Human Norovirus Detection and Production, Quantification, and Storage of Virus‐Like Particles

Kari Debbink1, Veronica Costantini2, Jesica Swanstrom1, Sudhakar Agnihothram1, Jan Vinjé2, Ralph Baric1, Lisa Lindesmith1

1 University of North Carolina, Chapel Hill, North Carolina, 2 Centers for Disease Control, Atlanta, Georgia
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15K.1
DOI:  10.1002/9780471729259.mc15k01s31
Online Posting Date:  November, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Human noroviruses constitute a significant worldwide disease burden. Each year, noroviruses cause over 267 million infections, deaths in over 200,000 children under the age of five, and over 50% of U.S. food‐borne illness. Due to the absence of a tissue culture model or small animal model to study human norovirus, virus‐like particles (VLPs) and ELISA‐based biological assays have been used to answer questions about norovirus evolution and immunity as well to provide a potential vaccine platform. This chapter outlines the protocols for norovirus detection in stool, as well as norovirus VLP design, production, purification, and storage using a Venezuelan equine encephalitis virus (VEE)–based virus replicon particle (VRP) expression system. Curr. Protoc. Microbiol. 31:15K.1.1‐15K.1.45. © 2013 by John Wiley & Sons, Inc.

Keywords: norovirus; virus‐like particle; virus replicon particle; Venezuelan equine encephalitis virus; virus‐like particle purification

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Duplex Real‐Time RT‐PCR for Detection of Human Norovirus Genogroup I and II
  • Support Protocol 1: Norovirus RNA Extraction from Stool Samples (Automatic Method)
  • Basic Protocol 2: Amplification of Norovirus ORF‐2 and ORF‐3 by Long RT‐PCR
  • Basic Protocol 3: TOPO TA Cloning ORF2/ORF3 into Plasmid Vector
  • Support Protocol 2: Plasmid DNA Purification and Insert Verification
  • Basic Protocol 4: Cloning of Norovirus Capsid Gene into the Virus Replicon Vector (Adding VEE Linkers Through PCR)
  • Alternate Protocol 1: Cloning of Norovirus Capsid Gene into the Virus Replicon Vector where Synthesized DNA Already Contains VEE Linkers
  • Support Protocol 3: Transformation of Competent Cells
  • Basic Protocol 5: Production of Stock Norovirus Recombinant Virus Replicon Particles
  • Support Protocol 4: Production of RNA for Making VRPs
  • Support Protocol 5: Verification of RNA Production by Gel Analysis
  • Support Protocol 6: Electroporation of BHK‐21 Cells with RNA
  • Support Protocol 7: Harvesting VRPs
  • Support Protocol 8: Purifying VRPs
  • Support Protocol 9: Safety Testing VRPs
  • Support Protocol 10: Determine Titer of VRPs
  • Basic Protocol 6: Production of Virus‐Like Particles from Replicons
  • Basic Protocol 7: Purification of Norovirus Virus‐Like Particles
  • Support Protocol 11: Validation of VLP Production
  • Basic Protocol 8: Quantification of Virus‐Like Particles
  • Basic Protocol 9: Storage of Virus‐Like Particles
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Duplex Real‐Time RT‐PCR for Detection of Human Norovirus Genogroup I and II

  Materials
  • AgPath‐ID One‐Step RT‐PCR Kit (Life Technologies, cat. no. AM1005) containing:
    • 2× RT‐PCR buffer
    • 25× RT‐PCR enzyme mix
    • Detection enhancer
    • Nuclease‐free water
  • Real‐time RT‐PCR oligonucleotide primers and TaqMan probes for GI and GII norovirus (Table 15.1.1 and Fig. )
  • RNA (See protocol 2)
  • Sterile 1.5‐ml microcentrifuge tubes, nuclease‐free
  • MicroAmp optical 96‐well reaction plate (Life Technologies, cat. no. N801‐0560)
  • MicroAmp optical adhesive film (Life Technologies, cat. no. 4311971)
  • Applied Biosystems 7500 real‐time PCR system (Life Technologies)
Table 5.0.1   MaterialsPrimers and Probes Used in Real‐Time RT‐PCR and ORF‐2/ORF‐3 Long RT‐PCR

Primers and probes Sequence (5′ to 3′) a Position b
Real‐time RT‐PCR primers and TaqMan probes
Cog 1F CGYTGGATGCGITTYCATGA 5276
Cog 1R CTTAGACGCCATCATCATTYAC 5343
Cog 2F CARGARBCNATGTTYAGRTGGATGAG 5003
Cog 2R TCGACGCCATCTTCATTCACA 5080
Ring 1C c FAM/AGATYGCGITCICCTGTCCA/BHQ 5314
Ring 2 d QUA/TGGGAGGGCGATCGCAATCT/BHQ 5048
ORF‐2/ORF3 primers
PanGIR 1 GGCARYCTWTCWGTATTRAAA 7119
PanGIIR 1 GTCCAGGAGTCCAAAA 7428
G1SKR CCAACCCARCCATTRTACA 5638
G2SKR CCRCCNGCATRHCCRTTRTACAT 5373
Ring2PCR TGGGAGGGCGATCGCAATCT 5048
Ring1APCR TGGACAGGRGATCGCRATCT 5306

 aY = C,T; I = inosine; R = A,G; B = C,G,T; N = A,C,G,T; W = A,T.
 bNucleotide positions for real‐time RT‐PCR and ORF‐2/ORF‐3 long RT‐PCR were taken from reference NoV strains in genogroups GI (Norovirus Hu/GI.1/Norwalk/1968/USA, Genbank accession no. AF093797) and GII (Norovirus Hu/GII.4/New Orleans/2010/USA GenBank accession no. JN595867).
 cGI TaqMan probe is 5′‐labeled with 6‐carboxyfluorescein (FAM) and 3′‐labeled with Black Hole quencher; Black Hole Quencher 1 is preferred.
 dGII TaqMan probe is 5′‐labeled with Quasar 670 or Cy5 and 3′‐labeled with Black Hole quencher; Black Hole Quencher 3 is preferred.

Support Protocol 1: Norovirus RNA Extraction from Stool Samples (Automatic Method)

  Materials
  • 10 mM phosphate‐buffered saline (PBS), pH 7.0 to 7.4 (see recipe)
  • Stool sample
  • MagMAX‐96 Viral RNA Isolation Kit (Life Technologies, cat. no. 1835) including:
    • Lysis/binding solution concentrate
    • Wash solution 1 concentrate
    • Wash solution 2 concentrate
    • Elution buffer
    • RNA binding beads
    • Carrier RNA
    • Lysis/binding enhancer
  • 100% ethanol, ACS grade or better, as diluent for kit reagents
  • 100% isopropanol, ACS grade or better, as diluent for kit reagents
  • Transfer pipet or sterile sticks
  • KingFisher plate. 200 µl (Thermo Scientific, cat. no. 97002084)
  • KingFisher tip comb (Thermo Scientific, cat. no. 97002070)
  • KingFisher magnetic particle processor (Thermo Scientific, cat. no. 5400000)

Basic Protocol 2: Amplification of Norovirus ORF‐2 and ORF‐3 by Long RT‐PCR

  Materials
  • ORF‐2/ORF‐3 oligonucleotide primers for GI or GII norovirus (Table 15.1.1 and Fig. )
  • 10 mM dNTP mix (Life Technologies, cat. no. AM8200)
  • Nuclease‐free water (Life Technologies, cat. no. AM9937)
  • RNA (see protocol 2)
  • SuperScript II reverse transcriptase (Life Technologies, cat. no. 18080‐022) including:
    • SuperScript II reverse transcriptase
    • 5× first‐strand buffer
    • 0.1 M DTT
  • RNase inhibitor (Life Technologies, cat. no. N808‐0119)
  • RNase ONE ribonuclease (Promega, cat. no. M4261)
  • DNA Clean & Concentrator‐5 (Zymo Research, cat. no. D4013) including:
    • DNA Binding Buffer
    • DNA Elution Buffer
    • DNA Wash Buffer
    • Zymo Spin Columns
    • 2‐ml Collection Tubes
  • Phusion High Fidelity PCR kit (Thermo Scientific, cat. no. F‐531S) including:
    • 2× Phusion HF buffer
    • Phusion high fidelity DNA polymerase
    • dNTP mix: 400 µM each dNTP
    • DMSO
  • ORF‐2/ORF‐3 oligonucleotide primers for Ring2PCR and PanGIIR 1 (Table 15.1.1 and Fig. )
  • Quick‐Load 1 Kb DNA ladder (BioLabs, cat. no. N0468S) or any other comparable molecular weight DNA standards)
  • 0.7% agarose gel (Voytas, ) in 1× TAE containing GelRed (1:10.000 dilution)
  • QIAquick Gel Extraction Kit (Qiagen)
  • 0.2‐ml thin‐walled PCR/RT‐PCR tubes
  • GeneAmp 9700 PCR thermal cycler (Life Technologies) or similar instrument
  • UV transilluminator
  • Dark Reader DR46B transilluminator (Clare Chemical Research, Inc., cat. no. DR456B)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Basic Protocol 3: TOPO TA Cloning ORF2/ORF3 into Plasmid Vector

  Materials
  • ORF2‐ORF3 PCR product (see protocol 3)
  • Taq DNA polymerase, recombinant (Life Technologies, cat. no. 10342‐020) including:
    • 10× PCR buffer
    • 50 mM MgCl 2
    • Taq DNA polymerase, recombinant
  • 10 mM ATP (Life Technologies, cat. no. AM8110G)
  • TOPO TA Cloning Kit Dual Promoter (Life Technologies, cat. no. K460040) including:
    • pCR II‐TOPO vector
    • 10× PCR buffer
    • Salt Solution
    • 12.5 mM dNTP Mix
    • 0.1 µg/µl M13 Forward (−20) oligonucleotide primer
    • 0.1 µg/µl M13 Reverse oligonucleotide primer
    • 0.1 µg/µl Control Template
    • 0.1 µg/µl Control PCR oligonucleotide primers
    • Nuclease‐free H 2O
  • One Shot TOP10 competent cells (Life Technologies, cat. no. C404003) including:
    • SOC. medium
    • TOP10 cells
    • pUC19 control DNA
  • 40 µg/ml Xgal (Promega, cat. no. PR‐V3941)
  • LB agar plates containing 100 µg/ml ampicillin (see recipe; use gridded plate for step 19)
  • LB broth containing 100 µg/ml ampicillin (see recipe)
  • DNA suspension buffer (Teknova, cat. no. T0220)
  • Taq DNA polymerase (Roche, cat. no. 11418432001) including:
    • 10× PCR buffer w/MgCl 2
    • Taq DNA polymerase
  • 2% agarose gel in 1× TAE buffer (Voytas, )
  • 0.2 ml thin‐walled PCR/RT‐PCR tubes
  • GeneAmp 9700 PCR thermal cycler (Life Technologies) or similar instrument
  • 42°C water bath
  • Rotary shaker
  • Autoclaved toothpicks
  • VWR digital dry block heaters (VWR, cat. no. 12621‐084) or similar instruments
  • 14‐ml conical tubes (e.g., BD Falcon)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Support Protocol 2: Plasmid DNA Purification and Insert Verification

  Materials
  • Bacteria containing plasmid and initially propagated in LB broth containing 100 µg/ml ampicillin ( protocol 4, step 31)
  • DNA suspension buffer (Teknova, cat. no. T0220)
  • Zyppy plasmid miniprep kit (Zymo Research, cat. no. D4019) including:
    • 7× lysis buffer
    • Neutralization buffer
    • Endo‐wash buffer
    • Zyppy wash buffer
    • Zyppy elution buffer
    • RNase A
    • Zymo‐Spin IIN columns
    • Collection tubes
  • ORF‐2/ORF‐3 oligonucleotide primers for PanGIR 1 and Ring1A for GI or PanGIIR 1 and Ring2PCR for GII (Table 15.1.1 and Fig. )
  • TOPO TA Cloning Kit Dual Promoter (Life Technologies, cat. no. K460040) including:
    • pCR II‐TOPO vector
    • 10× PCR buffer
    • Salt Solution
    • 12.5 mM dNTP Mix
    • 0.1 µg/µl M13 Forward (−20) oligonucleotide primer
    • 0.1 µg/µl M13 Reverse oligonucleotide primer
    • 0.1 µg/µl Control Template
    • 0.1 µg/µl Control PCR oligonucleotide primers
    • Nuclease‐free H 2O
  • Glycerol
  • 1.8-ml cryogenic vials, sterile
  • Additional reagents and equipment for TOPO TA cloning ( protocol 4)

Basic Protocol 4: Cloning of Norovirus Capsid Gene into the Virus Replicon Vector (Adding VEE Linkers Through PCR)

  Materials
  • Expand High Fidelity PCR Kit (Roche)
  • Norovirus capsid pDNA ( protocol 4)
  • PCR oligonucleotide primers (VEE primers pVR6199 and V7564 and sequence‐specific norovirus capsid forward oligonucleotide primer with VEE linker and reverse oligonucleotide primer with AscI site)—see Table 15.1.2
  • 10 mM dNTPs (10 mM each dNTP; included in Expand HF PCR kit; also see appendix 2A)
  • DEPC‐treated H 2O (included in Expand HF PCR kit; also see appendix 2A)
  • 0.8% agarose gel in 1× TAE buffer with 0.5 µg/ml ethidium bromide (Voytas, )
  • Qiagen QIAquick Gel Extraction kit (Qiagen)
  • LB medium and LB plates (see recipes) with and without selection antibiotic (we use carbenicillin or ampicillin)
  • Qiagen QIAprep Miniprep Kit (Qiagen)
  • 10× NEBuffer 4 (New England Biolabs)
  • 100× BSA (New England Biolabs)
  • NEBuffer 4 (New England Biolabs)
  • ApaI and AscI restriction enzymes (NEB)
  • pVR21 plasmid (not commercially available; go to GenBank for sequence; can be synthesized by BioBasic)
  • NEBuffer3 (New England Biolabs)
  • Calf intestinal phosphatase (CIP; New England Biolabs)
  • T4 DNA ligase (New England Biolabs)
  • Chemically competent E. coli, either lab‐made ( appendix 3L) or commercially purchased (also see protocol 10)
  • Sequencing primers (see annotation to step 27)
  • Sterile PCR tubes
  • Thermal cycler
  • Dark Reader DR46B transilluminator (Clare Chemical Research, Inc., cat. no. DR456B)
  • Heat blocks
  • 10‐ and 50‐ml conical tubes (e.g., BD Falcon)
  • Centrifuge
  • Disposable scalpel blades
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), TOPO TA cloning ( protocol 4), transformation of competent cells ( protocol 8), and DNA sequencing (Ausubel et al., , Chapter 7)
Table 5.0.2   MaterialsPrimers for Adding VEE Linkers to the Norovirus Capsid

Primer name Construct Direction Sequence Use a
G1s2V GII.4‐2006 Forward AGTCTAGTCCGCCAAGATGAAGATGGCGTCGAATGACGCCAACC Adding the VEE linker sequence to the beginning of the NoV capsid gene
DHa2V GII.4‐2006 Reverse CGTTAGCAGGCGCGCCTTATAAAGCACGTCTACGCCCCGTTCCA Adding an AscI site at the end of the capsid gene
pVR6199 VEE Forward CAAAGCTGCGCAGCTTTCC PCR amplifies the VEE piece needed for overlap PCR with NoV capsid
V7564 VEE Reverse CATCTTGGCGGACTAGACTATGTCGTAGTCCATTCAGGTTAGCCG PCR amplifies the VEE piece needed for overlap PCR with NoV capsid

 aNoV: norovirus.

Alternate Protocol 1: Cloning of Norovirus Capsid Gene into the Virus Replicon Vector where Synthesized DNA Already Contains VEE Linkers

  Materials
  • Synthesized norovirus capsid pDNA, available from BioBasic (http://store.biobasic.com/)
  • DEPC‐treated H 2O ( appendix 2A)
  • Chemically competent E. coli, either lab‐made ( appendix 3L) or commercially purchased (also see protocol 10)
  • LB medium and plates with and without selection antibiotics (see recipe)
  • pVR21‐expressing E. coli if purified pDNA is not available
  • Agar plates with appropriate selection antibiotic
  • Beaker with bleach
  • QIAprep Miniprep Kit (Qiagen)
  • Plasmid pVR21 (not commercially available)
  • NEBuffer 4 (New England Biolabs)
  • 100× BSA (New England Biolabs)
  • AscI and ApaI restriction enzymes (New England Biolabs)
  • Calf intestinal phosphatase (CIP; New England Biolabs)
  • 10‐ and 50‐ml conical tubes (e.g., BD Falcon)
  • Shaker that accommodates conical tubes (28° to 37°C)
  • Centrifuge that accommodates conical tubes
  • QIAquick Gel Extraction Kit
  • Additional reagents and equipment for transformation of competent cells (see protocol 10)

Support Protocol 3: Transformation of Competent Cells

  Materials
  • Chemically competent E. coli (purchased or prepared; see appendix 3L for preparation)
  • Plasmid DNA
  • LB medium (see recipe) without antibiotics
  • LB agar plates (see recipe) with 100 µg/ml carbenicillin or ampicillin
  • 42°C heat block
  • Glass spreading rod
  • Rocker

Basic Protocol 5: Production of Stock Norovirus Recombinant Virus Replicon Particles

  Materials
  • Plasmid DNA: capsid gene in pVR21, 3526 Capsid helper, 3526 Envelope glycoprotein helper
  • NEBuffer 3 (New England Biolabs)
  • 100× BSA (New England Biolabs)
  • NotI restriction enzyme (New England Biolabs)
  • Qiagen QIAquick Gel Extraction Kit (use PCR purification protocol, which is also included with this kit)
  • Ambion mMessage mMachine T7 Transcription Kit (Life Technologies; also see protocol 10)
  • Additional reagents and equipment for production of RNA ( protocol 10), verification of RNA production ( protocol 11), electroporation of BHK‐21 cells with RNA ( protocol 12), harvesting VRPs ( protocol 13), purifying VRPs ( protocol 14), safety testing of VRPs ( protocol 15), and titering of VRPs ( protocol 16)

Support Protocol 4: Production of RNA for Making VRPs

  Materials
  • RNaseZap (Life Technologies)
  • Ambion mMessage mMachine T7 Transcription Kit (Life Technologies) including:
    • 10× reaction buffer
    • 2× NTP/CAP
    • GTP
    • T7 enzyme mix
  • NotI‐digested plasmid DNA (pVR21 construct, 3526 Capsid helper, 3526 Envelope glycoprotein helper; see protocol 9, step 2; the pVR21 sequence is published; see GenBank accession AY741139.1; pVR21 can be synthetically constructed by BioBasic—a publication with the 3526 capsid helper and envelope glycoprotein helper sequences is in preparation)
  • Sterile PCR tubes
  • Filter pipet tips
  • Thermal cycler

Support Protocol 5: Verification of RNA Production by Gel Analysis

  Materials
  • 1.65 liters 1× TAE buffer ( appendix 2A)
  • 10% (w/v) SDS stock solution ( appendix 2A)
  • Agarose, ultrapure
  • RNA (see protocol 10, step 5)
  • 0.1% (w/v) SDS/2 mM EDTA, pH 8.0
  • 6× loading dye (Promega)
  • 1 kb DNA marker
  • 10 mg/ml ethidium bromide
  • Ethidium bromide destaining teabags (Mo Bio Laboratories, http://www.mobio.com)
  • Gel box with small comb (see Voytas, )
  • Thermal cycler
  • Pyrex dish (gel must fit inside during destaining)
  • Rocker
  • UV gel reader
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )

Support Protocol 6: Electroporation of BHK‐21 Cells with RNA

  Materials
  • BHK‐21 cells (ATCC no. CCL‐10)
  • BHK‐21 medium (see recipe)
  • Phosphate‐buffered saline (PBS; appendix 2A), sterile, cold
  • 0.05% trypsin‐EDTA (e.g., Invitrogen)
  • Construct RNA and capsid and E glycoprotein helper RNA that was prepared in protocol 10
  • Filter pipet tips
  • 175‐cm2 (T‐175) and 75‐cm2 (T‐75) cell culture–treated flasks
  • 50‐ml conical tubes (e.g., BD Falcon)
  • 0.4‐cm electroporation cuvettes (BioRad)
  • Gene Pulser (BioRad)
  • Additional reagents and equipment for counting viable cells (unit 15.4)

Support Protocol 7: Harvesting VRPs

  Materials
  • Flasks of VRP‐containing cells ( protocol 12)
  • BHK‐21 medium (see recipe)
  • 10‐ml and 50‐ml conical tubes
  • Refrigerated centrifuge

Support Protocol 8: Purifying VRPs

  Materials
  • 20% sucrose in cold PBS, sterile filtered
  • Clarified supernatant containing VRPs ( protocol 13)
  • Ethanol
  • Vesphene
  • Phosphate‐buffered saline (PBS; appendix 2A)
  • Bleach
  • Filter pipet tips
  • 25 × 89–mm Ultra‐Clear Beckman ultracentrifuge tubes (Beckman)
  • Ultracentrifuge with SW28 rotor (Beckman)
  • Digital scale for weighing rotors
  • Additional reagents and equipment for determining titer of VRPs ( protocol 16)

Support Protocol 9: Safety Testing VRPs

  Materials
  • BHK‐21 cells (ATCC no. CCL‐10)
  • BHK‐21 medium (see recipe)
  • Electroporation medium (collected during step 5 of protocol 13)
  • 0.5% crystal violet solution (see recipe)
  • 175‐cm2 cell culture–treated flasks
  • Inverted microscope
  • 10‐ and 50‐ml conical tubes

Support Protocol 10: Determine Titer of VRPs

  Materials
  • BHK‐21 cells (ATCC no. CCL‐10)
  • BHK‐21 medium (see recipe)
  • 1:1 acetone:methanol mixture (∼50 ml per slide)
  • Phosphate‐buffered saline (PBS; see recipe)
  • Anti‐norovirus mouse sera or commercially available mouse monoclonal antibody (Maine Biotechnology Services, http://www.mainebiotechnology.com/)
  • FITC‐labeled goat anti‐mouse IgG secondary antibody
  • Antifade mounting medium (optional)
  • 8‐well chamber slides (1 per two VRPs)
  • Pencil (non–organic soluble)
  • 50‐ml conical tubes (e.g., BD Falcon)
  • Aluminum foil (or a dark drawer)
  • Microscope slides and glass coverslips
  • Microscope (capable of imaging FITC‐labeled antibodies)
  • Fluorescent cell imaging software

Basic Protocol 6: Production of Virus‐Like Particles from Replicons

  Materials
  • BHK‐21 cells (ATCC no. CCL‐10)
  • BHK‐21 medium (see recipe)
  • Phosphate‐buffered saline (PBS; see recipe)
  • VRPs (see protocols above)
  • 175‐cm2 cell culture–treated flasks

Basic Protocol 7: Purification of Norovirus Virus‐Like Particles

  Materials
  • 40% (w/v) sucrose in PBS (5 ml per VLP)
  • Lysis buffer (see recipe)
  • Flasks containing VLPs ( protocol 17)
  • Phosphate‐buffered saline (PBS; see recipe)
  • Ultracentrifuge with SW‐55 Ti rotor
  • 10‐ and 50‐ml conical tubes
  • 25 × 89–mm Ultra‐Clear Beckman ultracentrifuge tubes (Beckman)
  • Filter pipet tips

Support Protocol 11: Validation of VLP Production

  Materials
  • 5× sample buffer (see recipe)
  • 20‐µl aliquots of the cell lysate (from the flask), cushion supernatant (the lysis buffer layer), and cushion (the sucrose layer)—see protocol 18
  • 10× Laemmli running buffer (see recipe)
  • 30 µl 10‐well Mini Protean 7.5% polyacrylamide gels (BioRad; also see appendix 3M)
  • Protein ladder (BioRad; also see appendix 3M)
  • Coomassie blue stain (see recipe)
  • 10% acetic acid
  • 90°C heat block
  • Microwave oven
  • Microwavable tray to accommodate gel
  • Rocker
  • Additional reagents and equipment for SDS‐PAGE ( appendix 3M)

Basic Protocol 8: Quantification of Virus‐Like Particles

  Materials
  • 25 to 50 µl of each VLP to be tested (see protocols above)
  • Pierce BCA Protein Assay Kit (Pierce), containing:
    • 2 mg/ml BSA standard
    • Reagent A solution
    • Reagent B solution
  • 96‐well plate
  • Microplate reader
  • Computer running Microsoft Excel

Basic Protocol 9: Storage of Virus‐Like Particles

  Materials
  • Purified VLPs (from protocol 18)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Anonymous. 2011. Updated norovirus outbreak management and disease prevention guidelines. MMWR Recomm. Rep. 60:1‐18.
  Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., and Struhl, K (eds.). 2013. Current Protocols in Molecular Biology. John Wiley & Sons, Hoboken, N.J.
  Baric, R.S., Yount, B., Lindesmith, L., Harrington, P.R., Greene, S.R., Tseng, F.C., Davis, N., Johnston, R.E., Klapper, D.G., and Moe, C.L. 2002. Expression and self‐assembly of norwalk virus capsid protein from venezuelan equine encephalitis virus replicons. J. Virol. 76:3023‐3030.
  Bok, K., Parra, G.I., Mitra, T., Abente, E., Shaver, C.K., Boon, D., Engle, R., Yu, C., Kapikian, A.Z., Sosnovtsev, S.V., Purcell, R.H., and Green, K.Y. 2011. Chimpanzees as an animal model for human norovirus infection and vaccine development. Proc. Natl. Acad. Sci. U.S.A. 108:325‐330.
  Cheetham, S., Souza, M., Meulia, T., Grimes, S., Han, M.G., and Saif, L.J. 2006. Pathogenesis of a genogroup II human norovirus in gnotobiotic pigs. J. Virol. 80:10372‐10381.
  Donaldson, E.F., Lindesmith, L.C., Lobue, A.D., and Baric, R.S. 2010. Viral shape‐shifting: Norovirus evasion of the human immune system. Nat. Rev. Microbiol. 8:231‐241.
  Duizer, E., Schwab, K.J., Neill, F.H., Atmar, R.L., Koopmans, M.P., and Estes, M.K. 2004. Laboratory efforts to cultivate noroviruses. J. Gen. Virol. 85:79‐87.
  Harris, J.P., Edmunds, W.J., Pebody, R., Brown, D.W., and Lopman, B.A. 2008. Deaths from norovirus among the elderly, England and Wales. Emerg. Infect. Dis. 14:1546‐1552.
  Hart, M.K., Caswell‐Stephan, K., Bakken, R., Tammariello, R., Pratt, W., Davis, N., Johnston, R.E., Smith, J., and Steele, K. 2000. Improved mucosal protection against Venezuelan equine encephalitis virus is induced by the molecularly defined, live‐attenuated V3526 vaccine candidate. Vaccine 18:3067‐3075.
  Herbst‐Kralovetz, M.M., Radtke, A.L., Lay, M.K., Hjelm, B.E., Bolick, A.N., Sarker, S.S., Atmar, R.L., Kingsley, D.H., Arntzen, C.J., Estes, M.K., and Nickerson, C.A. 2013. Lack of norovirus replication and histo‐blood group antigen expression in 3‐dimensional intestinal epithelial cells. Emerg. Infect. Dis. 19:431‐438.
  Huhti, L., Blazevic, V., Nurminen, K., Koho, T., Hytonen, V.P., and Vesikari, T. 2010. A comparison of methods for purification and concentration of norovirus GII‐4 capsid virus‐like particles. Arch. Virol. 155:1855‐1858.
  Jiang, X., Wang, M., Graham, D.Y., and Estes, M.K. 1992. Expression, self‐assembly, and antigenicity of the Norwalk virus capsid protein. J. Virol. 66:6527‐6532.
  Jiang, X., Matson, D.O., Cubitt, W.D., and Estes, M.K. 1996. Genetic and antigenic diversity of human caliciviruses (HuCVs) using RT‐PCR and new EIAs. Arch. Virol. Suppl. 12:251‐262.
  Jung, K., Wang, Q., Kim, Y., Scheuer, K., Zhang, Z., Shen, Q., Chang, K.O., and Saif, L.J. 2012. The effects of simvastatin or interferon‐alpha on infectivity of human norovirus using a gnotobiotic pig model for the study of antivirals. PLoS One 7:e41619.
  Kapikian, A.Z., Wyatt, R.G., Dolin, R., Thornhill, T.S., Kalica, A.R., and Chanock, R.M. 1972. Visualization by immune electron microscopy of a 27‐nm particle associated with acute infectious nonbacterial gastroenteritis. J. Virol. 10:1075‐1081.
  Koopmans, M., Vinje, J., de Wit, M., Leenen, I., van der Poel, W., and van Duynhoven, Y. 2000. Molecular epidemiology of human enteric caliciviruses in The Netherlands. J. Infect. Dis. 181:S262‐S269.
  Lay, M.K., Atmar, R.L., Guix, S., Bharadwaj, U., He, H., Neill, F.H., Sastry, K.J., Yao, Q., and Estes, M.K. 2010. Norwalk virus does not replicate in human macrophages or dendritic cells derived from the peripheral blood of susceptible humans. Virology 406:1‐11.
  Lindesmith, L., Moe, C., Marionneau, S., Ruvoen, N., Jiang, X., Lindblad, L., Stewart, P., LePendu, J., and Baric, R. 2003. Human susceptibility and resistance to Norwalk virus infection. Nat. Med. 9:548‐553.
  Lindesmith, L.C., Donaldson, E.F., and Baric, R.S. 2011. Norovirus GII.4 strain antigenic variation. J. Virol. 85:231‐242.
  Ma, Y. and Li, J. 2011. Vesicular stomatitis virus as a vector to deliver virus‐like particles of human norovirus: A new vaccine candidate against an important noncultivable virus. J. Virol. 85:2942‐2952.
  Mason, H.S., Ball, J.M., Shi, J.J., Jiang, X., Estes, M.K., and Arntzen, C.J. 1996. Expression of Norwalk virus capsid protein in transgenic tobacco and potato and its oral immunogenicity in mice. Proc. Natl. Acad. Sci. U.S.A. 93:5335‐5340.
  Prasad, B.V., Hardy, M.E., Dokland, T., Bella, J., Rossmann, M.G., and Estes, M.K. 1999. X‐ray crystallographic structure of the Norwalk virus capsid. Science 286:287‐290.
  Pratt, W.D., Davis, N.L., Johnston, R.E., and Smith, J.F. 2003. Genetically engineered, live attenuated vaccines for Venezuelan equine encephalitis: Testing in animal models. Vaccine 21:3854‐3862.
  Pushko, P., Parker, M., Ludwig, G.V., Davis, N.L., Johnston, R.E., and Smith, J.F. 1997. Replicon‐helper systems from attenuated Venezuelan equine encephalitis virus: Expression of heterologous genes in vitro and immunization against heterologous pathogens in vivo. Virology 239:389‐401.
  Reed, D.S., Lind, C.M., Lackemeyer, M.G., Sullivan, L.J., Pratt, W.D., and Parker, M.D. 2005. Genetically engineered, live, attenuated vaccines protect nonhuman primates against aerosol challenge with a virulent IE strain of Venezuelan equine encephalitis virus. Vaccine 23:3139‐3147.
  Schorn, R., Hohne, M., Meerbach, A., Bossart, W., Wuthrich, R.P., Schreier, E., Muller, N.J., and Fehr, T. 2010. Chronic norovirus infection after kidney transplantation: Molecular evidence for immune‐driven viral evolution. Clin. Infect. Dis. 51:307‐314.
  Schultz, A.C., Vega, E., Dalsgaard, A., Christensen, L.S., Norrung, B., Hoorfar, J., and Vinje, J. 2011. Development and evaluation of novel one‐step TaqMan realtime RT‐PCR assays for the detection and direct genotyping of genogroup I and II noroviruses. J. Clin. Virol. 50:230‐234.
  Siebenga, J.J., Vennema, H., Zheng, D.P., Vinje, J., Lee, B.E., Pang, X.L., Ho, E.C., Lim, W., Choudekar, A., Broor, S., Halperin, T., Rasool, N.B., Hewitt, J., Greening, G.E., Jin, M., Duan, Z.J., Lucero, Y., O'Ryan, M., Hoehne, M., Schreier, E., Ratcliff, R.M., White, P.A., Iritani, N., Reuter, G., and Koopmans, M. 2009. Norovirus illness is a global problem: Emergence and spread of norovirus GII.4 variants, 2001‐2007. J. Infect. Dis. 200:802‐812.
  Souza, M., Cheetham, S.M., Azevedo, M.S., Costantini, V., and Saif, L.J. 2007. Cytokine and antibody responses in gnotobiotic pigs after infection with human norovirus genogroup II.4 (HS66 strain). J. Virol. 81:9183‐9192.
  Tan, M., Zhong, W., Song, D., Thornton, S., and Jiang, X. 2004. E. coli‐expressed recombinant norovirus capsid proteins maintain authentic antigenicity and receptor binding capability. J. Med. Virol. 74:641‐649.
  Vega, E., Barclay, L., Gregoricus, N., Williams, K., Lee, D., and Vinje, J. 2011. Novel surveillance network for norovirus gastroenteritis outbreaks, United States. Emerg. Infect. Dis. 17:1389‐1395.
  Vinje, J., Green, J., Lewis, D.C., Gallimore, C.I., Brown, D.W., and Koopmans, M.P. 2000. Genetic polymorphism across regions of the three open reading frames of “Norwalk‐like viruses.” Arch. Virol. 145:223‐241.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:10.4.1‐10.4.8.
  Wobus, C.E., Karst, S.M., Thackray, L.B., Chang, K.O., Sosnovtsev, S.V., Belliot, G., Krug, A., Mackenzie, J.M., Green, K.Y., and Virgin, H.W. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol. 2:e432.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library