Testing of Transmission of Tobraviruses by Nematodes

Stuart A. MacFarlane1, Roy Neilson1

1 Scottish Crop Research Institute, Invergowrie, Dundee, United Kingdom
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 16B.5
DOI:  10.1002/9780471729259.mc16b05s12
Online Posting Date:  February, 2009
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Virus diseases often are spread between plants by vector organisms, some of which live below ground (e.g., fungi and nematodes) and feed on the plant root system. Tobraviruses are one of only two groups of plant viruses that have nematode vectors. They are primarily viruses of weed plants but can cause significant economic damage in a range of cultivated crops including potato, peas, beans, and many ornamental species. Identifying these viruses and their nematode vectors is a very important part of the struggle to combat disease in crop plants, and requires specialized techniques that will be discussed further in this unit. Curr. Protoc. Microbiol. 12:16B.5.1‐16B.5.16. © 2009 by John Wiley & Sons, Inc.

Keywords: virus transmission; tobraviruses; trichodorid nematodes; TRV; PEBV; PepRSV; Trichodorus; Paratrichodorus

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Viruliferous Status of Field Populations of Nematodes
  • Basic Protocol 2: Virus Acquisition by Nematodes
  • Basic Protocol 3: Virus Transmission by Nematodes
  • Basic Protocol 4: RT‐PCR Amplification of TRV RNA from Infected Plants
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Viruliferous Status of Field Populations of Nematodes

  Materials
  • Silica‐based river sand
  • Field soil containing a population of a target trichodorid nematode species
  • 2‐week‐old Petunia grandiflora (or other species, see Background Information) seedlings
  • Corundum
  • Virus indicator plants, e.g., Chenopodium amaranticolor and C. quinoa
  • Plastic pots (6‐cm diameter)
  • Glasshouse, temperature controlled
  • Mortar and pestle

Basic Protocol 2: Virus Acquisition by Nematodes

  Materials
  • Air‐dried silica‐based river sand
  • Steam‐sterilized loam mixture (particle size between 250 and 1500 µm)
  • 2‐week‐old P. grandiflora seedlings
  • 25‐ml plastic pots
  • Standard vented plastic glasshouse seed propagator (available from any garden center)
  • Glasshouse cubicle at 15° to 20°C
  • Pasteur pipets
  • Low‐power binocular microscope

Basic Protocol 3: Virus Transmission by Nematodes

  Materials
  • Nematodes with acquired virus (see protocol 2)
  • Air‐dried silica‐based river sand
  • 1‐week‐old P. grandiflora seedling
  • Standard potting compost
  • Corundum or similar abrasive powder
  • C. amaranticolor and C. quinoa virus indicator plants
  • 0.5‐ml Beem capsules (size 00, TAAB Laboratories Equipment)
  • 10‐ml conical centrifuge tubes
  • Fine needles
  • Low‐power binocular microscope
  • 18.5 × 12.5 × 7.5–cm plastic container
  • Pasteur pipets
  • Well‐vented seed propagators (available from any garden center)
  • Room at 20°C with 2000 Lux lighting
  • 7.5‐ml glass bottles
  • Counting dishes
  • Microscope slides
  • Coverslips
  • ≤60°C heating block
  • Seed tray with individual compartments
  • Mortar and pestle

Basic Protocol 4: RT‐PCR Amplification of TRV RNA from Infected Plants

  Materials
  • Washed roots of a bait plant
  • RNA extraction kit (e.g., Qiagen RNeasy plant mini kit)
  • RNase‐free water (e.g., DEPC‐treated water, Ambion)
  • Liquid nitrogen
  • TLES extraction buffer (see recipe)
  • Buffer‐saturated phenol, pH 5.0 (BioGene)
  • Chloroform
  • 4 M lithium chloride (LiCl)
  • 70% ethanol (diluted with water)
  • 1 µg/µl first‐strand cDNA oligonucleotide primer in water (5′‐GGGCGTAATAACGCTTACG‐3′; store at –20°C)
  • 200 U/µl Moloney Murine Leukemia Virus reverse transcriptase (M‐MLV RT; Promega) or equivalent
  • 5× M‐MLV reverse transcriptase reaction buffer (see recipe)
  • 2 mM and 10 mM 4dNTP mix (see recipe)
  • 40 U/µl RNase inhibitor (e.g., RNasin, Promega)
  • 10× Taq DNA polymerase reaction buffer with MgCl 2 (Roche)
  • 20 µM oligonucleotide PCR primer A (5′‐CAGTCTATACACAGAAACAGA‐3′, at 20 pmol/µl in water; store at –20°C)
  • 20 µM oligonucleotide PCR primer B (5′‐GACGTGTGTACTCAAGGGTT‐3′, at 20 pmol/µl in water; store at –20°C)
  • 5 U/µl Taq DNA polymerase (Roche)
  • Loading buffer (see recipe)
  • 1.2% agarose gel
  • TBE electrophoresis buffer (see recipe)
  • 1.5‐ml microcentrifuge tubes
  • Plastic, disposable pestle (Fisher Scientific)
  • Vortexer
  • Centrifuge
  • 42° and 70°C heating blocks or water baths
  • 200‐µl thin‐walled PCR tubes
  • Thermal cycler
  • Gel electrophoresis apparatus
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Andre, H.M., Ducarme, X., Anderson, J.M., Crossley, D.A. Jr., Koehler, H.H., Paoletti, M.G., Walter, D.E., and Lebrun, P. 2001. Skilled eyes are needed to go on studying the richness of the soil. Nature 409:761.
   Angenent, G.C., Linthorst, H.J.M., van Belkum, A.F., Cornelissen, B.J.C., and Bol, J.F. 1986. RNA2 of tobacco rattle virus strain TCM encodes an unexpected gene. Nucleic Acids Res. 14:4673‐4682.
   Angenent, G.C., Posthumus, E., Brederode, F.T., and Bol, J.F. 1989. Genome structure of tobacco rattle virus strain PLB: Further evidence on the occurrence of RNA recombination among tobraviruses. Virology 171:271‐274.
   Bergh, S.T., Koziel, M.G., Huang, S.‐C., Thomas, R.A., Gilley, D.P., and Siegel, A. 1985. The nucleotide sequence of tobacco rattle virus RNA2 (CAM strain). Nucleic Acids Res. 13:8507‐8518.
   Boutsika, K., Phillips, M.S., MacFarlane, S.A., Brown, D.J.F., Holeva, R.C., and Blok, V.C. 2004a. Molecular diagnostics of some trichodorid nematodes and associated tobacco rattle virus. Plant Pathol. 53:110‐116.
   Boutsika, K., Blok, V.C., Phillips, M.S., Lewis, S.A., Robbins, R.T., Ferraz, L.C.C.B., and Brown, D.J.F. 2004b. Confirmation of the synonymy of Paratrichodorus christiei (Allen, 1957) Siddiqi, 1974 with P. minor (Colbran, 1956) Siddiqi, 1974 (Nematoda: Triplonchida) based on sequence data obtained for the ribosomal DNA 18S gene. Nematology 6:145‐151.
   Brown, D.J.F. and Weischer, B. 1998. Specificity, exclusivity and complementarity in the transmission of plant viruses by plant parasitic nematodes. Fund. Appl. Nematol. 21:1‐11.
   Brown, D.J.F., Ploeg, A.T., and Robinson, D.J. 1989. A review of reported associations between Trichodorus and Paratrichodorus species (Nematoda: Trichodoridae) and tobraviruses with a description of laboratory methods for examining virus transmission by trichodorids. Fund. Appl. Nematol. 12:235‐241.
   Coomans, A. 2002. Present status and future of nematode systematics. Nematology 4:573‐582.
   Cornelissen, B.J.C., Linthorst, H.J.M., Brederode, F.T., and Bol, J.F. 1986. Analysis of the genome structure of tobacco rattle virus strain PSG. Nucleic Acids Res. 14:2157‐2169.
   Crosslin, J.M., Thomas, P.E., and Hammond, R.W. 2003. Genetic variability of genomic RNA2 of four tobacco rattle tobravirus isolates from potato fields in the northwestern United States. Virus Res. 96:99‐105.
   Decraemer, W. and Baujard, P. 1998. A polytomous key for the identification of species of the family Trichodoridae Thorne, 1935 (Nematoda: Triplonchida). Fund. Appl. Nematol. 21:37‐62.
   Decraemer, W., Karanastasi, E., Brown, D.J.F., and Backeljau, T. 2003. Review of the ultrastructure of the nematode body cuticle and its phylogenetic interpretation. Biol. Rev. 78:465‐510.
   Ferguson, D.H. 1999. Production of chimaeric genomes for the analysis of tobraviral symptom determinants. Ph.D. thesis. University of Birmingham. Birmingham, UK.
   Goulden, M.G., Lomonossoff, G.P., Davies, J.W., and Wood, K.R. 1990. The complete nucleotide sequence of PEBV RNA2 reveals the presence of a novel open reading frame and provides insights into the structure of tobraviral promoters. Nucleic Acids Res. 18:4507‐4512.
   Goulden, M.G., Lomonossoff, G.P., Wood, K.R., and Davies, J.W. 1991. A model for the generation of tobacco rattle virus (TRV) anomalous isolates: Pea early‐browning virus RNA2 acquires TRV sequences from both RNA1 and RNA2. J. Gen. Virol. 72:1751‐1754.
   Hamilton, W.D.O., Boccara, M., Robinson, D.J., and Baulcombe, D.C. 1987. The complete nucleotide sequence of tobacco rattle virus RNA1. J. Gen. Virol. 68:2563‐2575.
   Harrison, B.D. 1973. Pea early‐browning virus. CMI/AAB Descr. Pl. Viruses, No. 120:44.
   Harrison, B.D. and Robinson, D.J. 1978. The tobraviruses. Adv. Virus Res. 23:25‐77.
   Heinze, C., vonBargen, S., Sadowska‐Rybak, M., Willingmann, P., and Adam, G. 2000. Sequences of tobacco rattle virus from potato. J. Phytopathol. 148:547‐554.
   Hernández, C., Mathis, A., Brown, D.J.F., and Bol, J.F. 1995. Sequence of RNA2 of a nematode‐transmissible isolate of tobacco rattle virus. J. Gen. Virol. 76:2847‐2851.
   Hernández, C., Carette, J.E., Brown, D.J.F., and Bol, J.F. 1996. Serial passage of tobacco rattle virus under different selection conditions results in deletion of structural and non‐structural genes in RNA2. J. Virol. 70:4933‐4940.
   Hernández, C., Visser, P.B., Brown, D.J.F., and Bol, J.F. 1997. Transmission of tobacco rattle virus isolate PpK20 by its nematode vector requires one of the two non‐structural genes in the viral RNA2. J. Gen. Virol. 78:465‐467.
   Holeva, R., Phillips, M.S., Neilson, R., Brown, D.J.F., Boutsika, K., and Blok, V.C. 2006. Real‐time PCR detection and quantification of vector trichodorid nematodes and Tobacco Rattle virus. Mol. Cell. Probes 20:203‐211.
   Hübschen, J., Kling, L., Ipach, U., Zinkernagel, V., Bosselut, N., Esmenjaud, D., Brown, D.J.F., and Neilson, R. 2004. Validation of the specificity and sensitivity of species‐specific primers that provide a robust and reliable molecular diagnostic for Xiphinema diversicaudatum, X. index, and X. vuittenezi. Eur. J. Plant Pathol. 110:779‐788.
   Legorburu, F.J., Robinson, D.J., and Torrance, L. 1996. Features on the surface of the tobacco rattle tobravirus particle that are antigenic and sensitive to proteolytic digestion. J. Gen. Virol. 77:855‐859.
   MacFarlane, S.A. 1996. Rapid cloning of uncharacterised tobacco rattle virus isolates using long template (LT) PCR. J. Virol. Methods 56:91‐98.
   MacFarlane, S.A. 1997. Natural recombination among plant virus genomes: Evidence from tobraviruses. In Aspects of ssRNA Virus Genome Organization (M.A. Mayo, ed.) pp. 25‐31. Seminars in Virology 8, Academic Press, New York.
   MacFarlane, S.A. 1999. The molecular biology of the tobraviruses. J. Gen. Virol. 80:2799‐2807.
   MacFarlane, S.A. 2003. Molecular determinants of the transmission of plant viruses by nematodes. Mol. Plant Pathol. 4:211‐215.
   MacFarlane, S.A. and Brown, D.J.F. 1995. Sequence comparison of RNA2 of nematode‐transmissible and nematode‐non‐transmissible isolates of pea early‐browning virus suggests that the gene encoding the 29‐kDa protein may be involved in nematode transmission. J. Gen. Virol. 76:1299‐1304.
   MacFarlane, S.A. and Robinson, D.J. 2004. Transmission of plant viruses by nematodes. In SGM Symposium 63: Microbe‐Vector Interactions in Vector‐Borne Diseases (S.H. Gillespie, G.L. Smith, and A. Osbourne, eds.) pp. 263‐285. Cambridge University Press, Cambridge, U.K.
   MacFarlane, S.A., Taylor, S.C., King, D.I., Hughes, G., and Davies, J.W. 1989. Pea early‐browning virus RNA1 encodes four polypeptides including a putative zinc‐finger protein. Nucleic Acids Res. 17:2245‐2259.
   MacFarlane, S.A., Wallis, C.V., and Brown, D.J.F. 1996. Multiple genes involved in the nematode transmission of pea early browning virus. Virology 219:417‐422.
   MacFarlane, S.A., Vassilakos, N., and Brown, D.J.F. 1999. Similarities in the genome organisation of tobacco rattle virus and pea early‐browning virus isolates that are transmitted by the same vector nematode. J. Gen. Virol. 80:273‐276.
   MacFarlane, S.A., Neilson, R., and Brown, D.J.F. 2002. Nematodes. In Plant Virus Vector Interactions. Advances in Botanical Research, vol. 36 (R.T. Plumb, ed.) pp. 169‐198. Academic Press, London.
   Matthews, R.E.F. 1991. Plant Virology, 3rd Edition. Academic Press, London.
   Ploeg, A.T., Brown, D.J.F., and Robinson, D.J. 1992a. Acquisition and subsequent transmission of tobacco rattle virus isolates by Paratrichodorus and Trichodorus nematode species. Netherlands J. Plant Pathol. 98:291‐300.
   Ploeg, A.T., Brown, D.J.F., and Robinson, D.J. 1992b. The association between species of Trichodorus and Paratrichodorus vector nematodes and serotypes of tobacco rattle tobravirus. Ann. Appl. Biol. 121:619‐630.
   Robinson, D.J. 1992. Detection of tobacco rattle virus by reverse transcription and polymerase chain reaction. J. Virol. Methods 40:57‐66.
   Robinson, D.J. 2003. Tobacco Rattle Virus. CMI/AAB Descr. Pl. Viruses 398.
   Robinson, D.J. 2004. Identification and nucleotide sequence of a Tobacco rattle virus RNA1 variant that causes spraing disease in potato cv. Bintje. J. Phytopathol. 152:286‐290.
   Robinson, D.J. and Harrison, B.D. 1989. Pepper ringspot virus. CMI/AAB Descr. Pl.t Viruses 347.
   Robinson, D.J., Dale, M.F.B., and Todd, D. 2004. Factors affecting the development of disease symptoms in potatoes infected by tobacco rattle virus. Eur. J. Plant Pathol. 110:921‐928.
   Schmidt, K. and Koenig, R. 1999. Genetic analysis of large‐sized RNA2 species of a TCM‐like tobacco rattle virus source from spinach. Arch. Virol. 144:503‐511.
   Schmitt, C., Mueller, A.‐M., Mooney, A., Brown, D.J.F., and MacFarlane, S.A. 1998. Immunological detection and mutational analysis of the RNA2‐encoded nematode transmission proteins of pea early‐browning virus. J. Gen. Virol. 79:1281‐1288.
   Sudarshana, M.R. and Berger, P.H. 1998. Nucleotide sequence of both genomic RNAs of a North American tobacco rattle virus isolate. Arch. Virol. 143:1535‐1544.
   Swanson, M.M. and MacFarlane, S.A. 1999. The E116 isolate of Dutch pea early‐browning virus is a recombinant virus. Virus Res. 60:87‐94.
   Swanson, M., Barker, H., and MacFarlane, S.A. 2002. Rapid vascular movement of tobraviruses does not require coat protein: Evidence from mutated and wild‐type viruses. Ann. Appl. Biol. 141:259‐266.
   Taylor, C.E. and Brown, D.J.F. 1997. Nematode vectors of plant viruses. CAB International, Oxford, U.K.
   Taylor, C.E., Brown, D.J.F., Neilson, R., and Jones, A.T. 1994. The persistence and spread of Xiphinema diversicaudatum in cultivated and uncultivated biotopes. Ann. Appl. Biol. 124:469‐477.
   Uhde, K., Koenig, R., and Lesemann, D.E. 1998. An onion isolate of tobacco rattle virus: Reactivity with an antiserum to Hypochoeris mosaic virus, a putative furovirus, and molecular analysis of its RNA2. Arch. Virol. 143:1041‐1053.
   Vassilakos, N., Vellios, E.K., Brown, E.C., Brown, D.J.F., and MacFarlane, S.A. 2001. Tobravirus 2b protein acts in trans to facilitate transmission by nematodes. Virology 279:478‐487.
   Vellios, E., Duncan, G., Brown, D., and MacFarlane, S. 2002. Immunogold localization of tobravirus 2b nematode transmission helper protein associated with virus particles. Virology 300:118‐124.
   Visser, P.B. and Bol, J.F. 1999. Nonstructural proteins of Tobacco rattle virus which have a role in nematode‐transmission: Expression pattern and interaction with viral coat protein. J. Gen. Virol. 80:3272‐3280.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library