Murine Norovirus: Propagation, Quantification, and Genetic Manipulation

Seungmin Hwang1, Bader Alhatlani2, Armando Arias2, Sarah L. Caddy2, Constantina Christodoulou2, Juliana Bragazzi Cunha3, Ed Emmott2, Marta Gonzalez‐Hernandez3, Abimbola Kolawole3, Jia Lu2, Christine Rippinger3, Frédéric Sorgeloos2, Lucy Thorne2, Surender Vashist2, Ian Goodfellow2, Christiane E. Wobus3

1 Department of Pathology, University of Chicago, Chicago, Illinois, 2 Division of Virology, Department of Pathology, University of Cambridge, Cambridge, 3 Department of Microbiology and Immunology, University of Michigan Medical School, Ann Arbor, Michigan
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 15K.2
DOI:  10.1002/9780471729259.mc15k02s33
Online Posting Date:  May, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Murine norovirus (MNV) is a positive‐sense, plus‐stranded RNA virus in the Caliciviridae family. It is the most common pathogen in biomedical research colonies. MNV is also related to the human noroviruses, which cause the majority of nonbacterial gastroenteritis worldwide. Like the human noroviruses, MNV is an enteric virus that replicates in the intestine and is transmitted by the fecal‐oral route. MNV replicates in murine macrophages and dendritic cells in cells in culture and in the murine host. This virus is often used to study mechanisms in norovirus biology, because human noroviruses are refractory to growth in cell culture. MNV combines the availability of a cell culture and reverse genetics system with the ability to study infection in the native host. Herein, we describe a panel of techniques that are commonly used to study MNV biology. Curr. Protoc. Microbiol 33:15K.2.1‐15K.2.61. © 2014 by John Wiley & Sons, Inc.

Keywords: murine norovirus; purification; quantification; reverse genetics; transfection

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Generation of Murine Norovirus‐Containing Cell Lysate
  • Support Protocol 1: Generation of a Concentrated Murine Norovirus Stock
  • Support Protocol 2: Purification of MNV by Cesium Chloride Density Gradient Centrifugation
  • Alternate Protocol 1: Purification of MNV by Cesium Chloride Density Gradient Centrifugation (Large‐Scale)
  • Basic Protocol 2: Murine Norovirus Enzyme‐Linked Immunosorbent Assay
  • Basic Protocol 3: DNA‐Based, POL II‐Driven Generation of Recombinant Murine Norovirus
  • Alternate Protocol 2: DNA‐Based, T7‐Driven Generation of Recombinant MNV
  • Support Protocol 3: Preparation of a FPV‐T7 Stock Required for Reverse Genetics
  • Basic Protocol 4: RNA‐Based Generation of Recombinant Murine Norovirus
  • Basic Protocol 5: Measuring MNV Titers by TCID50
  • Alternate Protocol 3: Measuring MNV Titers by Plaque Assay
  • Alternate Protocol 4: Measuring MNV Genome Titers by RT‐qPCR
  • Basic Protocol 6: Strand‐Specific Quantification of MNV‐1 RNA
  • Support Protocol 4: Generation of Standard RNAs Representing MNV‐1 (+) and (−) Sense Genomic RNAs
  • Basic Protocol 7: siRNA Transfection of BV‐2 Cells Using Neon Transfection System
  • Basic Protocol 8: Lentiviral Transduction of Primary Bone Marrow–Derived Macrophages for MNV Infection
  • Support Protocol 5: Preparation of Mouse Bone Marrow Suspension for Macrophage Culture
  • Support Protocol 6: Production of Lentiviral Vector
  • Alternate Protocol 5: Lentiviral Transduction of Macrophage Cell Lines to Over‐Express or Down‐Regulate a Gene of Interest for MNV Infection
  • Basic Protocol 9: Transfection of Infectious Viral RNA into Mouse Embryonic Fibroblasts
  • Support Protocol 7: Preparation of Infectious Viral RNA from MNV Stock
  • Support Protocol 8: Preparation of Mouse Embryonic Fibroblast Cells
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Generation of Murine Norovirus‐Containing Cell Lysate

  Materials
  • RAW 264.7 cells (ATCC no. TIB‐71)
  • Complete DMEM‐10 medium (see recipe)
  • MNV‐1 (available via materials transfer agreement from Dr. Herbert Virgin, ; or other murine norovirus strains of interest)
  • 175‐cm2 tissue culture‐treated flasks
  • Cell scraper (e.g., Sarstedt—39 cm)
  • Sterile, disposable plastic tubes for storing the lysate and aliquots
  • Additional reagents and equipment for determining viral titer by TCID 50 ( protocol 10) or plaque assay ( protocol 11)

Support Protocol 1: Generation of a Concentrated Murine Norovirus Stock

  Materials
  • MNV stock (see protocol 1)
  • 30% (w/v) sucrose solution in tissue‐culture PBS, filter sterilized with 0.22‐µm filter (e.g., Millipore Stericup Express Plus system)
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • Refrigerated tabletop tissue culture centrifuge (e.g., Sorvall Legend RT)
  • 36 ml clear ultra‐centrifuge tubes (e.g., Beckman‐Coulter, cat. no. 344058)
  • Ultracentrifuge (e.g., Sorvall WX Ultra 80) with rotor and buckets for the appropriate volume (e.g., Sorvall AH‐629)
  • Additional reagents and equipment for determining viral titer by TCID 50 ( protocol 10) or plaque assay ( protocol 11)

Support Protocol 2: Purification of MNV by Cesium Chloride Density Gradient Centrifugation

  Materials
  • MNV stock (see protocol 1)
  • 30% (w/v) sucrose solution PBS, filter sterilized with 0.22‐µm filter (e.g., Millipore Stericup Express Plus system)
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • Cesium chloride (CsCl)
  • 95% ethanol
  • Refrigerated ultracentrifuge and Beckman rotors SW32 and SW55
  • Ultraclear centrifuge tubes for SW32 (Beckman Coulter, cat. no. 344058) and SW55 rotors (Beckman Coulter, cat. no. 344057)
  • Refractometer
  • 22‐G needles
  • 10 kDa MWCO dialysis tubing
  • Dialysis clips
  • Additional reagents and equipment for dialysis (Zumstein, ) and SDS‐PAGE including gel staining ( )

Alternate Protocol 1: Purification of MNV by Cesium Chloride Density Gradient Centrifugation (Large‐Scale)

  Materials
  • MNV stock ( protocol 1)
  • NaCl
  • PEG 8000
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no. 10010‐023)
  • Vertrel XF (non‐hazardous freon substitute; DuPont)
  • CsCl gradient solutions with densities of 1.35 and 1.45 g/cm3
  • 95% ethanol
  • Mid‐speed centrifuge with SLA‐3000 rotor and buckets
  • Stir plate in cold room with beaker and stir bar
  • Sonicator with sonicator tip (e.g., Fisher Scientific, Sonic Dismembrator model 550)
  • Beckman Coulter Ultracentrifuge with SW32 rotor and tubes
  • 22‐G needles
  • Refractometer
  • 10 kDa MWCO dialysis tubing
  • Dialysis clips
  • Additional reagents and equipment for dialysis (Zumstein, ) and SDS‐PAGE including gel staining ( )

Basic Protocol 2: Murine Norovirus Enzyme‐Linked Immunosorbent Assay

  Materials
  • Concentrated virus (see protocol 2)
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • ELISA wash buffer (see recipe)
  • ELISA blocking buffer (see recipe)
  • ELISA III buffer (see recipe)
  • Sera to be tested, plus known positive and negative control sera
  • Goat anti‐mouse IgG, IgA, IgM (H+L), horseradish peroxidase conjugate (Life Technologies, cat no. A10668)
  • ELISA substrate buffer (see recipe)
  • 30% H 2O 2 (Fisher Scientific, cat. no. BP 2633‐500)
  • Stop buffer (0.1 N phosphoric acid): 6.8 ml 85% phosphoric acid (14.7 N) per 500 ml water
  • Immulon II HB flat‐bottomed ELISA plate (Thermo Labsystems)
  • Repeating and multichannel pipettors with reservoirs
  • Plate reader

Basic Protocol 3: DNA‐Based, POL II‐Driven Generation of Recombinant Murine Norovirus

  Materials
  • Full‐length MNV‐containing plasmid (pMNV; available via materials transfer agreement from Dr. Herbert Virgin, )
  • EGFP‐expressing plasmid as control for transfection efficiency
  • Opti‐MEM I medium (Invitrogen)
  • Transfection reagent (Fugene HD; Promega)
  • 293T cells (ATCC no. CRL‐3216) growing in culture (low passage number works better)
  • DMEM‐10 medium (see recipe)
  • RAW 264.7 cells (ATCC no. TIB‐71; if viruses are going to be passaged to RAW cells)
  • QIAamp viral RNA kit (Qiagen)
  • Qiagen OneStep RT‐PCR kit
  • RNasin (Promega)
  • 10 mM dNTP mix ( )
  • Forward primer (GTGCGCAACACAGAGAAACG)
  • Reverse primer (CGGGCTGAGCTTCCTGC)
  • Nuclease‐free H 2O ( , or purchase, e.g., from Invitrogen)
  • QIAquick PCR purification kit (Qiagen)
  • 25‐, 75‐, and 175‐cm2 culture flasks
  • 15‐ml screw‐cap tubes
  • 15‐ml conical centrifuge tubes (e.g., BD Falcon)
  • PCR tubes
  • Spectrophotometer
  • Sequencing facility
  • Additional reagents and equipment for determining viral titer by TCID 50 ( protocol 10) or plaque assay ( protocol 11), agarose gel electrophoresis (Voytas, ), and spectrophotometric quantitation of DNA (Gallagher, )

Alternate Protocol 2: DNA‐Based, T7‐Driven Generation of Recombinant MNV

  Materials
  • Cultures of transfectable cells permissive for MNV replication, i.e., baby hamster kidney cells (BHK), BSR‐T7 (BHK‐21‐derived cells expressing recombinant T7‐polymerase), human embryonic kidney cells (HEK‐293T), human hepatocellular carcinoma cells (Huh7), or African green monkey cells (COS‐7)
  • Titered stock of FPV‐T7 ( protocol 8)
  • Dulbecco's modified Eagle's medium (DMEM; Life Technologies) with 10% fetal bovine serum (FBS) and no antibiotics
  • Opti‐MEM I medium (Invitrogen)
  • cDNA clone of MNV under the control of a T7 RNA polymerase promoter (i.e., pT7:MNV‐1 3′Rz; full‐length MNV–containing plasmid has been produced in Ian Goodfellow's laboratory and its generation has been described in Chaudhry et al., , and Yunus et al., )
  • Lipofectamine 2000 (Invitrogen)
  • 35‐mm dish
  • Additional reagents and equipment for basic cell culture techniques including trypsinization and cell counting (Phelan, )

Support Protocol 3: Preparation of a FPV‐T7 Stock Required for Reverse Genetics

  Materials
  • Primary chicken embryonic fibroblast cells (CEFs)
  • Dulbecco's modified Eagle's medium (DMEM; Life Technologies), supplemented with 10% fetal bovine serum (FBS) and 1× penicillin/streptomycin
  • FPV‐T7 inoculating stock (obtained via MTA from Dr. Mike Skinner, Imperial College London; )
  • Large volume flasks (175‐ or 225‐cm2)
  • Additional reagents and equipment for basic cell culture techniques including trypsinization and cell counting (Phelan, )

Basic Protocol 4: RNA‐Based Generation of Recombinant Murine Norovirus

  Materials
  • MNV cDNA (pT7:MNV 3′Rz) or plasmid containing recombinant MNV cDNA
  • NheI restriction enzyme (NEB, cat. no. R0131S)
  • GFX PCR DNA Gel Band Purification Kit (GE Healthcare, cat. no. 28‐9034‐70)
  • MEGAscript T7 Kit (Life Technologies, cat. no. AM1334) including reagents tabulated in Table 15.2.3
  • 2 U/µl DNase I, RNase‐free (NEB, cat. no. M0303S) and DNase I buffer
  • Lithium chloride (LiCl) precipitation solution (Life Technologies, cat. no. AM9480)
  • 70% ethanol
  • RNA storage solution (Life Technologies, cat. no. AM7000)
  • ScriptCap m7G Capping System (Epicentre Biotechnologies, cat. no. SCCE0610)
  • Neon transfection system (Life Technologies, cat. no. MPK5000)
  • Neon transfection system kit (Life Technologies, cat. no. MPK1025)
  • Opti‐MEM I (Life Technologies, cat. no. 31985070)
  • Lipofectamine 2000 Transfection Reagent (Life Technologies, cat. no. 11668‐027)
  • BV‐2 cells (Blasi et al., )
  • BV‐2 medium: Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L‐glutamine, and 1× penicillin/streptomycin (omit antibiotics where instructed)
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • Neon transfection system (Life Technologies, cat. no. MPK5000)
  • Neon transfection system 10‐µl kit (Life Technologies, cat. no. MPK1025)
  • BSR‐T7 cells (available via materials transfer agreement from Prof. Dr. Karl‐Klaus Conzelmann; )
  • Lipofectamine 2000 (Invitrogen)
  • Tabletop centrifuge
  • 6‐well culture plates
  • 15‐ml conical tubes (e.g., BD Falcon)
  • 35‐mm culture dish
  • Additional reagents and equipment for quantification of nucleic acids (Gallagher, ), agarose gel electrophoresis of RNA (Voytas, ; performed in the same way as for DNA but using RNase‐free reagents), and basic cell culture techniques including trypsinization and cell counting (Phelan, ), and plaque assay ( protocol 11) or TCID 50 assay ( protocol 10)
  • NOTE: All protocol steps must be performed using RNase‐free water.

Basic Protocol 5: Measuring MNV Titers by TCID50

  Materials
  • Frozen virus supernatant samples for titration (see protocols above)
  • BV‐2 mouse microglial cells (or RAW 264.7 mouse macrophage cells) growing in culture
  • DMEM‐10 medium (see recipe)
  • 96‐well tissue culture plates
  • 30‐ to 300‐µl Eppendorf Research Plus multichannel pipettor
  • 10 to 100 µl Eppendorf Research Plus multichannel pipettor
  • 300‐µl sterile filter pipet tips

Alternate Protocol 3: Measuring MNV Titers by Plaque Assay

  Materials
  • RAW 264.7 cells (ATCC no. TIB‐71)
  • DMEM‐10 (see recipe)
  • 3% (w/v) SeaPlaque agarose (see recipe), prewarmed
  • Complete 2× MEM medium (see recipe)
  • Virus supernatant samples for titration (see protocols above)
  • 0.33% Neutral Red solution (Sigma, cat no. N2889)
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • 6‐ and 24‐ or 48‐well plates
  • Repeater pipettor
  • Multichannel pipettor
  • Single channel pipettor
  • Filtered pipet tips
  • Rocker

Alternate Protocol 4: Measuring MNV Genome Titers by RT‐qPCR

  Materials
  • 10% bleach solution
  • 70% ethanol
  • RNase Away reagent (Life Technologies/Ambion, cat. no. 10328‐011)
  • Viral RNA extraction kit (e.g., Qiagen QiaAmp Viral RNA Kit, cat. no. 52906), RNA extraction kit (e.g., Qiagen RNeasy Mini kit, cat. no. 74104), or
  • Trizol reagent (Life Technologies, cat. no. 15596026)
  • Nuclease‐free H 2O ( or purchase, e.g., from Invitrogen)
  • Ambion Turbo DNA‐free DNase (Life Technologies, cat. no. AM1907) and Turbo DNA‐free buffer
  • Ambion Turbo DNA‐free DNase Inactivation Reagent
  • Amplification kit: BioRad iScript One‐step RT‐PCR kit for Probe (cat. no. 170‐88940) or BioRad iTaq Universal Probes One‐Step kit (cat. no. 172‐5140)
  • Primers: both primers bind in ORF1 of the MNV‐1 genome.
    • Forward primer (5′ → 3′): GTGCGCAACACAGAGAAACG (HPLC purified)
    • Reverse primer (5′ →3′): CGGGCTGAGCTTCCTGC (HPLC purified)
  • Probe (5′ →3′): [6‐FAM]‐CTAGTGTCTCCTTTGGAGCACCTA‐[BHQ1] (HPLC purified): probe is modified at the 5′‐end with a fluorescein amidite molecule (FAM), and at the 3′‐end with the non‐fluorescent molecule Black Hole Quencher 1 (BHQ1)
  • Unknown sample RNAs
  • Plasmid containing the MNV‐1 genome (for standard preparation)
  • Microcentrifuges (one designated for RNA work and one for DNA/plasmid work)
  • 96‐well PCR plates (Hard‐Shell PCR plates 96‐well white shell/clear well; BioRad, cat. no. HSP9601)
  • Optical film (Microseal ‘B’ seal, BioRad, cat. no. MSB1001)
  • Two sets of pipettors (one for RNA handling and one for plasmid handling)
  • Nuclease‐free 1.5‐ml tubes
  • BioRad CFX96Touch qPCR machine

Basic Protocol 6: Strand‐Specific Quantification of MNV‐1 RNA

  Materials
  • Total RNA isolated from infected cells (see “Viral RNA extraction” steps in protocol 12)
  • Control in vitro–transcribed RNA ( protocol 14)
  • 10 µM RT primer (Table 15.2.6)
  • 10 mM dNTP mix ( )
  • 5 × first‐strand synthesis buffer (Life Technologies, supplied with SuperScript III)
  • M DTT (Life Technologies, supplied with SuperScript III)
  • 40 U/µl RNaseOUT (Life Technologies)
  • SuperScript III (SS‐III) reverse transcriptase (Life Technologies, cat. no. 18080‐044) and 5× RT buffer
  • Nuclease‐free H 2O ( ; or purchase, e.g., from Life Technologies)
  • 10 µM PCR primers (Table 15.2.6)
  • 2× MESA Blue Mastermix (Mesa Blue qPCR Mastermix for SYBR Assay, Eurogentec)
  • PCR tubes
  • Heat block
  • 96‐well qPCR plates
  • qPCR thermal cycler (Life Technologies)
  • Thermosealer (Life Technologies)
Table 5.0.6   MaterialsPrimers Used for RT‐qPCR

RNA Name Sequence 5′‐3′ Position a
Gpos RT TposGpos CGGGAAGGCGACTGGAGTGCCCAAACATCTTTCCCTTGTTC b 1760‐1779
qPCR ‐ F Tpos CGGGAAGGCGACTGGAGTGCC Nonviral
qPCR ‐R Gneg TGGACAACGTGGTGAAGGAT 1678‐1697
Gneg RT TnegGneg GGCCGTCATGGTGGCGAATAATGGACAACGTGGTGAAGGAT 1678‐1697
qPCR ‐ F Tneg GGCCGTCATGGTGGCGAATAA Nonviral
qPCR ‐R Gpos CAAACATCTTTCCCTTGTTC 1760‐1779

 aThe genome positions are with reference to the MNV‐1.CW‐1 genome RNA sequence. The standard RNAs were designed to include the neighboring RNA secondary structure complexity to imitate the actual RNA.
 bThe 5′ end of the forward primer (underlined sequence) is T7 promoter. T7 polymerase needs this sequence to start RNA synthesis.

Support Protocol 4: Generation of Standard RNAs Representing MNV‐1 (+) and (−) Sense Genomic RNAs

  Materials
  • 100 ng/µl plasmid DNA template (pT7:MNV1 3′Rz, available without MTA from Dr. Ian Goodfellow, Cambridge University)
  • KOD polymerase kit (Merck)
  • 10 mM dNTP mix ( )
  • 10 µM PCR primers (Table 15.2.7)
  • 1% agarose TBE gel (Voytas, )
  • 0.5 × TBE buffer ( )
  • DNA ladder (e.g., GeneRuler 1‐kb Plus, Fermentas)
  • PCR purification kit (GE Healthcare)
  • 0.4 M Tris·Cl, pH 8.0 ( )
  • 320 mM magnesium acetate
  • 400 mM DTT
  • 20 mM spermidine
  • 100 mM ATP
  • 100 mM GTP
  • 100 mM CTP
  • 100 mM UTP
  • Pyrophosphatase (New England Biolabs, cat. no. M2403L)
  • 40 U/µl RNaseOUT (Life Technologies)
  • Nuclease‐free water
  • T7 RNA polymerase (Promega, cat. no. P2074)
  • Nuclease‐free H 2O ( , or purchase, e.g., from Promega or NEB)
  • 2 U/µl DNase I (RNase‐free, Life Technologies)
  • 3 M sodium acetate, pH 5.2 ( )
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol
  • 100% (v/v) ethanol
  • 75% (v/v) ethanol
  • Nanodrop spectrophotometer (http://www.nanodrop.com)
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ) and SDS‐PAGE ( )
Table 5.0.7   MaterialsPrimers Used for Generation of Standard RNAs

Standard RNA Name Sequence 5′‐3′ a Position b
Gpos7 Gpos‐F GCGTAATACGACTCACTATAGGGCTTTTGGCCTCACCTCTG 1085‐1104
Gpos‐R CCAAGATGAAATTGATGTGGCTGTAATCGGGCC 1954‐1986
Gneg7 Gneg‐F GCGTAATACGACTCACTATAGGGTGCCAAGATGAAATTGATG 1970‐1990
Gneg‐R GCTTTTGGCCTCACCTCTG 1086‐1104

 aThe 5′ end of the forward primer (underlined sequence) is T7 promoter. T7 polymerase needs this sequence to start RNA synthesis.
 bThe genome positions are with reference to the MNV‐1.CW‐1 genome RNA sequence. The standard RNAs were designed to include the neighboring RNA secondary structure complexity to imitate the actual RNA.

Basic Protocol 7: siRNA Transfection of BV‐2 Cells Using Neon Transfection System

  Materials
  • Confluent flask(s) of BV‐2 cells (Blasi et al., ), passaged 24 hr prior to start of protocol to ensure actively growing cells
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • BV‐2 medium: Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 2 mM L‐glutamine, and 1× penicillin/streptomycin (omit antibiotics where instructed), 37°C
  • siRNAs: directed against the target and a control housekeeping gene (e.g., GAPDH)
  • NEON 100 µl kit; (Life Technologies, cat. no. MPK10096; (contains Buffers E and R, gold tips, and tip holder)
  • NEON pipet (Life Technologies, cat. no. MPP100)
  • 6‐well cell culture dishes
  • 15‐ml sterile conical tubes (e.g., BD Falcon)
  • Additional reagents and equipment for basic cell culture techniques including trypsinization and cell counting (Phelan, ), and western blotting (Gallagher et al., )

Basic Protocol 8: Lentiviral Transduction of Primary Bone Marrow–Derived Macrophages for MNV Infection

  Materials
  • Day 4 bone marrow culture for the derivation of macrophages ( protocol 17)
  • Macrophage complete medium (see recipe)
  • Lentiviral vectors ( protocol 18)
  • Selection antibiotic, e.g., 1 µg/ml puromycin in culture medium
  • PBS/EDTA solution (e.g., Sigma, cat. no. E8008)
  • 10‐cm culture plates
  • Sterile cell lifter (e.g., Fisher Scientific, cat. no. 08 100 240)
  • 50‐ml conical tubes (e.g., BD Falcon)
  • 6‐ or 24‐well culture plates
  • Additional reagents and equipment for basic cell culture techniques including trypsinization and cell counting (Phelan, )

Support Protocol 5: Preparation of Mouse Bone Marrow Suspension for Macrophage Culture

  Materials
  • Donor mice, 6‐ to 12‐weeks old, specific pathogen‐free
  • 70% ethanol
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • Macrophage complete medium (see recipe)
  • Forceps and scissors (keep in sterile container containing 70% ethanol)
  • 100 × 15–mm petri dishes (non–tissue culture treated)
  • 15‐ and 50‐ml conical centrifuge tube, sterile
  • 10‐ or 30‐ml syringes with 26‐G needles, sterile
  • Additional reagents and equipment for mouse euthanasia ( )

Support Protocol 6: Production of Lentiviral Vector

  Materials
  • 293T cells (ATCC no. CRL‐3216)
  • DMEM‐10 medium (see recipe)
  • Plasmids:
    • Pseudotyping vector encoding the G protein of vesicular stomatitis virus (VSV‐G, e.g., pMD2.G, Addgene plasmid 12259)
    • Lentiviral packaging vector (e.g., psPAX2, Addgene plasmid 12260)
    • Lentiviral vector of choice (e.g., pCDH‐MCS‐T2A‐copGFP‐MSCV, System Biosciences CD523A‐1, for the over‐expression of a gene or pLKO.1 puro, Addgene plasmid 8453, for the down‐regulation of a gene)
  • 2.5 M CaCl 2, sterile
  • 2× HeBS (see recipe), sterile
  • Macrophage complete medium (see recipe)
  • 10‐cm tissue culture–treated dishes
  • 15‐ and 50‐ml conical tubes (e.g., BD Falcon)
  • 0.45‐µm filter unit
  • Additional reagents and equipment for basic cell culture techniques including trypsinization and counting cells (Phelan, )

Alternate Protocol 5: Lentiviral Transduction of Macrophage Cell Lines to Over‐Express or Down‐Regulate a Gene of Interest for MNV Infection

  Materials
  • Macrophage cell lines: RAW 264.7 (ATCC cat. no. TIB‐71) or BV‐2 (Blasi et al., )
  • DMEM‐10 medium (see recipe)
  • Lentiviral vectors ( protocol 18)
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • Selection drug (optional; e.g., puromycin)
  • 10‐cm dishes, tissue‐culture treated
  • Sterile cell lifter (e.g., Fisher Scientific, cat. no. 08 100 240)
  • Additional reagents and equipment for counting cells (Phelan, 006)

Basic Protocol 9: Transfection of Infectious Viral RNA into Mouse Embryonic Fibroblasts

  Materials
  • MEFs ( protocol 22)
  • DMEM‐10 medium (see recipe)
  • Opti‐MEM I medium (Invitrogen)
  • Viral RNA of MNV ( protocol 21)
  • Lipofectamine 2000 (Life Technologies)
  • 24‐well tissue culture–treated plates

Support Protocol 7: Preparation of Infectious Viral RNA from MNV Stock

  Materials
  • Concentrated MNV virus stock ( protocol 2)
  • TRIzol (Life Technologies) or TRI Reagent (Sigma)
  • Chloroform
  • Isopropanol
  • 75% ethanol
  • RNase‐free H 2O ( , or purchase, e.g., from Invitrogen)
  • Water bath or heat block (55° to 60°C)

Support Protocol 8: Preparation of Mouse Embryonic Fibroblast Cells

  Materials
  • Pregnant female mouse
  • Phosphate‐buffered saline (PBS), pH 7.4, sterile (e.g., Life Technologies, cat. no.10010‐023)
  • 70% ethanol
  • DMEM‐10 medium (see recipe)
  • Trypsin/EDTA (e.g., Cellgro, cat. no. 25‐053‐CI)
  • Dimethylsulfoxide (DMSO)
  • 10‐cm petri dishes
  • Dissecting instruments
  • 10‐ml syringe, sterile
  • 175‐cm2 tissue culture flasks
  • 50‐ml conical tubes (e.g., BD Falcon)
  • Additional reagents and equipment for mouse euthanasia ( ) and immortalization of fibroblasts (Xu, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

   Arias, A. , Bailey, D. , Chaudhry, Y. , and Goodfellow, I. 2012. Development of a reverse‐genetics system for murine norovirus 3: Long‐term persistence occurs in the caecum and colon. J. Gen. Virol. 93:1432‐1441.
   Blasi, E. , Barluzzi, R. , Bocchini, V. , Mazzolla, R. , and Bistoni, F. 1990. Immortalization of murine microglial cells by a v‐raf/v‐myc carrying retrovirus. J. Neuroimmunol. 27:229‐237.
   Bocchini, V. , Mazzolla, R. , Barluzzi, R. , Blasi, E. , Sick, P. , and Kettenmann, H. 1992. An immortalized cell line expresses properties of activated microglial cells. J. Neurosci. Res. 31:616‐621.
   Britton, P. , Green, P. , Kottier, S. , Mawditt, K.L. , Penzes, Z. , Cavanagh, D. , and Skinner, M.A. 1996. Expression of bacteriophage T7 RNA polymerase in avian and mammalian cells by a recombinant fowlpox virus. J. Gen. Virol. 77:963‐967.
   Bustin, S.A. , Benes, V. , Garson, J.A. , Hellemans, J. , Huggett, J. , Kubista, M. , Mueller, R. , Nolan, T. , Pfaffl, M.W. , Shipley, G.L. , Vandesompele, J. , and Wittwer, C.T. 2009. The MIQE guidelines: Minimum information for publication of quantitative real‐time PCR experiments. Clin. Chem. 55:611‐622.
   Buttigieg, K. , Laidlaw, S.M. , Ross, C. , Davies, M. , Goodbourn, S. , and Skinner, M.A. 2013. Genetic screen of a library of chimeric poxviruses identifies an ankyrin repeat protein involved in resistance to the avian type I interferon response. J. Virol. 87:5028‐5040.
   Chachu, K.A. , Strong, D.W. , LoBue, A.D. , Wobus, C.E. , Baric, R.S. , and Virgin, H.W. IV. 2008. Antibody is critical for the clearance of murine norovirus infection. J. Virol. 82:6610‐6617.
   Chaudhry, Y. , Skinner, M.A. , and Goodfellow, I.G. 2007. Recovery of genetically defined murine norovirus in tissue culture by using a fowlpox virus expressing T7 RNA polymerase. J. Gen. Virol. 88:2091‐2100.
   Cox, C. , Cao, S. , and Lu, Y. 2009. Enhanced detection and study of murine norovirus‐1 using a more efficient microglial cell line. Virol. J. 6:196.
   Gallagher, S.R. 2011. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 93:A.3D.1–A.3D.14.
   Gallagher, S. , Winston, S.E. , Fuller, S.A. and Hurrell, J.G.R. 2008. Immunoblotting and immunodetection. Curr. Protoc. Mol. Biol. 83:10.8.1‐10.8.28.
   Geissler, K. , Parrish, C.R. , Schneider, K. , and Truyen, U. 1999. Feline calicivirus capsid protein expression and self‐assembly in cultured feline cells. Vet. Microbiol. 69:63‐66.
   Gonzalez‐Hernandez, M.B. , Bragazzi Cunha, J. , and Wobus, C.E. 2012. Plaque assay for murine norovirus. J. Vis. Exp. 66:e4297.
   Green, K.Y. 2007. Caliciviridae. In Fields Virology ( D.M. Knipe and P.M. Howley , eds.) pp. 949‐980. Lippincott Williams & Wilkins, Philadelphia.
   Higuchi, R. , Dollinger, G. , Walsh, P.S. , and Griffith, R. 1992. Simultaneous amplification and detection of specific DNA sequences. Biotechnology 10:413‐417.
   Hsu, C.C. , Wobus, C.E. , Steffen, E.K. , Riley, L.K. , and Livingston, R.S. 2005. Development of a microsphere‐based serologic multiplexed fluorescent immunoassay and a reverse transcriptase PCR assay to detect murine norovirus 1 infection in mice. Clin. Diagn. Lab. Immunol. 12:1145‐1151.
   Hwang, S. , Maloney, N.S. , Bruinsma, M.W. , Goel, G. , Duan, E. , Zhang, L. , Shrestha, B. , Diamond, M.S. , Dani, A. , Sosnovtsev, S.V. , Green, K.Y. , Lopez‐Otin, C. , Xavier, R.J. , Thackray, L.B. , and Virgin, H.W. 2012. Nondegradative role of Atg5‐Atg12/Atg16L1 autophagy protein complex in antiviral activity of interferon gamma. Cell Host Microbe 11:397‐409.
   Karst, S.M. , Wobus, C.E. , Lay, M. , Davidson, J. , and Virgin, H.W. IV. 2003. STAT1‐dependent innate immunity to a Norwalk‐like virus. Science 299:1575‐1578.
   Kim, J.A. , Cho, K. , Shin, M.S. , Lee, W.G. , Jung, N. , Chung, C. , and Chang, J.K. 2008. A novel electroporation method using a capillary and wire‐type electrode. Biosens. Bioelectron. 23:1353‐1360.
   Kitajima, M. , Oka, T. , Tohya, Y. , Katayama, H. , Takeda, N. , and Katayama, K. 2009. Development of a broadly reactive nested reverse transcription‐PCR assay to detect murine noroviruses, and investigation of the prevalence of murine noroviruses in laboratory mice in Japan. Microbiol. Immunol. 53:531‐534.
   Lindenbach, B.D. 2009. Measuring HCV infectivity produced in cell culture and in vivo. Methods Mol. Biol. 510:329‐336.
   Lutfalla, G. and Uze, G. 2006. Performing quantitative reverse‐transcribed polymerase chain reaction experiments. Methods Enzymol. 410:386‐400.
   Madore, H.P. , Treanor, J.J. , and Dolin, R. 1986. Characterization of the Snow Mountain agent of viral gastroenteritis. J. Virol. 58:487‐492.
   Mahler, M. and Kohl, W. 2009. A serological survey to evaluate contemporary prevalence of viral agents and Mycoplasma pulmonis in laboratory mice and rats in western Europe. Lab. Anim. 38:161‐165.
   Mikeska, T. and Dobrovic, A. 2009. Validation of a primer optimisation matrix to improve the performance of reverse transcription—quantitative real‐time PCR assays. BMC Res. Notes 2:112.
   Mumphrey, S.M. , Changotra, H. , Moore, T.N. , Heimann‐Nichols, E.R. , Wobus, C.E. , Reilly, M.J. , Moghadamfalahi, M. , Shukla, D. , and Karst, S.M. 2007. Murine norovirus 1 infection is associated with histopathological changes in immunocompetent hosts, but clinical disease is prevented by STAT1‐dependent interferon responses. J. Virol. 81:3251‐3263.
   Neumann, E. , Schaefer‐Ridder, M. , Wang, Y. , and Hofschneider, P.H. 1982. Gene transfer into mouse lyoma cells by electroporation in high electric fields. EMBO J. 1:841‐845.
   Parwani, A.V. , Saif, L.J. , and Kang, S.Y. 1990. Biochemical characterization of porcine enteric calicivirus: Analysis of structural and nonstructural viral proteins. Arch. Virol. 112:41‐53.
   Phelan, M.C. 2006. Techniques for mammalian cell tissue culture. Curr. Protoc. Mol. Biol. 74:A.3F.1‐A.3F.18.
   Piche, C. and Schernthaner, J.P. 2003. Background priming during reverse transcription by oligo(dT) carried over from mRNA isolation. Biotechniques 34:720‐722, 724.
   Reed, L.J. and Muench, H. 1938. A simple method of estimating fifty per cent endpoints. Am. J. Hygiene 27:493‐497.
   Ruiz, S. , Beauvillain, C. , Mevelec, M.N. , Roingeard, P. , Breton, P. , Bout, D. , and Dimier‐Poisson, I. 2005. A novel CD4‐CD8alpha+CD205+CD11b‐ murine spleen dendritic cell line: Establishment, characterization and functional analysis in a model of vaccination to toxoplasmosis. Cell Microbiol. 7:1659‐1671.
   Smith, D.B. , McFadden, N. , Blundell, R.J. , Meredith, A. , and Simmonds, P. 2012. Diversity of murine norovirus in wild‐rodent populations: Species‐specific associations suggest an ancient divergence. J. Gen. Virol. 93:259‐266.
   Somogyi, P. , Frazier, J. , and Skinner, M.A. 1993. Fowlpox virus host range restriction: Gene expression, DNA replication, and morphogenesis in nonpermissive mammalian cells. Virology 197:439‐444.
   Stahlberg, A. , Kubista, M. , and Pfaffl, M. 2004. Comparison of reverse transcriptases in gene expression analysis. Clin. Chem. 50:1678‐1680.
   Stanley, E.R. , Guilbert, L.J. , Tushinski, R.J. , and Bartelmez, S.H. 1983. CSF‐1—a mononuclear phagocyte lineage‐specific hemopoietic growth factor. J. Cell Biochem. 21:151‐159.
   Takeshita, S. , Kaji, K. , and Kudo, A. 2000. Identification and characterization of the new osteoclast progenitor with macrophage phenotypes being able to differentiate into mature osteoclasts. J. Bone Miner. Res. 15:1477‐1488.
   Taube, S. , Perry, J.W. , Yetming, K. , Patel, S.P. , Auble, H. , Shu, L. , Nawar, H.F. , Lee, C.H. , Connell, T.D. , Shayman, J.A. , and Wobus, C.E. 2009. Ganglioside‐linked terminal sialic acid moieties on murine macrophages function as attachment receptors for murine noroviruses. J. Virol. 83:4092‐4101.
   Thackray, L.B. , Wobus, C.E. , Chachu, K.A. , Liu, B. , Alegre, E.R. , Henderson, K.S. , Kelley, S.T. , and Virgin, H.W. IV 2007. Murine noroviruses comprising a single genogroup exhibit biological diversity despite limited sequence divergence. J. Virol. 81:10460‐10473.
   Timofeeva, A.V. and Skrypina, N.A. 2001. Background activity of reverse transcriptases. Biotechniques 30:22‐24, 26, 28.
   Tsunesumi, N. , Sato, G. , Iwasa, M. , Kabeya, H. , Maruyama, S. , and Tohya, Y. 2012. Novel murine norovirus‐like genes in wild rodents in Japan. J. Vet. Med. Sci. 74:1221‐1224.
   Tuiskunen, A. , Leparc‐Goffart, I. , Boubis, L. , Monteil, V. , Klingstrom, J. , Tolou, H.J. , Lundkvist, A. , and Plumet, S. 2010. Self‐priming of reverse transcriptase impairs strand‐specific detection of dengue virus RNA. J. Gen. Virol. 91:1019‐1027.
   Vashist, S. , Urena, L. , Chaudhry, Y. , and Goodfellow, I. 2012a. Identification of RNA‐protein interaction networks involved in the norovirus life cycle. J. Virol. 86:11977‐11990.
   Vashist, S. , Urena, L. ,and Goodfellow, I. 2012b. Development of a strand specific real‐time RT‐qPCR assay for the detection and quantitation of murine norovirus RNA. J. Virol. Methods 184:69‐76.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:10.4.1‐10.4.8.
   Ward, V.K. , McCormick, C.J. , Clarke, I.N. , Salim, O. , Wobus, C.E. , Thackray, L.B. , Virgin, H.W. IV , and Lambden, P.R. 2007. Recovery of infectious murine norovirus using pol II‐driven expression of full‐length cDNA. Proc. Natl. Acad. Sci. U.S.A. 104:11050‐11055.
   Wobus, C.E. , Karst, S.M. , Thackray, L.B. , Chang, K.O. , Sosnovtsev, S.V. , Belliot, G. , Krug, A. , Mackenzie, J.M. , Green, K.Y. , and Virgin, H.W. 2004. Replication of Norovirus in cell culture reveals a tropism for dendritic cells and macrophages. PLoS Biol. 2:e432.
   Wobus, C.E. , Thackray, L.B. , and Virgin, H.W. IV. 2006. Murine norovirus: A model system to study norovirus biology and pathogenesis. J. Virol. 80:5104‐5112.
   Xu, J. 2005. Preparation, culture, and immortalization of mouse embryonic fibroblasts. Curr. Protoc. Mol. Biol. 70:28.1.1–28.1.8.
   Yunus, M.A. , Chung, L.M. , Chaudhry, Y. , Bailey, D. , and Goodfellow, I. 2010. Development of an optimized RNA‐based murine norovirus reverse genetics system. J. Virol. Methods 169:112‐118.
   Zumstein, L. 1998. Dialysis and ultrafiltration. Curr. Protoc. Mol. Biol. 41:A.3C.1–A.3C.7.
Internet Resources
   http://www.bio‐protocol.org/wenzhang.aspx?id=415
  A protocol for the generation of a neutral red‐containing MNV stock to measure replicating virus can be found at this site.
   http://www.jove.com/video/4145/reverse‐genetics‐mediated‐recovery‐of‐infectious‐murine‐norovirus
  A video for the generation of recombinant MNV can be found at this site.
   http://www.lindenbachlab.org/resources.html
  Excel spreadsheet for calculating TCID50 values.
   http://www.jove.com/video/4297/plaque‐assay‐for‐murine‐norovirus
  A video for the plaque assay can be found at this site.
   http://www.endmemo.com/bio/dnacopynum.php
  A link to convert RNA concentration to copy number.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library