Reverse Transcription‐Polymerase Chain Reaction‐Based Detection of Plant Viruses

Ruhui Li1, John S. Hartung1

1 USDA‐ARS, Beltsville, Maryland
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 16C.1
DOI:  10.1002/9780471729259.mc16c01s6
Online Posting Date:  August, 2007
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

A one‐step reverse transcription–polymerase chain reaction (RT‐PCR) is used to detect two cherry flexiviruses, Cherry green ring mottle virus (CGRMV) and Cherry necrotic rusty mottle virus (CNRMV), in Prunus species. This unit presents procedures for collection of plant samples, preparation of total nucleic acids, viral RNA‐rich or total RNA extracts from plant tissues, and subsequent amplification of the viral targets by one‐step RT‐PCR using a pair of consensus primers. The PCR amplicons are visualized by electrophoresis in a 1% agarose gel containing ethidium bromide in TAE buffer and viewed under ultraviolet light. This procedure is rapid, sensitive, reliable, and cost‐effective and is generally useful on a wide variety of plant/virus systems. The use of a semi‐automatic homogenizer for sample preparation and one‐tube RT‐PCR for virus detection makes this approach ideal for screening large numbers of samples. Curr. Protoc. Microbiol. 6:16C.1.1‐16C.1.9. © 2007 by John Wiley & Sons, Inc.

Keywords: RT‐PCR; plant viruses; Cherry green ring mottle virus (CGRMV); Cherry necrotic rusty mottle virus (CNRMV)

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Extraction of Total Nucleic Acids from Mature Plant Tissues Using CTAB Buffer
  • Alternate Protocol 1: Isolation of Viral RNA‐Rich Extract from Young Leaves by Plate‐Trapping
  • Alternate Protocol 2: Extraction of Total RNA from Young Tissues by Qiagen Rneasy Plant Mini Kit
  • Basic Protocol 2: RT‐PCR Assay for Identification of Viral Pathogens
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Extraction of Total Nucleic Acids from Mature Plant Tissues Using CTAB Buffer

  Materials
  • Plant sample
  • CTAB buffer (extraction buffer; see recipe)
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • Isopropanol, room temperature
  • 70% (v/v) ethanol
  • 20 mM Tris⋅Cl, pH 8.0
  • 1.5‐ and 2.0‐ml microcentrifuge tubes (Labsource or Fisher Scientific)
  • 1/4‐in. steel shots (Slingshot AMMO, Crosman; http://www.crosman.com/)
  • Razor blades
  • Wooden coffee stirrer
  • Screw caps (Labsource or Fisher Scientific)
  • FastPrep instrument (bead‐mill homogenizer, Savant)Water bath, dry‐bath incubator or hybridization oven
  • Vortex
  • 1.7‐ml microcentrifuge tubes

Alternate Protocol 1: Isolation of Viral RNA‐Rich Extract from Young Leaves by Plate‐Trapping

  Materials
  • Prepared tissue ( protocol 1, steps 1 to 6)
  • Extraction buffer (see recipe)
  • Sterile distilled water
  • 3% (v/v) Triton X‐100 (Sigma‐Aldrich)
  • ELISA microplate (Dynatech Laboratories)
  • Additional reagents and solutions for preparing plant tissue ( protocol 1)

Alternate Protocol 2: Extraction of Total RNA from Young Tissues by Qiagen Rneasy Plant Mini Kit

  Materials
  • QIAGEN OneStep RT‐PCR Kit (QIAGEN)
  • Sense primer: 5′‐ CCTCATTCACATAGCTTAGGTTT‐3′
  • Antisense primer: 5′‐ACTTTAGCTTCGCCCCGTG‐3′
  • Total nucleic acid extract ( protocol 1 or Alternate Protocols protocol 21 or protocol 32)
  • 40 U/µl RNase OUT (Invitrogen)
  • 1% agarose gel
  • 0.1 µg/ml ethidium bromide ( appendix 2A)
  • PCR tube, PCR strip, or PCR plate
  • Thermal cycler
  • Gel imaging system
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Clark, M.F. 1981. Immunosorbent assays in plant pathology. Ann. Rev. Phytopathol. 19:83‐106.
   Clark, M.F. and Adams, A.N. 1977. Characteristics of the microplate method of enzyme‐linked immunosorbent assay for the detection of plant viruses. J. Gen. Virol. 34:475‐483.
   Demeke, T. and Adams, R.P. 1992. The effect of plant polysaccharides and buffer additives on PCR. Biotechniques 12:332‐334.
   Doyle, J.J. and Dickson, E.E. 1987. Preservation of plant samples for DNA restriction endonuclease analysis. Taxon 36:715‐722.
   Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., and Ball, L.A. 2005. Virus Taxonomy‐Eighth Report of the International Committee on Taxonomy of Viruses. Elsevier Academic Press.
   Foissac, L., Gentit, P., Svanetia‐Dumas, L., Dulucq, M.J., and Candresse, T. 2002. Polyvalent detection of fruit tree tricho, capillo, and foveaviruses by nested RT‐PCR using degenerated and inosine containing primers (PDO RT‐PCR). Acta Hortic. 550:37‐43.
   Gentit, P., Foissae, X., Svanetia‐Dumas, L., Peypelut, M., Macquaire, G., and Candresse, T. 2002. Molecular characterization of foveaviruses associated with the cherry necrotic mottle leaf disease and complete sequencing of a European isolate of Cherry green ring mottle virus. Arch. Virol. 147:1033‐1042.
   Jones, A.S. and Walker, R.T. 1963. Isolation and analysis of the deoxyribonucleic acid of Mycoplasma mycoides var. capri. Nature 198:588‐589.
   Jones, A.T. and McGavin, W.J. 2002. Improved PCR detection of Blackcurrant reversion virus in Ribes and further evidence that it is the causal agent of reversion disease. Plant Dis. 86:1333‐1338.
   Li, R. and Mock, R. 2005. An improved reverse transcription‐polymerase chain reaction (RT‐PCR) assay for the detection of two cherry flexiviruses in Prunus spp. J. Virol. Methods 129:162‐169.
   Mullis, K.B., Faloona, F., Scharf, S.J., Horn, G.T., and Erlich, H.A. 1986. Specific enzymatic amplification of DNA in vitro: The polymerase chain reaction. Cold Spring Harb. Symp. Quant. Biol. 51:263‐273.
   Murray, M.G. and Thompson, W.F. 1980. Rapid isolation of high molecular weight plant DNA. Nucleic Acids Res. 8:4321‐4325.
   Parker, K.G., Fridland, P.R., and Gilmer, G.M. 1976. Green Ring Mottle. In Virus Diseases and Noninfectious Diseases of Stone Fruit in North America. US Department of Agriculture, Agriculture Handbook No. 437, pp. 193‐199.
   Rott, M.E. and Jelkmann, W. 2001a. Characterization and detection of several filamentous viruses of cherry: Adaptation of an alternative cloning method (DOP‐PCR), and modification of an RNA extraction protocol. Eur. J. Plant Pathol. 107:411‐420.
   Rott, M.E. and Jelkmann, W. 2001b. Complete nucleotide sequence of cherry necrotic rusty mottle virus. Arch. Virol. 146:395‐401.
   Saghai‐Maroof, M.A., Soliman, K.M., Jorgenson, R.A., and Allard, R.W. 1987. Ribosomal DNA spacer‐length polymorphisms in barley: Mendelian inheritance, chromosomal location and population dynamics. Proc. Natl. Acad. Sci. U.S.A. 81:8014‐8018.
   Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
   Zhang, Y.P., Kirkpatrick, B.C., Smart, C.D., and Uyemoto, J.K. 1998. cDNA cloning and molecular characterization of cherry green ring mottle virus. J. Gen. Virol. 79:2275‐2281.
   Zhang, Y.P., Uyemoto, J.K., Terlizzi, B.D., and Kirkpatrick, B.C. 2000. Comparison of cherry green ring mottle virus strains using RT‐PCR and coat protein sequence phylogeny. J. Plant Pathol. 82:49‐53.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library