  • 37°C water bath (or other temperature baths for specific enzymes used)
  • Razor blades
  • 0.5‐ and 1.5‐ml tubes
  • Electroporator and 1‐mm cuvettes
  • 37°C incubator with shaking
  • Centrifuge
  • Additional reagents and equipment for gel electrophoresis (Voytas, )

Basic Protocol 2: One‐Step Growth Curves

  Materials
  • HeLa or HeLa S3 cells (unit 15.1, protocol 7)
  • 10% NCS DMEM/F12 (unit 15.1)
  • Virus stocks of known titer to be assayed
  • Serum‐free DMEM/F12 (unit 15.1), cold
  • PBS ( appendix 2A), cold
  • 24‐well plates
  • 37°C, 5% CO 2 humidified incubator
  • 1.5‐ml tubes
  • Centrifuge

Basic Protocol 3: Drug‐Resistance Curves

  Materials
  • HeLa or HeLa S3 cells (unit 15.1, protocol 7)
  • 10% NCS DMEM/F12 (unit 15.1)
  • Drug to be tested and appropriate solvent
  • Serum‐free DMEM/F12 (unit 15.1)
  • Virus stocks of known titer to be assayed
  • 24‐well plates
  • 37°C, 5% CO 2 humidified incubator
  • Tissue culture microscope
  • 1.5‐ml tubes
  • Centrifuge

Basic Protocol 4: Assaying Translation and Replication with PLuc Replicon

  Materials
  • PLuc plasmid prib(+)RLuc
  • 10 U/µl MluI and 10× NEBuffer 3 (New England BioLabs)
  • Nuclease‐free water
  • 6× DNA loading dye
  • 1% agarose TAE gels and running buffer (Voytas, )
  • DNA ladder (e.g., GeneRuler 1‐kb Plus, Fermentas)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol ( appendix 2A)
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 3 M sodium acetate, pH 5.2 ( appendix 2A)
  • Isopropanol
  • 75% (v/v) ethanol
  • 5× transcription buffer (unit 15.1)
  • NTP mix (25 mM each NTP)
  • 40 U/µl RNaseOUT (Invitrogen)
  • T7 RNA polymerase
  • 2 U/µl DNase I (RNase‐free; New England BioLabs)
  • 3× LiCl‐EDTA (unit 15.1)
  • 0.5× TE (unit 15.1)
  • 2× RNA denaturing loading dye
  • HeLa or HeLa S3 cells (unit 15.1, protocol 7)
  • D‐PBS (PBS without Ca2+ or Mg2+)
  • 0.05% trypsin‐EDTA
  • 10% NCS DMEM/F12 (unit 15.1), 37°C
  • 2 M guanidine hydrochloride (GuHCl)
  • 5× cell culture lysis reagent (Promega)
  • Luciferase assay system (Promega)
  • 1.5‐ml tubes
  • 37°C heat block or water bath
  • Refrigerated centrifuge
  • NanoDrop spectrophotometer
  • 95°C heat block
  • Hemacytometer
  • Tissue culture microscope (inverted phase‐contrast)
  • Electroporator and 4‐mm cuvettes
  • 15‐ml conical tubes
  • 6‐well plates
  • 37°C, 5% CO 2 humidified incubator
  • Cell scraper
  • Additional reagents and equipment for gel electrophoresis (Voytas, )

Basic Protocol 5: In Vitro Translation and Replication (IVTR) Assay with S10 HeLa Extracts

  Materials
  • 10× NTP‐Rx buffer without UTP (see recipe)
  • 100 mM GuHCl
  • S10 HeLa extract (see protocol 6)
  • Initiation factors (see protocol 7)
  • DEPC‐treated water
  • In vitro–transcribed viral and/or replicon RNA (see protocol 4 and/or unit 15.1, protocol 1)
  • 5× cell culture lysis reagent (Promega)
  • Luciferase assay system (Promega)
  • Puromycin
  • 30 µCi 32P‐UTP (PerkinElmer)
  • TENSK buffer (see recipe)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol ( appendix 2A)
  • 3 M sodium acetate, pH 5.5 ( appendix 2A)
  • 70% and 99% (v/v) ethanol
  • 6× gel loading buffer (RNase‐free)
  • 0.8% agarose TBE gels and running buffer (Voytas, )
  • 1.5‐ml tubes
  • 30° and 42°C heat blocks or water baths
  • Refrigerated centrifuge
  • Gel vacuum
  • Quantitative imaging device (e.g., Typhoon phosphorImager)
  • Additional reagents and equipment for gel electrophoresis (Voytas, )
CAUTION: Radioactive materials require special handling; all supernatants must be considered radioactive waste and disposed of appropriately.

Support Protocol 1: Generation of S10 HeLa Extracts for IVTR Assay

  Materials
  • HeLa S3 cells (unit 15.1, Support Protocol 3)
  • Fetal bovine serum (FBS; appendix 2A)
  • Isotonic buffer (see recipe), ice cold
  • Hypotonic buffer (see recipe), ice cold
  • 10× extract buffer (see recipe)
  • Dialysis buffer I (see recipe), ice cold
  • 1 M CaCl 2 ( appendix 2A)
  • 150 U/µl S7 Micrococcal nuclease (Roche) in 1 mM Tris
  • 1 M EGTA
  • 50‐ and 500‐ml conical tubes
  • Centrifuge
  • 40‐ml glass Dounce homogenizer with tight pestle B (Bellco)
  • 14‐ml culture tubes
  • 5‐ml Slide‐A‐Lyzer cassette 10,000 MWCO (ThermoScientific)
  • 2‐liter beaker

Support Protocol 2: Generation of Initiation Factors for IVTR Assay

  Materials
  • HeLa S3 cells (unit 15.1, Support Protocol 3)
  • Fetal bovine serum (FBS; appendix 2A)
  • Isotonic buffer (see recipe), ice cold
  • Hypotonic buffer (see recipe), ice cold
  • 4 M KCl ( appendix 2A)
  • Dialysis buffer II (see recipe), ice cold
  • 50‐ and 500‐ml conical tubes
  • Centrifuge
  • 40‐ml glass Dounce homogenizer with tight pestle B (Bellco)
  • 14‐ml culture tubes
  • 25 × 38–mm Quick‐Seal polyallomar tubes (Beckman, cat. no. 343664)
  • Refrigerated centrifuge and Beckman JA‐20 rotor
  • Spectrophotometer
  • Magnetic stir plate and stir bar
  • 5‐ml Slide‐A‐Lyzer cassette 10,000 MWCO (ThermoScientific)
  • 2‐liter beaker
  • 1.5‐ml tubes

Basic Protocol 6: Assaying Replication by Strand‐Specific qPCR

  Materials
  • HeLa or HeLa S3 cells (unit 15.1, protocol 7)
  • 10% NCS DMEM/F12 (unit 15.1)
  • P0 or other infecting stocks of known titer
  • Serum‐free DMEM/F12 (unit 15.1)
  • PBS ( appendix 2A)
  • 2.5% NCS DMEM/F12 (unit 15.1), 37°C
  • Purelink RNA mini kit (Life Technologies) containing:
    • Cell lysis buffer
  • 2‐mercaptoethanol ( appendix 2A)
  • 70% (v/v) ethanol
  • Nuclease‐free water
  • 10 mM dNTP mix ( appendix 2A)
  • 5 µM RT primers (+strand_RT, −strand_RT; Table 15.2.1)
  • 200 U/µl SuperScript III RT (Life Technologies) containing:
    • 5× first‐synthesis buffer
    • 0.1 M DTT
  • 40 U/µl RNaseOUT (Life Technologies)
  • 10 U/µl ExonucleaseI and 10× ExonucleaseI buffer (Fermentas)
  • 2× Fast Mastermix (KAPA Biosystems)
  • 10 µM PCR primers (+strand_F, −strand_R, Tag; Table 15.2.1)
  • 24‐well plates
  • 37°C, 5% CO 2 humidified incubator
  • 1.5‐ml tubes
  • 37°, 55°, 70°, 80°C, and 95°C heat blocks or water baths
  • 20‐µl multichannel pipettor
  • Thermal cycler
    Table 5.0.1   MaterialsqPCR Primers

    Primer name Sequence
    +strand_RT GGCCGTCATGGTGGCGAATAAtgtgatggatccgggggtagcg
    −strand_RT GGCCGTCATGGTGGCGAATAAcatggcagccccggaacagg
    +strand_F Catggcagccccggaacagg
    −strand_R Tgtgatggatccgggggtagcg
    Tag GGCCGTCATGGTGGCGAATAA

Basic Protocol 7: Immunoprecipitation of PV Virions

  Materials
  • Dynabeads protein A (Life Technologies)
  • 1 µg/µl anti‐poliovirus type 1 monoclonal antibody (14D2, Pierce Biotechnology)
  • PBS containing 0.02% (v/v) Tween‐20
  • Experimental lysates (e.g., protocol 2, step 11)
  • PBS ( appendix 2A)
  • 50 mM glycine, pH 2.8
  • 1 M Tris⋅Cl, pH 7.5 ( appendix 2A)
  • 1 mg/ml RNaseA (Life Technologies)
  • Purelink RNA micro kit (Life Technologies)
  • Nuclease‐free water
  • 1.5‐ml tubes
  • DynaMag‐2 magnet (Life Technologies)
  • Tube rotator
  • 37°C heat block or water bath

Basic Protocol 8: Assaying Translation by Western Blot

  Materials
  • HeLa S3 cells (unit 15.1, protocol 7)
  • 10% NCS DMEM/F12 (unit 15.1)
  • Virus stock(s) to be analyzed
  • PBS ( appendix 2A)
  • 0.5% NP‐40 lysis buffer (see recipe)
  • 2× protein loading dye
  • SDS‐PAGE gels and running buffer ( appendix 3M)
  • 6‐well plates
  • 37°C, 5% CO 2 humidified incubator
  • Cell scraper
  • 1.5‐ml tubes
  • Centrifuge
  • Light microscope
  • Additional reagents and equipment for western blot (Gallagher, )

Basic Protocol 9: Assaying Translation by 35S‐Met Labeling

  Materials
  • HeLa or HeLa S3 cells (unit 15.1, protocol 7)
  • 10% NCS DMEM/F12 (unit 15.1)
  • Methionine‐ and cysteine‐free DMEM (Life Technologies, cat. no. 21013‐024)
  • EasyTag EXPRESS35S protein labeling mix (PerkinElmer)
  • Virus stocks of known titer to be assayed
  • Serum‐free DMEM/F12 (unit 15.1)
  • PBS ( appendix 2A)
  • Charcoal paper
  • PBS containing 1% (v/v) Triton X‐100
  • 2× protein loading dye
  • SDS‐PAGE gels and running buffer ( appendix 3M)
  • 10% (v/v) glycerol
  • 6‐well plates
  • 37°C and 5% CO 2 humidified incubator
  • NENSure charcoal trap (PerkinElmer)
  • Cell scraper
  • 1.5‐ml tubes
  • Centrifuge
  • 95°C heat block
  • Gel dryer
  • X‐ray film and cassettes
CAUTION: Radioactive materials require special handling; all supernatants must be considered radioactive waste and disposed of appropriately.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Andino, R., Rieckhof, G.E., Achacoso, P.L., and Baltimore, D. 1993. Poliovirus RNA synthesis utilizes an RNP complex formed around the 5′‐end of viral RNA. EMBO J. 12:3587‐3598.
   Barton, D.J., Black, E.P., and Flanegan, J.B. 1995. Complete replication of poliovirus in vitro: Preinitiation RNA replication complexes require soluble cellular factors for the synthesis of VPg‐linked RNA. J. Virol. 69:5516‐5527.
   Bienz, K., Egger, D., Troxler, M., and Pasamontes, L. 1990. Structural organization of poliovirus RNA replication is mediated by viral proteins of the P2 genomic region. J. Virol. 64:1156‐1163.
   Crotty, S., Saleh, M.C., Gitlin, L., Beske, O., and Andino, R. 2004. The poliovirus replication machinery can escape inhibition by an antiviral drug that targets a host cell protein. J. Virol. 78:3378‐3386.
   Crowther, D. and Melnick, J.L. 1961. Studies of the inhibitory action of guanidine on poliovirus multiplication in cell cultures. Virology 15:65‐74.
   De Jesus, N.H. 2007. Epidemics to eradication: The modern history of poliomyelitis. Virol. J. 4:70.
   Doedens, J.R., Giddings, T.H. Jr., and Kirkegaard, K. 1997. Inhibition of endoplasmic reticulum‐to‐Golgi traffic by poliovirus protein 3A: Genetic and ultrastructural analysis. J. Virol. 71:9054‐9064.
   Gallagher, S. 2010. Protein blotting: Immunoblotting. Curr. Protoc. Essential Lab. Techn. 4:8.3.1‐8.3.36.
   Hagino‐Yamagishi, K. and Nomoto, A. 1989. In vitro construction of poliovirus defective interfering particles. J. Virol. 63:5386‐5392.
   Herold, J. and Andino, R. 2000. Poliovirus requires a precise 5′ end for efficient positive‐strand RNA synthesis. J. Virol. 74:6394‐6400.
   Hogle, J.M., Chow, M., and Filman, D.J. 1985. Three‐dimensional structure of poliovirus at 2.9 Å resolution. Science 229:1358‐1365.
   Kaplan, G. and Racaniello, V.R. 1988. Construction and characterization of poliovirus subgenomic replicons. J. Virol. 62:1687‐1696.
   Kitamura, N., Semler, B.L., Rothberg, P.G., Larsen, G.R., Adler, C.J., Dorner, A.J., Emini, E.A., Hanecak, R., Lee, J.J., van der Werf, S., Anderson, C.W., and Wimmer, E. 1981. Primary structure, gene organization and polypeptide expression of poliovirus RNA. Nature 291:547‐553.
   Kuechler, E., Seipelt, J., Liebig, H.‐D., and Sommergruber, W. 2002. Picornavirus proteinase‐mediated shutoff of host cell translation: Direct cleavage of a cellular initiation factor. In Molecular Biology of Picornaviruses (B.L. Semler and E. Wimmer, eds.) pp. 301‐312. ASM Press, Washington, D.C.
   Lauring, A.S., Acevedo, A., Cooper, S.B., and Andino, R. 2012. Codon usage determines the mutational robustness, evolutionary capacity, and virulence of an RNA virus. Cell Host Microbe 12:623‐632.
   Mendelsohn, C.L., Wimmer, E., and Racaniello, V.R. 1989. Cellular receptor for poliovirus: Molecular cloning, nucleotide sequence, and expression of a new member of the immunoglobulin superfamily. Cell 56:855‐865.
   Mueller, S., Papamichail, D., Coleman, J.R., Skiena, S., and Wimmer, E. 2006. Reduction of the rate of poliovirus protein synthesis through large‐scale codon deoptimization causes attenuation of viral virulence by lowering specific infectivity. J. Virol. 80:9687‐9696.
   Pincus, S.E., Diamond, D.C., Emini, E.A., and Wimmer, E. 1986. Guanidine‐selected mutants of poliovirus: Mapping of point mutations to polypeptide 2C. J. Virol. 57:638‐646.
   Plaskon, N.E., Adelman, Z.N., and Myles, K.M. 2009. Accurate strand‐specific quantification of viral RNA. PLoS One 4:e7468.
   Racaniello, V.R. and Baltimore, D. 1981. Cloned poliovirus complementary DNA is infectious in mammalian cells. Science 214:916‐919.
   Ren, R.B., Costantini, F., Gorgacz, E.J., Lee, J.J., and Racaniello, V.R. 1990. Transgenic mice expressing a human poliovirus receptor: A new model for poliomyelitis. Cell 63:353‐362.
   Rightsel, W.A., Dice, J.R., McAlpine, R.J., Timm, E.A., McLean, I.W. Jr., Dixon, G.J., and Schabel, F.M. Jr. 1961. Antiviral effect of guanidine. Science 134:558‐559.
   Tolskaya, E.A., Romanova, L.I., Kolesnikova, M.S., Gmyl, A.P., Gorbalenya, A.E., and Agol, V.I. 1994. Genetic studies on the poliovirus 2C protein, an NTPase. A plausible mechanism of guanidine effect on the 2C function and evidence for the importance of 2C oligomerization. J. Mol. Biol. 236:1310‐1323.
   Vignuzzi, M., Wendt, E., and Andino, R. 2008. Engineering attenuated virus vaccines by controlling replication fidelity. Nat. Med. 14:154‐161.
   Vogt, D.A. and Andino, R. 2010. An RNA element at the 5′‐end of the poliovirus genome functions as a general promoter for RNA synthesis. PLoS Pathogens 6:e100936.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Zamora, M., Marissen, W.E., and Lloyd, R.E. 2002. Poliovirus‐mediated shutoff of host translation: An indirect effect. In Molecular Biology of Picornaviruses (B.L. Semler and E. Wimmer, eds.) pp. 313‐320. ASM Press, Washington, D.C.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library