Avian Bornaviruses: Diagnosis, Isolation, and Genotyping

Jianhua Guo1, Susan Payne1, Shuping Zhang2, Debra Turner1, Ian Tizard1, Paulette Suchodolski1

1 Department of Veterinary Pathobiology, Texas A&M University, College Station, Texas, 2 Veterinary Medical Diagnostic Laboratory, University of Missouri, Columbia, Missouri
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15I.1
DOI:  10.1002/9780471729259.mc15i01s34
Online Posting Date:  August, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

These protocols apply to all currently known genotypes of avian bornavirus (ABV). First, they include four basic protocols for molecular techniques that should enable an investigator to detect ABV infection in a live or dead bird. These include both reverse transcriptase and real‐time PCR assays. Second, they include three protocols enabling ABV infections to be diagnosed by serologic techniques including indirect immunofluorescence assays, western blotting, and enzyme‐linked immunoassays. Third, they also include methods by which ABV can be isolated from infected bird tissues by culture in primary duck embryo fibroblasts, as well as in other avian cell lines. Finally, as part of a diagnostic workup, any virus detected should be genotyped by sequencing, and a protocol for this is also provided. Curr. Protoc. Microbiol. 34:15I.1.1‐15I.1.33. © 2014 by John Wiley & Sons, Inc.

Keywords: avian bornaviruses; polymerase chain reaction; virus culture; immunofluorescence; western blotting; immunohistochemistry; genotyping

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Extraction of Viral RNA from Urofeces
  • Basic Protocol 2: Extraction of Viral RNA from Tissues
  • Basic Protocol 3: Two‐Step Reverse‐Transcription Polymerase Chain Reaction (RT‐PCR)
  • Support Protocol 1: Agarose Gel Electrophoresis
  • Basic Protocol 4: One‐Step Reverse Transcriptase Real‐Time PCR
  • Alternate Protocol 1: Two‐Step Real‐Time PCR
  • Basic Protocol 5: Western Blotting
  • Basic Protocol 6: Indirect Enzyme‐Linked Immunosorbent Assay for Diagnosis of ABV Infection
  • Basic Protocol 7: Immunohistochemistry for Detection of ABV in Paraffin‐Embedded Tissues
  • Basic Protocol 8: Establishment of Primary Duck Embryo Fibroblast Culture
  • Basic Protocol 9: ABV Isolation from Avian Tissues
  • Basic Protocol 10: Titration of ABV in Tissue Culture
  • Alternate Protocol 2: Fluorescence Focus Assay
  • Basic Protocol 11: Genotyping of ABV
  • Support Protocol 2: Production of Recombinant Antigen
  • Support Protocol 3: Production of a Cell Lysate Containing ABV Antigens
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Extraction of Viral RNA from Urofeces

  Materials
  • Dulbecco's phosphate‐buffered saline (DPBS) without calcium or magnesium (Gibco/Life Technologies, cat. no. 14190; also see recipe)
  • Individual urofecal or swab sample
  • QIAamp Viral RNA Mini Kit (Qiagen)
  • Aerosol‐barrier pipet tips
  • Centrifuge

Basic Protocol 2: Extraction of Viral RNA from Tissues

  Materials
  • Tissue samples of interest
  • RNeasy Mini Kit (Qiagen)
  • 70% ethanol
  • RNase‐free H 2O (e.g., DEPC‐treated; )
  • Negative RNA preparation control from a known ABV‐negative bird or, if not available, RNA from ABV‐negative duck embryo fibroblasts

Basic Protocol 3: Two‐Step Reverse‐Transcription Polymerase Chain Reaction (RT‐PCR)

  Materials
  • Applied Biosystems High Capacity cDNA synthesis kit (or equivalent) containing:
    • Reverse transcriptase (RT) buffer
    • Random primers
    • Deoxyribonucleotide triphosphates (dNTP) mix (100 mM), the source of nucleotides for the RT reaction
    • MultiScribe reverse transcriptase
    • RNase inhibitor
  • RNase‐free H 2O (e.g., DEPC‐treated; )
  • RNA solution from test sample (Basic Protocol protocol 11 or protocol 22)
  • Controls: ABV positive control RNA (positive control), the mock extraction RNA from protocol 1, and a cDNA reaction mix in which water replaces the RNA sample (negative controls)
  • Invitrogen Platinum Taq kit (or equivalent) containing:
    • 10× PCR buffer
    • 50 mM MgCl 2
    • 10 mM dNTP mix
    • Platinum Taq DNA polymerase
  • ABV primers (ABV primers are generally synthesized commercially and there are many excellent suppliers. They are generally supplied lyophilized within about 1 week. It is not necessary to purchase HPLC‐purified primers. In our experience, the following primer pairs generate optimal results. Obtained from Integrated DNA Technologies, these are reconstituted to 100 µl with H 2O, aliquotted, and frozen at −80°C. When ready for use, an aliquot is thawed and diluted to the appropriate working concentration):
    • ABV M Primer mix—used at a 0.2 µM each working concentration:
    • ABV M F (5′‐GGTAATTGTTCCTGGATGG‐3′)
    • ABV M R (5′‐ACACCAATGTTCCGAAGACG‐3′)
    • ABV N Primer mix—used at a 0.2 µM each working concentration:
    • ABV N F (5′‐GCGGTAACAACCAACCAGCAA‐3′)
    • ABV N R (5′‐GTTCATTAGTTTGCRAATCCRGTTA‐3′)
    • ABV P Primer mix—used at a 10 µM each initial concentration (we use a higher final concentration of these highly degenerate primers):
    • ABV P2 F (5′‐AAGAAGAAYCCYTCCATGATCTC‐3′)
    • ABV P3 R (5′‐TCCATCATCATBTTCATDGTYTC‐3′)
  • Thin‐walled 0.2‐ml PCR tubes
  • Thermal cycler
  • Additional reagents and equipment for agarose gel electrophoresis ( protocol 4)

Support Protocol 1: Agarose Gel Electrophoresis

  Materials
  • Agarose (Promega, cat. no. v3125)
  • TAE (Tris‐acetate‐EDTA) running buffer 10× concentrate (Sigma‐Aldrich)
  • Gel Red nucleic acid stain, water soluble (Biotium)
  • PCR products to be analyzed ( protocol 3)
  • Gel loading buffer (Invitrogen, cat. no. 10816‐015)
  • DNA ladder such as the Invitrogen PCR marker or the Bioline Hyper Ladder II (Bioline)
  • Electrophoresis apparatus, combs, trays
  • Ultraviolet light box
  • Alpha Imager or equivalent

Basic Protocol 4: One‐Step Reverse Transcriptase Real‐Time PCR

  Materials
  • TaqMan Fast Virus 1‐Step master mix (Life Technologies; or equivalent)
  • ABV TaqMan M or P primer/probe set (probes are synthesized commercially from a number of different manufacturers; we order our TaqMan probes and primers from Eurofins; primer sets are diluted in one tube at a concentration of 36 µM each.):
    • ABV M1F primer‐5′‐GGTAATTGTTCCTGGATGG‐3′ (36 µM)
    • ABV M2R primer‐5′‐GG[Y]TC[Y] [Y]TCACTGAAAGAAA[H]GG‐3′ (36 µM)
    • ABV M TaqMan Probe ‐5′ FAM‐CCAACAAAGTCTAT[Y]TCCA[R]C‐3′‐BHQ (10 µM)
    • ABV P9F primer‐5′‐AAGAAGAA[Y]CC[Y]TCCATGATCTC‐3′ (36 µM)
    • ABV P10R primer‐5′‐AA[Y]TGCCGAAT[B]A[R]GTCATC‐3′ (36 µM)
    • ABV P TaqMan Probe‐5′FAM‐TCGATAACTG [Y]TCCCTTCCGGTC‐3′‐BHQ (10 µM)
  • RNase‐free H 2O (e.g., DEPC‐treated; ) ABV RNA (From protocol 1)
  • Mock DPBS‐RNA extraction negative control sample (from protocol 1)
  • Negative control sample using H 2O instead of sample RNA
  • Real‐time plate and optical adhesive film or nuclease‐free thin‐walled 0.2 ml PCR strip tubes with real‐time grade optical strip cap
  • ABI 7900HT Fast Real‐Time PCR system
  • SDS 2.4 software

Alternate Protocol 1: Two‐Step Real‐Time PCR

  Additional Materials (also see protocols above)
  • Invitrogen 2× TaqMan Fast Advanced Master Mix (or equivalent)
  • ABV cDNA ( protocol 5)

Basic Protocol 5: Western Blotting

  Materials
  • Gel loading buffer (BioRad, cat. no. 161‐0737)
  • Prestained SDS‐PAGE standard (marker) covering the 6.5 to 200 kDa range for molecular weight estimation (BioRad)
  • Lysate ( protocol 16) of duck embryo fibroblasts (DEF) infected and noninfected with ABV ( protocol 10)
  • SDS‐PAGE running buffer (see recipe)
  • Coomassie blue R‐250 staining solution (BioRad)
  • 1× Coomassie blue destaining solution R‐250 (BioRad)
  • 100% methanol
  • Transfer buffer (see recipe)
  • Blocking buffer (see recipe)
  • Primary antibody: This is the plasma/serum under test; positive and negative control plasma samples must be included; the most convenient source of such antibodies is plasma from a confirmed case of PDD (Ouyang et al., ;). The 40 kDa nucleoprotein (N‐protein) is strongly immunodominant in such cases (Fig. ).
  • Secondary antibody: alkaline phosphatase (or horseradish peroxidase)–labeled goat anti–macaw IgY (Bethyl Laboratories)
  • Alkaline phosphatase detection substrate (we use SIGMAFAST BCIP/NBT tablets; one tablet prepares 10 ml of substrate solution; Sigma‐Aldrich) or horseradish peroxidase detection substrate (Sigma‐Aldrich, cat. no. D4293‐50SET)
  • Boiling water bath
  • Mini‐Protean II gel electrophoresis apparatus (Bio‐Rad).
  • Scalpel
  • Polyvinylidene fluoride (PVDF) sheet (Immobilon PVDF transfer membranes; Millipore)
  • Platform rocker
  • Additional reagents and equipment for SDS‐PAGE ( ), preparation of lysates containing ABV antigens ( protocol 16), and western blotting (immunoblotting; Gallagher et al., )

Basic Protocol 6: Indirect Enzyme‐Linked Immunosorbent Assay for Diagnosis of ABV Infection

  Materials
  • Recombinant ABV nucleoprotein produced in E. coli ( protocol 15)
  • Coating buffer (see recipe)
  • PBST: 0.05% (v/v) Tween‐20 in phosphate‐buffered saline (PBS; )
  • Blocking buffer: 3% (w/v) bovine serum albumin (BSA) in washing buffer (see recipe for washing buffer)
  • Primary antibody: this is the test serum/plasma
  • Known positive and known negative sera as controls
  • Secondary antibody: goat anti–macaw IgY (Bethyl Laboratories)
  • Rabbit anti‐goat IgG antibody–horseradish peroxidase conjugate
  • One‐step TM ultraTMB solution (Thermo Fisher Scientific)
  • 2 M sulfuric acid
  • 96‐well ELISA plate
  • ELISA washer
  • ELISA reader

Basic Protocol 7: Immunohistochemistry for Detection of ABV in Paraffin‐Embedded Tissues

  Materials
  • Paraffin‐embedded tissue blocks sectioned to 4 to 5 nm and floated onto glass microscope slides (Zeller, )
  • Xylene
  • Absolute ethanol
  • 95%, 80%, 75%, and 50% (v/v) ethanol
  • 0.01 M sodium citrate buffer, pH 6.0 (see recipe)
  • Dulbecco's phosphate‐buffered saline (DPBS) without calcium or magnesium (Gibco/Life Technologies, cat. no. 14190; also see recipe)
  • 3% (v/v) hydrogen peroxide solution
  • 10% (v/v) normal chicken serum or normal goat serum
  • Primary antibody: ABV anti‐N antibody (we use our own polyclonal preparation, which is made in chickens; this reagent is laboratory specific, but can be obtained from the authors of this unit as a courtesy) or ABV‐positive serum
  • Positive control: normal parrot serum
  • PBST: 0.05% (v/v) Tween‐20 in phosphate‐buffered saline (PBS; )
  • Secondary antibody: HRP‐ or AP‐conjugated goat anti‐chicken IgY or HRP‐ or AP‐conjugated goat anti‐macaw IgY (Bethyl Laboratories)
  • 0.4 mg/ml 3,3′‐diaminobenzidine (Sigma)
  • Hematoxylin stain (Sigma)
  • Mounting medium
  • Coplin jars
  • Coverslips

Basic Protocol 8: Establishment of Primary Duck Embryo Fibroblast Culture

  Materials
  • Specific‐pathogen‐free duck (mallard) eggs may be obtained from the USDA Avian Disease Laboratory (conventional duck eggs may be obtained from many different sources on‐line)
  • 70% ethanol
  • Dulbecco's phosphate‐ buffered saline (DPBS) without calcium or magnesium (Gibco/Life Technologies, cat. no. 14190); also (see recipe)
  • 0.05% trypsin‐EDTA (Gibco/Life Technologies)
  • Complete MEM medium (see recipe)
  • Freezing medium: 50% (v/v) fetal bovine serum (FBS) and 50% (v/v) of a mixture of complete MEM (see recipe) and 20% (v/v) dimethyl sulfoxide (DMSO; Hybri‐Max from Sigma‐Aldrich)
  • Model “1502” egg incubator (G.Q.F.)
  • Egg candler (e.g., Lyon Electric)
  • Stainless steel forceps and scissors (sterile)
  • Petri dish, polystyrene, 100 mm × 15 mm, sterile (Thermo Fisher Scientific)
  • 14‐ml polystyrene round‐bottom tubes, disposable, sterile (e.g., BD Falcon)
  • 75‐ml glass trypsinizing flasks (Wheaton)
  • Magnetic stir bars
  • Magnetic stirrers
  • Cheesecloth (VWR), sterile
  • Sterile beaker
  • 50‐ml Falcon conical polypropylene centrifuge tubes, sterile (e.g., BD Falcon)
  • Refrigerated centrifuge
  • Cryogenic vials (Nalgene, Thermo Fisher Scientific)
  • Nalgene Cryo 1°C Freezing Container
  • Additional reagents and equipment for reverse‐transcription PCR ( protocol 3)

Basic Protocol 9: ABV Isolation from Avian Tissues

  Materials
  • Bird tissues for testing
  • DEF (duck embryo fibroblast, prepared as in protocol 10) cells or QM7 (quail muscle clone 7; ATCC #CRL‐1962); ABV can persistently infect both these cell types without cytopathic effects.
  • MEM medium with 10% fetal bovine serum (FBS)
  • MEM medium with 2% fetal bovine serum (FBS) and 1× penicillin‐streptomycin (add from 100× concentrated pen/strep; e.g., Gibco/Life Technologies)0.05% trypsin‐EDTA (Gibco/Life Technologies)
  • MEM medium with 10% fetal bovine serum (FBS) and 1× penicillin‐streptomycin streptomycin (add from 100× concentrated pen/strep; e.g., Gibco/Life Technologies)
  • Syringe with 18‐G needle
  • 25‐cm2 vented culture flasks
  • Additional reagents and equipment for reverse transcription–polymerase chain reaction ( protocol 3) and western blotting ( protocol 7)

Basic Protocol 10: Titration of ABV in Tissue Culture

  Materials
  • Duck embryonic fibroblasts (DEF) tested and shown to be ABV‐free, grown in tissue culture flasks and frozen ( protocol 10)
  • Complete MEM medium (see recipe)
  • Dulbecco's phosphate‐buffered saline (DPBS) without calcium or magnesium (Gibco/Life Technologies, cat. no. 14190; also see recipe)
  • 0.05% trypsin‐EDTA (Gibco/Life Technologies)
  • ABV viral stock (prepared in laboratory)
  • 4% paraformaldehyde in DPBS without Ca or Mg (diluted from 16% paraformaldehyde stock solution; Alfa Aesar, cat. no. 43368)
  • 1% Triton X‐100 in DPBS without Ca or Mg
  • 5% dried milk in PBST
  • PBST: 0.05% (w/v) Tween‐20 in phosphate‐buffered saline (PBS; )
  • Primary antibody: ABV anti‐N antibody (prepared in laboratory) or ABV‐positive plasma/serum
  • Secondary antibody: HRP or AP conjugated goat anti‐chicken IgY or HRP or AP conjugated goat anti‐macaw IgY (Bethyl Laboratories)
  • Normal bird serum/plasma (usually chicken)
  • Alkaline phosphatase detection substrate (we use SIGMAFAST BCIP/NBT tablets; one tablet prepares 10 ml of substrate solution; Sigma‐Aldrich)
  • 75‐cm2 tissue culture flasks
  • Hemacytometer
  • 24‐well tissue culture plates
  • 14‐ml snap‐cap tubes
  • Platform rocker
  • Humidified chamber: small Tupperware container or slide box containing moistened Kimwipes

Alternate Protocol 2: Fluorescence Focus Assay

  Additional Materials (also see protocol 12)
  • Secondary antibody: FITC‐conjugated goat anti‐macaw IgY (Bethyl Laboratories)
  • 1% (v/v) Triton X‐100 in DPBS without Ca or Mg
  • ProLong Antifade reagent (Invitrogen; optional)
  • Fluorescence microscope

Basic Protocol 11: Genotyping of ABV

  Materials
  • QIAquick PCR Purification Kit (Qiagen) including spin columns, buffers, and collection tubes for the purification of PCR products from gels
  • Isopropanol
  • Scalpel blades for excising the PCR product from the agarose gel
  • 50°C water bath or heat block
  • Sequencing facility
  • Additional reagents and equipment for RT‐PCR ( protocol 3) and agarose gel electrophoresis ( protocol 4)

Support Protocol 2: Production of Recombinant Antigen

  Additional Materials (also see Basic Protocols protocol 22 and protocol 33)
  • DEFs infected with ABV
  • Primer set: forward 5′‐CATG CAT ATG CCA CCC AAG AGA CAA AGA AGC and reverse 5′‐ GT AC CTC GAG GTT TGC GAA TCC GGT TAC ACC.
  • pET21 vector (Novagen, cat. no. 69740)
  • Rosetta strain E. coli (Novagen, cat. no. 70236)
  • Ni‐NTA agarose (Qiagen)
  • Sepharose CL‐4B column (GE Healthcare)
  • Additional reagents and equipment for RNA extraction ( protocol 2), RT‐PCR ( protocol 3), molecular biological techniques including cloning, transformation, protein expression, and Sepharose CL‐4B column chromatography (Ausubel et al., ), and Ni‐NTA affinity chromatography (Petty, ),

Support Protocol 3: Production of a Cell Lysate Containing ABV Antigens

  Materials
  • DEF cultures ( protocol 10; ABV‐infected and noninfected control) growing in 25‐cm2 flasks
  • Dulbecco's phosphate‐ buffered saline (DPBS) without calcium or magnesium (Gibco/Life Technologies, cat. no. 14190); also see recipe
  • 0.25% trypsin‐EDTA (Gibco/Life Technologies)
  • Lysis buffer (Tissue extraction Reagent 1; Invitrogen, cat. no. FNN0071A)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Ausubel, F.M. , Brent, R. , Kingston, R.E. , Moore, D.D. , Seidman, J.G. , Smith, J.A. , and Struhl, K. (eds). 2014. Current Protocols in Molecular Biology. John Wiley & Sons, New York.
   Brismar, J. 1991. Understanding receiver‐operating‐characteristic curves: A graphic approach. Am. J. Roentgenol. 157:1119‐1121.
   Delnatte, P. , Mak, M. , Ojkic, D. , Thagav, R. , DeLay, J. , and Smith, D.A. 2014. Detection of avian bornavirus in multiple tissues of infected psittacine birds using real‐time reverse transcription polymerase chain reaction. J. Vet. Diagn. Invest. 26:266‐271.
   Gallagher, S. , Winston, S. E. , Fuller, S. A. , and Hurrell, J. G. 2008. Immunoblotting and immunodetection. Curr. Protoc. Mol. Biol. 83:10.8.1–10.8.28.
   Gancz, A.Y. , Clubb, S. , and Shivaprasad, H.L. 2010. Advanced diagnostic approaches and current management of proventricular dilatation disease. Vet. Clin. North Am. Exot. Anim. Pract. 13:471‐494.
   Honkavuori, K.S. , Shivaprasad, H.L. , Williams, B.L. , Quan, P.L. , Hornig, M. , Street, C. , Palacios, G. , Hutchison, S.K. , Franca, M. , Egholm, M. , Briese, T. , and Lipkin, W.I. 2008. Novel borna virus in psittacine birds with proventricular dilatation disease. Emerg. Infect. Dis. 14:1883‐1886.
   Hoppes, S. , Gray, P.L. , Payne, S. , Shivaprasad, H.L. , and Tizard, I. 2010. The isolation, pathogenesis, diagnosis, transmission, and control of avian bornavirus and proventricular dilatation disease. Vet. Clin. North Am. Exot. Anim. Pract. 13:495‐508.
   Horie, M. , Honda, T. , Suzuki, Y. , Kobayashi, Y. , Oshida, T. , Ikuta, K. , Jern, P. , Gojobori, T. , Coffin, J.M. , and Tomonaga, K. 2010. Endogenous non‐retroviral RNA virus elements in mammalian genomes. Nature 463:84‐87.
   Kistler, A.L. , Gancz, A. , Clubb, S. , Skewes‐Cox, P. , Fischer, K. , Sorber, K. , Chiu, C.Y. , Lublin, A. , Mechani, S. , Farnoushi, Y. , Greninger, A. , Wen, C.C. , Karlene, S.B. , Ganem, D. , and DeRisi, J.L. 2008. Recovery of divergent avian bornaviruses from cases of proventricular dilatation disease: Identification of a candidate etiologic agent. Virol. J. 5:88.
   Ladunga, I. 2009. Finding similar nucleotide sequences using network BLAST searches. Curr. Protoc. Bioinform. 26:3.3.1‐3.3.26.
   Lipkin, W.I. , Briese, T. , and Hornig, M. 2011. Borna disease virus—Fact and fantasy. Virus Res. 162:162‐172.
   Matsumoto, Y. , Hayashi, Y. , Omori, H. , Honda, T. , Daito, T. , Horie, M. , Ikuta, K. , Fujino, K. , Nakamura, S. , Schneider, U. , Chase, G. , Yoshimori, T. , Schwemmle, M. , and Tomonaga, K. 2012. Bornavirus closely associates and segregates with host chromosomes to ensure persistent intranuclear infection. Cell Host Microbe 11:492‐503.
   Narayan, O. , Herzog, S. , Frese, K. , Scheefers, H. , and Rott, R. 1983. Pathogenesis of Borna disease in rats: Immune‐mediated viral ophthalmoencephalopathy causing blindness and behavioral abnormalities. J. Infect. Dis. 148:305‐315.
   Ouyang, N. , Storts, R. , Tian, Y. , Wigle, W. , Villanueva, I. , Mirhosseini, N. , Payne, S. , Gray, P. , and Tizard, I. 2009. Histopathology and the detection of avian bornavirus in the nervous system of birds diagnosed with proventricular dilatation disease. Avian Pathol. 38:393‐401.
   Payne, S.L. , Delnette, P. , Guo, J. , Heatley, J.J. , Tizard, I. , and Smith, D.L. 2012. Birds and Bornaviruses. Anim. Health Rev. Rep. 13:145‐156.
   Petty, K.J. 1996. Metal‐chelate affinity chromatography. Curr. Protoc. Prot. Sci. 4:9.4.1–9.4.16.
   Rinder, M. , Ackermann, A. , Kempf, H. , Kaspers, B. , Korbel, R. , and Staeheli, P. 2009. Broad tissue and cell tropism of Avian Bornavirus in parrots with proventricular dilatation disease. J. Virol. 83:5401‐5407.
   Rott, R. , Herzog, S. , Fleischer, B. , Winokur, A. , Amsterdam, J. , Dyson, W. , and Koprowski, H. 1985. Detection of serum antibodies to Borna disease virus in patients with psychiatric disorders. Science 228:755‐756.
   Towbin, H. , Staehelin, T. , and Gordon, J. 1989. Immunoblotting in the clinical laboratory. J. Clin. Chem. Clin. Biochem. 27:495‐501.
   Villanueva, I. , Gray, P. , and Tizard, I. 2008. Detection of an antigen specific for proventricular dilation disease in psitticine birds. Vet. Rec. 163:426.
   Zeller, R. 1989. Fixation, embedding, and sectioning of tissues, embryos, and single cells. Curr. Protoc. Mol. Biol. 7:14.1.1–14.1.8.
Key References
   de Kloet, A.H. , Kerski, A. , and deKloet, S.R. 2011. Diagnosis of Avian bornavirus infection in psittaciformes by serum antibody detection and reverse transcription polymerase chain reaction assay using feather calami. J. Vet. Diagn. Invest. 23:421‐429.
  A useful review, especially as it pertains to the use of feather calami as a source of diagnostic samples.
   Gray, P. , Hoppes, S. , Suchodolski, P. , Mirhosseini, N. , Payne, S. , Villanueva, I. , Shivaprasad, H.L. , Honkavuori, K.S. , Lipkin, W.I. , Briese, T. , Reddy, S.M. , and Tizard, I. 2010. Use of avian bornavirus isolates to induce proventricular dilatation disease in conures. Emerg. Infect. Dis. 16:473‐479.
  The paper that demonstrated the fulfilment of Koch's postulates and thus confirmed that ABV is the causal agent of PDD.
   Herzog, S. , Enderlein, D. , Heffels‐Redmann, U. , Piepenbring, A. , Neumann, D. , Kaleta, E.F. , Muller, H. , Lierz, M. , and Herden, C. 2010. Indirect immunofluorescence assay for intra vitam diagnosis of avian bornavirus infection in psittacine birds. J. Clin. Microbiol. 48:2282‐2284.
  An excellent analysis regarding the use of the indirect immunofluorescence assay for the serodiagnosis of ABV infection.
   Rubbenstroth, D. , Rinder, M. , Kaspers, B. , and Staeheli, P. 2012. Efficient isolation of avian bornaviruses (ABV) from naturally infected psittacine birds and identification of a new ABV genotype from a salmon‐crested cockatoo (Cacatua moluccensis). Vet. Microbiol. 161:36‐42.
  A review describing methods of isolating ABV from infected birds.
   Villanueva, I. , Gray, P. , Mirhosseini, N. , Payne, S. , Hoppes, S. , Honkavuori, K.S. , Briese, T. , Turner, D. , and Tizard, I. 2010. The diagnosis of proventricular dilatation disease: Use of a Western blot assay to detect antibodies against avian Borna virus. Vet. Microbiol. 143:196‐201.
  An analysis of the use of the western blot assay for the detection of antibodies to ABV in infected birds.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library