Molecular Identification and Subtype Analysis of Blastocystis

C. Rune Stensvold1, C. Graham Clark2

1 Department of Microbiology and Infection, Statens Serum Institut, Copenhagen, 2 Faculty of Infectious and Tropical Diseases, London School of Hygiene and Tropical Medicine, London
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 20A.2
DOI:  10.1002/cpmc.17
Online Posting Date:  November, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Several typing methods have been used in studies aiming to unravel the molecular epidemiology of Blastocystis, which is one of the most common intestinal parasites in human and many non‐human hosts. Such studies have the potential to add to knowledge on Blastocystis transmission, host specificity, phylogeography, and clinical and public health significance, but rely on robust, standardized methods by which data can be generated and compared directly between studies. One of the most used methods is “barcoding,”, which involves single‐round PCR amplification and sequencing of partial small subunit ribosomal RNA genes of the parasites. Recently, a publicly available online facility was developed for quick and standardized identification of subtypes (ribosomal lineages) and subtype alleles (variation within subtypes) based on sequence data obtained by barcoding PCR. Moreover, a modified barcoding approach is now available using nested PCR, which enables detection of mixed subtype infections. © 2016 by John Wiley & Sons, Inc.

Keywords: blastocystis; molecular epidemiology; parasite; stool; zoonosis

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Ethanol Fixation of Stool Prior to Genomic DNA Extraction
  • Basic Protocol 2: Molecular Detection of Blastocystis Infection by Taq‐Man Real‐Time PCR
  • Basic Protocol 3: Barcoding PCR‐DNA Sequencing and Subtyping
  • Basic Protocol 4: Sequence Analysis
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Ethanol Fixation of Stool Prior to Genomic DNA Extraction

  Materials
  • Fecal samples of interest
  • Ethanol
  • Phosphate‐buffered saline (PBS)
  • 1.5‐ or 2‐ml microcentrifuge tubes (Eppendorf)
  • Microcentrifuge tube rack
  • Wooden sticks or eqivalent
  • Vortex
  • Microcentrifuge

Basic Protocol 2: Molecular Detection of Blastocystis Infection by Taq‐Man Real‐Time PCR

  Materials
  • Primers: 1 µM each of Blasto forward F5: 5′‐GGTCCGGTGAACACTTTGGATTT‐3′ and Blasto reverse F2: 5′‐CCTACGGAAACCTTGTTACGACTTCA‐3′
  • 300 nM probe: FAM‐TCGTGTAAATCTTACCATTTAGAGGA‐MGBNFQ
  • Platinum Taq polymerase (Invitrogen)
  • Tris·Cl, pH 8.0
  • Sodium chloride
  • Sodium phosphate
  • 0.1 mM dithiothreitol (DTT)
  • Stabilizers
  • 50% (v/v) glycerol
  • 10× PCR buffer minus MgCl 2 (200 mM Tris, pH 8.4, 500 mM KCl) (Invitrogen)
  • 5 mM MgCl 2
  • dUTP mix (12.5 mM dUTP, 50 mM dGTP, 50 mM dATP, 50 mM dCTP)
  • Appropriate IPC dilution (if applicable)
  • Template
  • PCR water
  • PCR tubes
  • ABI 7500 real‐time PCR system instrument with a 96‐well block (e.g., Applied Biosystems)

Basic Protocol 3: Barcoding PCR‐DNA Sequencing and Subtyping

  Materials
  • PCR master mix (e.g., Extract‐N‐Amp PCR ReadyMix, Sigma‐Aldrich, cat. no. E3004)
  • Forward primer (10 µg/µl RD5; Table 20.2.1)
  • Reverse primer (10 µg/µl BhRDr; Table 20.2.1)
  • DNase/RNase‐free distilled water
  • Template DNA (see protocol 1)
  • Agarose gels (1.5% or 2%)
  • PCR purification kit (e.g., QIAquick PCR Purification Kit, cat. no. 28106)
  • PCR tubes or plates
  • Thermal cycler
  • Gel equipment and gel analyzer

Basic Protocol 4: Sequence Analysis

  Materials
  • DNA sequence files in FASTA format
  • Internet access (www.pubmlst.org/blastocystis)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Alfellani, M.A., Stensvold, C.R., Vidal‐Lapiedra, A., Onuoha, E.S., Fagbenro‐Beyioku, A.F., and Clark, C.G. 2013a. Variable geographic distribution of Blastocystis subtypes and its potential implications. Acta Trop. 126:11‐18. doi: 10.1016/j.actatropica.2012.12.011.
  Alfellani, M.A., Taner‐Mulla, D., Jacob, A.S., Imeede, C.A., Yoshikawa, H., Stensvold, C.R., and Clark, C.G. 2013b. Genetic diversity of Blastocystis in livestock and zoo animals. Protist. 164:497‐509. doi: 10.1016/j.protis.2013.05.003.
  Scanlan, P.D., Stensvold, C.R., and Cotter, P.D. 2015. Development and application of a Blastocystis subtype‐specific PCR assay reveals that mixed‐subtype infections are common in a healthy human population. Appl. Environ. Microbiol. 81:4071‐4076. doi: 10.1128/AEM.00520‐15.
  Scicluna, S.M., Tawari, B., and Clark, C.G. 2006. DNA barcoding of Blastocystis. Protist. 157:77‐85. doi: 10.1016/j.protis.2005.12.001.
  Stensvold, C.R. 2013. Comparison of sequencing (barcode region) and sequence‐tagged‐site PCR for Blastocystis subtyping. J. Clin. Microbiol. 51:190‐194. doi: 10.1128/JCM.02541‐12.
  Stensvold, C.R., Alfellani, M., and Clark, C.G. 2012a. Levels of genetic diversity vary dramatically between Blastocystis subtypes. Infect. Genet. Evol. 12:263‐273. doi: 10.1016/j.meegid.2011.11.002.
  Stensvold, C.R., Ahmed, U.N., Andersen, L.O., and Nielsen, H.V. 2012b. Development and evaluation of a genus‐specific, probe‐based, internal process controlled real‐time PCR assay for sensitive and specific detection of Blastocystis. J. Clin. Microbiol. 50:1847‐1851. doi: 10.1128/JCM.00007‐12.
Internet Resources
  http://www.pubmlst.org/blastocystis
  Blastocystis subtype (18S) and sequence typing (MLST) databases.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library