Generating and Maintaining Transgenic Cryptosporidium parvum Parasites

Mattie C. Pawlowic1, Sumiti Vinayak1, Adam Sateriale1, Carrie F. Brooks1, Boris Striepen2

1 Center for Tropical and Emerging Global Diseases, University of Georgia, Athens, Georgia, 2 Department of Cellular Biology, University of Georgia, Athens, Georgia
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 20B.2
DOI:  10.1002/cpmc.33
Online Posting Date:  August, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The apicomplexan parasite Cryptosporidium is a leading cause of diarrheal disease and an important contributor to overall global child mortality. We currently lack effective treatment and immune prophylaxis. Recent advances now permit genetic modification of this important pathogen. We expect this to produce rapid advances in fundamental as well as translational research on cryptosporidiosis. Here we outline genetic engineering for Cryptosporidium in sufficient detail to establish transfection in any laboratory that requires access to this key technology. This chapter details the conceptual design consideration, as well as the experimental steps required to transfect, select, and isolate transgenic parasites. We also provide detail on key in vitro and in vivo assays to detect, validate, and quantify genetically modified Cryptosporidium parasites. © 2017 by John Wiley & Sons, Inc.

Keywords: Cryptosporidium; diarrheal disease; genetics; transfection; (3‐5) CRISPR

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Cryptosporidium Tissue Culture
  • Support Protocol 1: Immunofluorescence Assay of Cryptosporidum‐Infected Cultures
  • Basic Protocol 2: Transfection of Cryptosporidum (Amaxa 4D Nucleofection Device)
  • Alternate Protocol 1: Transfection of Cryptosporidium Using Large 4D Nucleofection Cuvettes
  • Alternate Protocol 2: Transfection of Cryptosporidium Using BTX Electroporation Device
  • Support Protocol 2: Designing and Creating DNA Constructs for Genetic Modification of Cryptosporidium
  • Basic Protocol 3: Surgical Infection of Mice with Transfected Sporozoites
  • Alternate Protocol 3: Oral Infection of Mice with Cryptosporidium Oocysts
  • Basic Protocol 4: Nanoluciferase Assay to Measure Infection in In Vitro Cultures
  • Alternate Protocol 4: Nanoluciferase Assay to Measure Infection in Fecal Samples
  • Support Protocol 3: PCR Screen of Fecal DNA Containing Transgenic Cryptosporidium to Map Genetic Modification
  • Basic Protocol 5: Purification of Oocysts from Fecal Material
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Cryptosporidium Tissue Culture

  Materials
  • HCT‐8, human ileocecal colorectal adenocarcinoma cells, (ATCC catalog #CCL‐244)
  • HCT‐8 medium (see recipe)
  • 1× phosphate‐buffered saline (PBS; Corning, cat. no. 46‐013‐CM), pH 7.4
  • Trypsin (0.25%)
  • Cryptosporidium oocysts (available from Sterling Labs or Bunchgrass Farms; or produced in‐house)
  • 1:4 bleach solution (see recipe)
  • Ice
  • Cryptosporidium infection medium (see recipe)
  •  
  • 37°C water bath
  • 15‐ml centrifuge tubes
  • Centrifuge with adaptors for 15‐ml tubes
  • 25‐cm2 flasks
  • 37°C incubator maintained at 5% CO 2
  • 24‐, and 96‐well plates
  • Sterile 12‐mm glass coverslips
  • 1.5‐ml microcentrifuge tubes
  • Microcentrifuge at 4°C
NOTE: All steps to be carried out in a biosafety cabinet using aseptic technique. Cryptosporidium oocysts should be maintained on ice or at 4°C at all times.

Support Protocol 1: Immunofluorescence Assay of Cryptosporidum‐Infected Cultures

  Materials
  • Phosphate‐buffered saline (PBS), pH 7.4
  • 3% paraformaldehyde, prepared in PBS, pH 7.4
  • 125 mM glycine, prepared in PBS, pH 7.4
  • 0.25% Triton X‐100, prepared in PBS pH 7.4
  • 3% bovine serum albumin (BSA), prepared in PBS pH 7.4
  • Antibodies of choice: We have found several antibodies to work well in IFA; listed below are commercially available antibodies for detecting both wild‐type and transgenic Cryptosporidium mutants:Sporo‐Glo (Waterborne, cat. no. A600FLR)Vicia Villosa Lectin, VVL (Vector Laboratories, Fluorescein labeled, cat. no. FL‐1231)Anti‐Human Neomycin Phosphotransferase II, NPII (Alpha Diagnostics International; only stains in transgenic parasites)
  • DAPI
  • Fluoro‐Gel with TES Buffer (Electron Microscopy Sciences, cat. no. 17985‐30)
  • Clear nail polish
  • 24‐well plate
  • Parafilm
  • Forceps
  • Paper towels
  • Microscope Slides (Fisher Scientific, cat. no. 12‐544‐1)

Basic Protocol 2: Transfection of Cryptosporidum (Amaxa 4D Nucleofection Device)

  Materials
  • Cryptosporidium oocysts
  • Phosphate‐buffered saline (PBS), pH 7.4
  • 1:4 bleach solution (see recipe)
  • Ice
  • 0.2 mM sodium deoxytaurocholate in PBS, pH 7.4
  • SF Cell Line 4D‐Nucleofector X Kit (Lonza, cat. no. V4XC‐2032) containing:
  • SF buffer
  • Supplement #1
  • DNA desired for transfection: DNA should be prepared at a minimum of 2 μg/μl if transfecting a single plasmid, or 4 μg/μl if transfecting two plasmids (transfection of more than two plasmids is not recommended; DNA should be prepared in Tris‐EDTA, pH 8.0, or nuclease‐free water)
  • Cryptosporidium infection medium (see recipe)
  • 1.5‐ml centrifuge tubes
  • Microcentrifuge at 4°C
  • Parafilm
  • Water bath maintained at 15°C (we have a dedicated water bath placed in a cold room)
  • Disposable hemacytometer (Kova Glasstic Slide 10 with Grids, cat. no. 87144)
  • 4D AMAXA Nucleofector (Lonza, Cologne)
  • 37°C, 5% CO 2 incubator

Alternate Protocol 1: Transfection of Cryptosporidium Using Large 4D Nucleofection Cuvettes

  Additional Materials (also see protocol 3)
  • SF Cell Line 4D‐Nucleofector X Kit Large cuvettes (Lonza, cat. no.V4XC‐2012)
  • Disposable Pasteur pipettes

Alternate Protocol 2: Transfection of Cryptosporidium Using BTX Electroporation Device

  Additional Materials (also see protocol 3)
  • 1× Cytomix (see recipe)
  • 2‐mm BTX Electroporation Cuvettes
  • 1.5‐ml microcentrifuge tubes
  • BTX Electroporation System (ECM 630, Harvard Apparatus)
  • 37°C, 5% CO 2 incubator

Support Protocol 2: Designing and Creating DNA Constructs for Genetic Modification of Cryptosporidium

  Materials
  • Luria‐Bertani (LB) broth
  • Kanamycin
  • CpAldo_Cas9_Ribo + U6 Plasmid [Fig.  , Striepen Lab plasmid #185, University of Georgia (Vinayak et al., )]
  • Forward and Reverse Oligonucleotide pair corresponding to your guide RNA sequence (see strategic planning section for instructions on design): To the 5′ end of the oligonucleotide pair corresponding to the guide RNA sequence, add an artificial “GTTG” to the forward oligo and an “AAAC” to the reverse oligo (once the oligos are annealed, these additional sequences will generate sticky ends compatible to the BbsI cloning site on the plasmid)
  • AccuPrep Nano‐Plus Plasmid Mini Extraction Kit (Bioneer, cat. no. K‐3111)
  • AccuPrep Purification Kit (Bioneer, cat. no. K‐3035)
  • BbsI (NEB cat. no. R0539, store at −80°C)
  • Agar for bacterial culture plates
  • Calf Intestinal Alkaline Phosphatase (CIP; NEB, cat. no. M0290, store at −20°C)
  • Ultra‐pure water
  • T4 Polynucleotide Kinase, T4PNK (NEB, cat. no. M0201, store at −20°C)
  • T4 DNA Ligase Reaction Buffer (NEB, cat. no. B0202, store in 10‐μl aliquots at −20°C and do not freeze‐thaw more than twice)
  • Transformation competent bacterial cells
  • Forward Screening Primer: 5′‐CTTTACTATTTATTCCGCTTCCACATGC‐3′
  • DNA polymerase master mix for PCR (Promega GoTaq or similar)
  • 37°C incubator for bacterial cultures
  • 37°C water bath
  • DNA gel electrophoresis apparatus
  • PCR tubes
  • Thermal cycler
  • Heated, shaking incubator, set at 250 rpm and 37°C
  • Petri dishes

Basic Protocol 3: Surgical Infection of Mice with Transfected Sporozoites

  Materials
  • 4 female interferon‐gamma knockout mice per each desired strain (B6.129S7‐Ifngtm1Ts/J; JAX 002287)
  • Mouse Antibiotic Pre‐Treatment Solution (see recipe)
  • 3% to 6% hydrogen peroxide solution
  • Sterile water
  • Transfected sporozoites (see protocol 8)
  • Sterile phosphate‐buffered saline (PBS)
  • Blue food coloring dye
  • Ice
  • Ophthalmic ointment
  • Betadine surgical scrub, 7.5% povidone‐iodine
  • 70% (v/v) ethanol
  • Meloxicam 5 mg/ml solution for injection (Eloxiject, Henry Schein Animal Health, cat. no. 049755)
  • Paromomycin sulfate salt (Sigma Aldrich, cat. no. P5057, or similar)
  • DietGel Boost, a purified high calorie dietary supplement (Clear H 2O, cat. no. 72‐04‐5022)
  • Phillips Norelco GoStyler precision trimmer (Style no. NT9145)
  • Animal cages
  • Microcentrifuge tubes
  • Microcentrifuge tube storage boxes (1 per cage)
  • Surgical grade scissors and blunt forceps (we generally use one set per cage and sterilize using a hot glass bead sterilizer between animals)
  • Sterilization packs for autoclaving surgical tools
  • Hot glass bead sterilizer
  • Surgical instrument cleaner solution (Roboz, cat. no. IC‐1000)
  • Far infrared warming pad
  • Sterile draping
  • Isoflurane anesthesia set up (induction box, nose cone, oxygen tank, and isoflurane scavenging system)
  • Surgical latex gloves (fresh pair for each mouse)
  • Sterile gauze pads
  • Permanent markers (black, red, green)
  • 1‐ml tuberculin syringe, 27‐G detachable needle (Covidien, cat. no. 8881501368)
  • Microsurgical scissors
  • Blunt forceps
  • PDS*II (polydioxanone) suture, 4‐0 violet monofilament (Ethicon, cat. no. Z304H)
  • VetBond tissue adhesive (3 M, cat. no. 1469SB)
NOTE: Mice should be visually examined for good health post‐transport and allowed to acclimate to new environment and food for 7 days prior to antibiotic pre‐treatment.

Alternate Protocol 3: Oral Infection of Mice with Cryptosporidium Oocysts

  Materials
  • 4 to 6 female mice: IFN‐γ KO (Jackson Laboratory, cat. no. 002287) or NOD scid gamma (NOD.Cg‐Prkdcscid Il2rgtm1Wjl/SzJ; Jackson Laboratory, cat. no. 005557), depending on virulence of the Cryptosporidium strain)
  • Cryptosporidium oocysts diluted in PBS
  • Sterile gavage needles (see Table 20.2.1)
Table 0.0.1   MaterialsGavage Needle Specifications Based on Mouse Size

Weight of mouse (grams) Gauge (G) Length of gavage need (inches) Ball diameter (mm) Shape
<14 24 1 1.25 Straight
15‐20 22 1, 1.5 1.25 Straight
20‐25 20 1, 1.5, 3 2.25 Straight, curved
25‐30 18 1, 1.5, 2 2.25 Straight, curved
30‐35 18 2, 3 2.25 Straight, curved

NOTE: Before using gavage to infect mice, seek training in proper technique. In addition, note that appropriately sized and type of gavage needles (Table 20B.2.1) must be selected. Gavage needles can either be stainless steel and reusable or disposable and made of flexible plastic. Stainless steel needles are more durable against chewing, but plastic needles are less likely to cause injury. Stainless steel needles can be straight or curved and plastic needles bend and flex to follow the esophagus of mice. (A curved needle is often easier to use and less traumatic as are needles with a barrel tip rather than a ball tip.)

Basic Protocol 4: Nanoluciferase Assay to Measure Infection in In Vitro Cultures

  Materials
  • NanoGlo Luciferase Assay Kit (Promega, cat. no. N1110)
  • HCT‐8, human ileocecal colorectal adenocarcinoma cells, (ATCC #CCL‐244)
  • CoStar Assay Plate, 96‐well, no lid, round‐bottom white polyprolyene (cat. no. 3355)
  • Plate reader that measures luminescence (e.g., Promega GloMax)
NOTE: To be carried out in a biosafety cabinet with the light off.

Alternate Protocol 4: Nanoluciferase Assay to Measure Infection in Fecal Samples

  Materials
  • Fecal sample
  • Fecal lysis buffer (see recipe)
  • NanoGlo Luciferase Assay Kit (Promega, cat. no. N1110) containing:
  • NanoGlo substrate and lysis buffer
  • Thin metal or wooden spatula (one per fecal sample)
  • Scale
  • 1.5‐ml microcentrifuge tubes
  • 3‐mm glass beads (Fisher Scientific, cat. no. 11‐312 A)
  • Vortex mixer
  • Microcentrifuge
  • CoStar Assay Plate, 96‐well, no lid, round‐bottom white polyprolyene (cat. no. 3355)
  • Plate reader that measures luminescence (e.g., Promega GloMax)

Support Protocol 3: PCR Screen of Fecal DNA Containing Transgenic Cryptosporidium to Map Genetic Modification

  Materials
  • Liquid nitrogen
  • Fecal DNA (including an unmodified wild‐type control sample)
  • Zymo Fecal DNA MicroPrep Kit (Zymo Research, cat. no.D6012) containing:
  • Lysis solution: Bashing bead tubes
  • Upstream Forward Primer
  • Internal Reverse Primer
  • Internal Forward Primer
  • Downstream Reverse Primer
  • Low‐Fidelity DNA polymerase master mix for PCR (Promega GoTaq)
  • Rubber ice bucket
  • Heat block
  • Vortex mixer
  • Thermal cycler

Basic Protocol 5: Purification of Oocysts from Fecal Material

  Materials
  • Ice‐cold tap water
  • Fecal matter
  • Ice
  • Ice‐cold sucrose floatation solution (see recipe)
  • Phosphate‐buffered saline (PBS) with antibiotics (1× penicillin/streptomycin)
  • Ice‐cold 0.85% NaCl (see recipe)
  • Ice‐cold 1.25 M cesium chloride (CsCl 2) solution
  • 2.5% potassium dichromate, prepared in ultra‐pure water
  • 15‐, 50‐, and 500‐ml Conical tubes
  • Cole Parmer LabGEN 125 Homogenizer with autoclavable Omni Tip plastic tip generator probes
  • 250‐ and 850‐μm mesh filters and PVC fittings for mesh filters (Bel‐Art 378451000 Mini‐Sieve Micro Sieve Set)
  • Small plastic funnels
  • Cell scraper, length 300 mm, blade 20 mm (TPP, cat. no. 99003)
  • Large autoclave tray, or several buckets filled with ice
  • 10 liters carboy for autoclaving liquid waste
  • Large centrifuge at 4°C
  • 1.5‐ml microcentrifuge tubes
  • Microcentrifuge at 4°C
  • Disposable hemocytometer (Kova Glasstic Slide 10 with Grids; cat. no. 87144)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

  Abrahamsen, M. S., Templeton, T. J., Enomoto, S., Abrahante, J. E., Zhu, G., Lancto, C. A., … Kapur, V. (2004). Complete genome sequence of the apicomplexan, Cryptosporidium parvum. Science, 304(5669), 441–445. doi: 10.1126/science.1094786.
  Amadi, B., Mwiya, M., Musuku, J., Watuka, A., Sianongo, S., Ayoub, A., & Kelly, P. (2002). Effect of nitazoxanide on morbidity and mortality in Zambian children with cryptosporidiosis: A randomised controlled trial. Lancet, 360(9343), 1375–1380. doi: 10.1016/S0140‐6736(02)11401‐2. [pii] S0140‐6736(02)11401‐2
  Brooks, C. F., Johnsen, H., van Dooren, G. G., Muthalagi, M., Lin, S. S., Bohne, W., … Striepen, B. (2010). The toxoplasma apicoplast phosphate translocator links cytosolic and apicoplast metabolism and is essential for parasite survival. Cell Host & Microbe, 7(1), 62–73. doi: 10.1016/j.chom.2009.12.002.
  Bushkin, G. G., Motari, E., Carpentieri, A., Dubey, J. P., Costello, C. E., Robbins, P. W., & Samuelson, J. (2013). Evidence for a structural role for acid‐fast lipids in oocyst walls of Cryptosporidium, Toxoplasma, and Eimeria. MBio, 4(5), e00387–00313. doi: 10.1128/mBio.00387‐13.
  Checkley, W., White, A. C., Jr., Jaganath, D., Arrowood, M. J., Chalmers, R. M., Chen, X. M., … Houpt, E. R. (2015). A review of the global burden, novel diagnostics, therapeutics, and vaccine targets for cryptosporidium. The Lancet Infectious Diseases, 15(1), 85–94. doi: 10.1016/S1473‐3099(14)70772‐8. [pii] S1473‐3099(14)70772‐8
  Clifford, C. P., Crook, D. W., Conlon, C. P., Fraise, A. P., Day, D. G., & Peto, T. E. (1990). Impact of waterborne outbreak of cryptosporidiosis on AIDS and renal transplant patients. Lancet, 335(8703), 1455–1456. doi: 0140‐6736(90)91478‐S. [pii]
  DeCicco RePass, M. A., Chen, Y., Lin, Y., Zhou, W., Kaplan, D. L., & Ward, H. D. (2017). A novel bioengineered 3D human intestinal model for long‐term infection of cryptosporidium parvum. Infection and Immunity, 85, e00731–16. doi: 10.1128/IAI.00731‐16. [pii] IAI.00731‐16
  Fayer, R., Nerad, T., Rall, W., Lindsay, D. S., & Blagburn, B. L. (1991). Studies on cryopreservation of Cryptosporidium parvum. The Journal of Parasitology, 77(3), 357–361. doi: 10.2307/3283119.
  Fayer, R, Speer, C. A., & Dubey, J. P. (1997). The general biology of Cryptosporidium. Boca Rotaon, Florida: CRC Press Inc.
  Fox, B. A., Ristuccia, J. G., Gigley, J. P., & Bzik, D. J. (2009). Efficient gene replacements in Toxoplasma gondii strains deficient for nonhomologous end joining. Eukaryotic Cell, 8(4), 520–529. doi: 10.1128/EC.00357‐08.
  Griffiths, J. K., Theodos, C., Paris, M., & Tzipori, S. (1998). The gamma interferon gene knockout mouse: A highly sensitive model for evaluation of therapeutic agents against Cryptosporidium parvum. Journal of Clinical Microbiology, 36(9), 2503–2508.
  Gueiros‐Filho, F. J., & Beverley, S. M. (1994). On the introduction of genetically modified Leishmania outside the laboratory. Experimental Parasitology, 78(4), 425–428. doi: 10.1006/expr.1994.1048.
  Guerrant, D. I., Moore, S. R., Lima, A. A., Patrick, P. D., Schorling, J. B., & Guerrant, R. L. (1999). Association of early childhood diarrhea and cryptosporidiosis with impaired physical fitness and cognitive function four‐seven years later in a poor urban community in northeast Brazil. The American Journal of Tropical Medicine and Hygiene, 61(5), 707–713.
  Gut, J., & Nelson, R. G. (1999). Cryptosporidium parvum: Synchronized excystation in vitro and evaluation of sporozoite infectivity with a new lectin‐based assay. The Journal of Eukaryotic Microbiology, 46(5), 56S–57S.
  Hall, M. P., Unch, J., Binkowski, B. F., Valley, M. P., Butler, B. L., Wood, M. G., … Wood, K. V. (2012). Engineered luciferase reporter from a deep sea shrimp utilizing a novel imidazopyrazinone substrate. ACS Chemical Biology, 7(11), 1848–1857. doi: 10.1021/cb3002478.
  Harb, O. S., & Roos, D. S. (2015). The Eukaryotic Pathogen Databases: A functional genomic resource integrating data from human and veterinary parasites. Methods in Molecular Biology, 1201, 1–18. doi: 10.1007/978‐1‐4939‐1438‐8_1.
  Huynh, M. H., & Carruthers, V. B. (2009). Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Eukaryotic Cell, 8(4), 530–539. doi: 10.1128/EC.00358‐08.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816–821. doi: 10.1126/science.1225829.
  Korich, D. G., Mead, J. R., Madore, M. S., Sinclair, N. A., & Sterling, C. R. (1990). Effects of ozone, chlorine dioxide, chlorine, and monochloramine on Cryptosporidium parvum oocyst viability. Applied and Environmental Microbiology, 56(5), 1423–1428.
  Kotloff, K. L., Nataro, J. P., Blackwelder, W. C., Nasrin, D., Farag, T. H., Panchalingam, S., … Levine, M. M. (2013). Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): A prospective, case‐control study. Lancet, 382(9888), 209–222. doi: 10.1016/S0140‐6736(13)60844‐2. [pii] S0140‐6736(13)60844‐2
  Liu, L., Oza, S., Hogan, D., Perin, J., Rudan, I., Lawn, J. E., & Black, R. E. (2015). Global, regional, and national causes of child mortality in 2000‐13, with projections to inform post‐2015 priorities: An updated systematic analysis. Lancet, 385(9966), 430–440. doi: 10.1016/S0140‐6736(14)61698‐6. [pii] S0140‐6736(14)61698‐6
  Mac Kenzie, W. R., Hoxie, N. J., Proctor, M. E., Gradus, M. S., Blair, K. A., Peterson, D. E., … Davis, J. P. (1994). A massive outbreak in Milwaukee of cryptosporidium infection transmitted through the public water supply. The New England Journal of Medicine, 331(3), 161–167. doi: 10.1056/NEJM199407213310304.
  Manabe, Y. C., Clark, D. P., Moore, R. D., Lumadue, J. A., Dahlman, H. R., Belitsos, P. C., … Sears, C. L. (1998). Cryptosporidiosis in patients with AIDS: Correlates of disease and survival. Clinical Infectious Diseases, 27(3), 536–542. doi: 10.1086/514701.
  Mary, C., Chapey, E., Dutoit, E., Guyot, K., Hasseine, L., Jeddi, F., … Network, A. C. N. (2013). Multicentric evaluation of a new real‐time PCR assay for quantification of Cryptosporidium spp., & identification of Cryptosporidium parvum and Cryptosporidium hominis. Journal of Clinical Microbiology, 51(8), 2556–2563. doi: 10.1128/JCM.03458‐12.
  Mead, J. R., Arrowood, M. J., Sidwell, R. W., & Healey, M. C. (1991). Chronic Cryptosporidium parvum infections in congenitally immunodeficient SCID and nude mice. The Journal of Infectious Diseases, 163(6), 1297–1304. doi: 10.1093/infdis/163.6.1297.
  Mochizuki, K. (2008). High efficiency transformation of Tetrahymena using a codon‐optimized neomycin resistance gene. Gene, 425(1‐2), 79–83. doi: 10.1016/j.gene.2008.08.007.
  Morada, M., Lee, S., Gunther‐Cummins, L., Weiss, L. M., Widmer, G., Tzipori, S., & Yarlett, N. (2016). Continuous culture of Cryptosporidium parvum using hollow fiber technology. International Journal for Parasitology, 46(1), 21–29. doi: 10.1016/j.ijpara.2015.07.006. [pii] S0020‐7519(15)00220‐9
  Newman, M., & Ausubel, F. M. (2016). Introduction to Gene Editing and Manipulation Using CRISPR/Cas9 Technology. Current Protocols in Molecular Biology, 115, 31 34 31–36. doi: 10.1002/cpmb.14.
  Peng, D., & Tarleton, R. (2015). EuPaGDT: A web tool tailored to design CRISPR guide RNAs for eukaryotic pathogens. Microbial Genomics, 1(4). doi: 10.1099/mgen.0.000033.
  Rossignol, J. F., Kabil, S. M., el‐Gohary, Y., & Younis, A. M. (2006). Effect of nitazoxanide in diarrhea and enteritis caused by Cryptosporidium species. Clinical Gastroenterology and Hepatology, 4(3), 320–324. doi: 10.1016/j.cgh.2005.12.020. [pii] S1542‐3565(05)01191‐2
  Sidik, S. M., Hackett, C. G., Tran, F., Westwood, N. J., & Lourido, S. (2014). Efficient genome engineering of Toxoplasma gondii using CRISPR/Cas9. PLoS One, 9(6), e100450. doi: 10.1371/journal.pone.0100450.
  Striepen, B. (2013). Parasitic infections: Time to tackle cryptosporidiosis. Nature, 503(7475), 189–191. doi: 10.1038/503189a.
  Upton, S. J. (1997). In vitro cultivation. Boca Raton, Florida: CRC Press Inco.
  Upton, S. J., Tilley, M., & Brillhart, D. B. (1994). Comparative development of Cryptosporidium parvum (Apicomplexa) in 11 continuous host cell lines. FEMS Microbiology Letters, 118(3), 233–236. doi: 10.1111/j.1574‐6968.1994.tb06833.x.
  Upton, S. J., Tilley, M., Nesterenko, M. V., & Brillhart, D. B. (1994). A simple and reliable method of producing in vitro infections of Cryptosporidium parvum (Apicomplexa). FEMS Microbiology Letters, 118(1‐2), 45–49. doi: 10.1111/j.1574‐6968.1994.tb06801.x.
  Vinayak, S., Pawlowic, M. C., Sateriale, A., Brooks, C. F., Studstill, C. J., Bar‐Peled, Y., … Striepen, B. (2015). Genetic modification of the diarrhoeal pathogen Cryptosporidium parvum. Nature, 523(7561), 477–480. doi: 10.1038/nature14651.
Key Reference
  Vinayak, S., Pawlowic, M. C., Sateriale, A., Brooks, C. F., Studstill, C. J., Bar‐Peled, Y., … Striepen, B. (2015). Genetic modification of the diarrhoeal pathogen Cryptosporidium parvum. Nature, 523(7561), 477–480. doi: 10.1038/nature14651.
Internet Resources
  http://www.eupathdb.org.
  Resource for genomic sequences and related data sets for eukaryotic pathogens including Cryptosporodium and related parasites.
  http://www.cryptodb.org.
  Resource for the genomic sequence and related data sets for several Cryptosporidium species.
  http://grna.ctegd.uga.edu.
  Resource to identify and select guide RNA sequences to design CRISPR/Cas9 gene editing. Several genomes are pre‐loaded, including Cryptosporidium, to aid in avoiding off‐target effects.
  https://www.addgene.org/crispr/guide/.
  Additional basic information concerning CRISPR/Cas9.
  http://www.striepenlab.org.
  For additional information or to contact the authors, please visit the laboratory's Web site.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library