Isolation and Cloning of Small RNAs from Virus‐Infected Plants

Louise Chappell1, David Baulcombe1, Attila Molnár1

1 The Sainsbury Laboratory, John Innes Centre, Colney
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 16H.2
DOI:  10.1002/9780471729259.mc16h02s00
Online Posting Date:  January, 2006
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

RNA silencing is an evolutionarily conserved, RNA‐mediated, regulatory system of eukaryotic organisms that also acts as an antiviral system in plants and animals. A defining feature of RNA silencing is the presence of 21‐ to 26‐nucleotide small RNAs corresponding to the silencing target sequence, which in virus‐infected plants are derived from the viral genome. The virus‐derived small RNAs have a nonrandom distribution along the viral genome, suggesting hotspots for viral small‐RNA generation. The isolated small RNAs can be used either as probes for hybridization studies or for directional cloning in order to get detailed information about their sizes, origins, and functions. This unit describes an isotope‐free small‐RNA cloning procedure that utilizes unmodified small RNAs and is routinely used to characterize small RNAs from various plant tissues.

Keywords: RNA silencing; viral siRNA; cloning; plant viruses; Dicer; RISC

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Isolating and Cloning Unmodified Small RNAs from Virus‐Infected Plant Tissues
  • Alternate Protocol 1: Dephosphorylating and Cloning Small RNAs from Virus‐Infected Plant Tissues
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Isolating and Cloning Unmodified Small RNAs from Virus‐Infected Plant Tissues

  Materials
  • Virus‐infected leaf tissue
  • Liquid nitrogen
  • Extraction buffer (see recipe)
  • Buffered phenol, pH 8.0 ( appendix 2A)
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol ( appendix 2A)
  • 24:1 (v/v) chloroform/isoamyl alcohol
  • 4 M sodium acetate, pH 5.2
  • Absolute ethanol
  • 80% ethanol
  • 70% ethanol in a wash bottle
  • RNase‐free H 2O ( appendix 2A) or double‐distilled autoclaved H 2O
  • 15% denaturing polyacrylamide gels, fifteen well, 20 × 16 × 0.15 cm (see recipe; also see Ellington and Pollard, 2001)
  • 0.5× TBE buffer ( appendix 2A): sterilize by autoclaving
  • Gel‐loading solution (see recipe)
  • 10‐nucleotide DNA oligo ladder (see recipe)
  • 10 mg/ml ethidium bromide ( appendix 2A)
  • 0.3 M NaCl, RNase‐free
  • 20 mg/ml glycogen (Roche)
  • 100 µM 5′ adapter (see Table 16.2.1)
  • Dimethyl sulfoxide (DMSO)
  • 10× PAN ligation buffer (see recipe)
  • 31 U/µl RNAguard (Amersham Pharmacia)
  • 40 U/µl T4 RNA ligase (Amersham Pharmacia)
  • 100 µM 3′ adapter (Table 16.2.1)
  • 100 µM PCR 3′ primer (Table 16.2.1)
  • 0.1 M dithiothreitol (DTT)
  • 5× first‐strand buffer (Invitrogen)
  • 2 mM deoxyribonucleoside triphosphates (dNTPs: dATP, dCTP, dGTP, dTTP, 2 mM each; appendix 2A)
  • 200 U/µl reverse transcriptase (Superscript II, RNase H, Invitrogen)
  • 150 mM KOH/20mM Tris base
  • 150 mM HCl
  • 1× and 10× TE buffer (see appendix 2A for 1×)
  • 10× PCR buffer (Roche)
  • PCR 5′ primer (Table 16.2.1)
  • 5 U/µl Taq DNA polymerase (Roche)
  • 6× DNA loading solution (Fermentas)
  • 15% native polyacrylamide gel, fifteen well, 20 × 16 × 0.15 cm (see recipe; also see Chory and Pollard, )
  • 20‐bp PCR low DNA ladder (Sigma)
  • 10× buffer H (Roche)
  • 10 U/µl EcoRI (Roche)
  • 10 U/µl NcoI (Roche)
  • 2% (w/v) standard agarose gel with 0.25 µg/ml ethidium bromide (also see Voytas, )
  • 10× T4 DNA ligase buffer (New England Biolabs)
  • 400 U/µl T4 DNA ligase (New England Biolabs)
  • QIAquick PCR purification kit (Qiagen)
  • 10 mM Tris⋅Cl, pH 8.5 ( appendix 2A)
  • pGEM‐T Easy cloning vector (Promega)
  • Rapid DNA ligation kit (Roche)
  • TOP10 cells (Invitrogen)
  • SOC medium ( appendix 4A)
  • LB agar plates ( appendix 4A) with 100 µg/ml ampicillian
  • 2% (w/v) Xgal
  • 20% (w/v) IPTG
  • Primer M13 F (Table 16.2.1)
  • Primer M13 R (Table 16.2.1)
  • 1% (w/v) W‐1 (Invitrogen)
  • 100‐bp DNA ladder (Fermentas)
  • Pestle and mortar
  • 15‐ml polypropylene conical tube, sterile (i.e., Falcon Blue)
  • Refrigerated laboratory centrifuge with swinging‐bucket rotors (e.g., Sigma 4K15C)
  • 90°, 65°, 50°, and 42°C water baths
  • 360‐nm UV transilluminator
  • Plastic wrap (e.g., Saran)
  • Rotary shaker or rocker
  • 1.7‐ml siliconized polypropylene microcentrifuge tubes (Sigma)
  • Tabletop centrifuge, refrigerated (e.g., Eppendorf 5415 D)
  • 200‐µl PCR tubes
  • 16°C incubator
  • 96‐well thermal cycler–compatible microtiter plates
  • Additional reagents and equipment for agarose gel electrophoresis (Voytas, ), denaturing polyacrylamide gel electrophoresis (Ellington and Pollard, ), nondenaturing (native) polyacrylamide gel electrophoresis (Chory and Pollard, ), and the polymerase chain reaction (Kramer and Coen, )
NOTE: Use normal precautions for working with nucleic acids, including sterile solutions and autoclaved utensils. Avoid exposure to ribonucleases. Also see Critical Parameters and Troubleshooting.
Table 6.0.1   MaterialsOligonucleotides and Their Corresponding Sequences

Oligonucleotide Sequence a
5′ adapter 5′ TGGGAATTCCTCACTrArArA 3′
3′ adapter 5′℗rUrUrUCTATCCATGGACTGTidT 3′
PCR 5′ primer 5′ CATGGGAATTCCTCACTAAA 3′
PCR 3′ primer 5′ TACAGTCCATGGATAGAAA 3′
M13 F primer 5′ TTCCCAGTCACGACGTT 3′
M13 R primer 5′ CAGGAAACAGCTATGAC 3′
20‐nt DNA marker 5′ GCGCTCTTGACTCGTTGTGC 3′
30‐nt DNA marker 5′ ACGTGTCGACATCACGCTGGAAATGATACA 3′
40‐nt DNA marker 5′ GATAATACGACTCACTATAGGGCCAGGGCGCAGATTGAGC 3′
50‐nt DNA marker 5′ ACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTA CTTTCTCTTA 3′
61‐nt DNA marker 5′ ATGGATCCCTCGAGGTCGACCCTAGGTGGTCTCATCCTCA GTTCGAGAAGTAACCCGGGAT 3′
71‐nt DNA marker 5′ ATGACTAGTAGTAGGCTCTCTCTGTCCTTGAGGATGATGC TCAAGTCTAGCTCTAAGCTGCTCAAGCTCTC 3′
80‐nt DNA marker 5′ AGTCTTCTCATCCATAGAAGCAGTAGTAGGAATATCGTAA TCAAGAGCACCAGATGAAGAGATCTTCTTGAATCTGTTAG 3′

 aA, C, G, T, DNA residues; rA, rU, RNA residues; ℗, 5′ phosphate; idT, 3′‐inverted deoxythymidine.

Alternate Protocol 1: Dephosphorylating and Cloning Small RNAs from Virus‐Infected Plant Tissues

  • 10× phosphatase buffer (New England Biolabs)
  • 20 U/µl calf intestinal alkaline phosphatase (CIP, New England Biolabs)
  • 10× T4 polynucleotide kinase (PNK) buffer (New England Biolabs)
  • 10 U/µl T4 polynucleotide kinase (New England Biolabs)
  • 100 mM ATP, pH 7.0
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Chory, J. and Pollard, J.D. 1999. Separation of small DNA fragments by conventional gel electrophoresis. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 2.7.1‐2.7.8. John Wiley & Sons, Hoboken, N.J.
   Elbashir, S.M., Lendeckel, W., and Tuschl, T. 2001. RNA interference is mediated by 21‐ and 22‐nucleotide RNAs. Genes Dev. 15:188‐200.
   Ellington, A. and Pollard, J.D. 1998. Purification of oligonucleotides using denaturing polyacrylamide gel electrophoresis. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 2.12.1‐2.12.7. John Wiley & Sons, Hoboken, N.J.
   Gallagher, S.R. 2004. Quantitation of DNA and RNA with Absorption and Fluorescence Spectroscopy. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. A.3D.1‐A.3D.12. John Wiley & Sons, Hoboken, N.J.
   Hamilton, A.J. and Baulcombe, D.C. 1999. A species of small antisense RNA in post‐transcriptional gene silencing in plants. Science 286:950‐952.
   Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. In Current Protocols in Molecular Biology (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 15.1.1‐15.1.14. John Wiley & Sons, Hoboken, N.J.
   Lagos‐Quintana, M., Rauhut, R., Lendeckel, W., and Tuschl, T. 2001. Identification of novel genes coding for small expressed RNAs. Science 294:853‐858.
   Lagos‐Quintana, M., Rauhut, R., Yalcin, A., Meyer, J., Lendeckel, W., and Tuschl, T. 2002. Identification of tissue‐specific microRNAs from mouse. Curr. Biol. 12:735‐739.
   Lau, N.C., Lim, L.P., Weinstein, E.G., and Bartel, D.P. 2001. An abundant class of tiny RNAs with probable regulatory roles in Caenorhabditis elegans. Science 294:858‐862.
   Lee, R.C., Feinbaum, R.L., and Ambros, V. 1993. The C. elegans heterochronic gene lin‐4 encodes small RNAs with antisense complementarity to lin‐14. Cell 75:843‐854.
   Llave, C., Kasschau, K.D., Rector, M.A., and Carrington, J.C. 2002. Endogenous and silencing‐associated small RNAs in plants. Plant Cell 14:1605‐1619.
   Molnár, A., Csorba, T., Lakatos, L., Várallyay, É., Lacomme, C., and Burgyán, J. 2005. Plant virus derived siRNAs predominantly originate from highly structured single‐stranded viral RNAs. J. Virol. 79:7812‐7818.
   Pfeffer, S., Lagos‐Quintana, M., and Tuschl, T. 2003. Cloning of small RNA molecules. In Current Protocols in Molecular Biology, Vol. 4 (F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, eds.) pp. 26.4.1‐26.4.18. John Wiley & Sons, Hoboken, N.J.
   Pfeffer, S., Zavolan, M., Grasser, F.A., Chien, M., Russo, J.J., Ju, J., John, B., Enright, A.J., Marks, D., Sander, C., and Tuschl, T. 2004. Identification of virus‐encoded microRNAs. Science 304:734‐736.
   Reinhart, B.J. and Bartel, D.P. 2002. Small RNAs correspond to centromere heterochromatic repeats. Science 297:1831.
   Voytas, D. 1992. Agarose gel electrophoresis. In Current Protocols in Immunology (J.E. Coligan, A.M. Kruisbeek, D.H. Margulies, E.M. Shevach, and W. Strober, eds.) pp. 10.4.1‐10.4.8. John Wiley & Sons, Hoboken, N.J.
   Watanabe, T., Takeda, A., Mise, K., Okuno, T., Suzuki, T., Minami, N., and Imai, H. 2005. Stage‐specific expression of microRNAs during Xenopus development. FEBS Lett. 579:318‐324.
   White, J.L. and Kaper, J.M. 1989. A simple method for detection of viral satellite RNAs in small tissue samples. J. Virol. Methods 23:83‐94.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library