Efficient Genome Editing in the Oomycete Phytophthora sojae Using CRISPR/Cas9

Yufeng Fang1, Linkai Cui1, Biao Gu1, Felipe Arredondo1, Brett M. Tyler1

1 Center for Genome Research and Biocomputing and Department of Botany and Plant Pathology, Oregon State University, Corvallis, Oregon
Publication Name:  Current Protocols in Microbiology
Unit Number:  Unit 21A.1
DOI:  10.1002/cpmc.25
Online Posting Date:  February, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Phytophthora is a filamentous fungus‐like microorganism, but belongs to the oomycetes, in the kingdom Stramenopila. Phytophthora species are notorious as plant destroyers, causing multibillion‐dollar damage to agriculture and natural ecosystems worldwide annually. For a long time, genome editing has been unattainable in oomycetes, because of their extremely low rate of homologous recombination. The recent implementation of the CRISPR/Cas (clustered regularly interspaced short palindromic repeats/CRISPR‐associated) system in the soybean pathogen Phytophthora sojae, an experimental model for oomycetes, has opened up a powerful new research capability for the oomycete community. Here, we describe a detailed protocol for CRISPR/Cas9‐mediated genome editing in P. sojae, including single guide RNA (sgRNA) design and construction, efficient gene replacement, and mutant‐screening strategies. This protocol should be generally applicable for most culturable oomycetes. We also describe an optimized transformation method that is useful for other Phytophthora spp. including P. capsici and P. parasitica. © 2017 by John Wiley & Sons, Inc.

Keywords: oomycetes; Phytophthora; genome editing; gene replacement; CRISPR/Cas9

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: sgRNA Design
  • Basic Protocol 2: Preparation of CRISPR/Cas9 Plasmids
  • Basic Protocol 3: Preparation of Homologous Donor Template for HDR‐Mediated Mutation
  • Basic Protocol 4: Optimized P. sojae Transformation
  • Basic Protocol 5: Screening for P. sojae HDR‐Mediated Mutants
  • Support Protocol 1: Small Scale Extraction of P. sojae Genomic DNA (P. sojae gDNA Miniprep)
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: sgRNA Design

  Materials
  • sgRNA design software, EuPaGDT (http://grna.ctegd.uga.edu/)
  • Sequence analysis, FungiDB (http://fungidb.org/)
  • RNA secondary structure prediction, RNA structure (http://rna.urmc.rochester.edu/RNAstructureWeb/Servers/Predict1/Predict1.html).

Basic Protocol 2: Preparation of CRISPR/Cas9 Plasmids

  Materials
  • Oligonucleotides (sense and antisense oligonucleotides obtained from an oligonucleotide synthesis service)
  • TE buffer (10 mM Tris·Cl, 1 mM EDTA; pH 8.0)
  • T4 DNA ligase and 10 × buffer (NEB, cat. no. M0202S)
  • Sterile deionized water
  • 0.5 M NaCl
  • pYF515 (“all‐in‐one” plasmid, for expression of both Cas9 and sgRNA)
  • Generalized sgRNA cloning plasmid pYF2.3G‐Ribo‐sgRNA (for two‐plasmid transformation system)
  • Nhe I (NEB, cat. no. R0131S)
  • Bsa I and 10 × CutSmart Buffer (NEB, cat. no. R0535S)
  • PCR purification kit (Qiagen)
  • Chemically competent E. coli DH5α cells
  • Ice
  • LB liquid medium and LB liquid medium containing 100 μg/ml ampicillin (see Elbing and Brent, )
  • SOC liquid medium (see Seidman et al., )
  • LB agar plates containing 100 μg/ml ampicillin (see Elbing and Brent, )
  • Green Taq DNA polymerase and buffer (Genscript)
  • M13 Forward universal primer (5′‐GTTTTCCCAGTCACGACG‐3′)
  • Zyppy plasmid Miniprep Kit (Zymo Research)
  • Primer RPL41_Pseq_F (5′‐CAAGCCTCACTTTCTGCTGACTG‐3′)
  • HiSpeed Plasmid Midi kit (Qiagen)
  • hSpCas9 expression plasmid, pYF2‐PsNLS‐hSpCas9 (for two‐plasmid transformation system)
  • Plasmid Maxi Kit (Qiagen)
  • pYF2‐PsNLS‐hSpCas9‐GFP (for examination of Cas9 expression in situ), optional
  • 37°C incubator‐shaker
  • Thermal cycler
  • 42°C water bath for heat‐shocking cells
  • 1.5‐ml microcentrifuge tubes
  • 0.2‐ml PCR tubes
  • 10‐μl sterile pipet tips for picking colonies from agar plates
  • Flasks for large‐scale culture (100‐ to 250‐ml)
  • Nanodrop microspectrophotometer (http://www.nanodrop.com)
  • 15‐ml bacterial culture tubes
  • Vacuum concentrator
  • Additional reagents and equipment for performing agarose gel electrophoreses (see Voytas, 2000).
The CRISPR plasmids can be obtained from the Tyler Laboratory at Oregon State University upon request.

Basic Protocol 3: Preparation of Homologous Donor Template for HDR‐Mediated Mutation

  Materials
  • Donor DNA (e.g., mCherry gene)
  • PCR purification kit (Qiagen)
  • Plasmid pBluescript SK II+
  • In‐Fusion HD Cloning kit (Clontech) containing:
  •  5× In‐fusion HD enzyme premix
  • Sterile deionized
  • Ice
  • Chemically competent E. coli DH5α cells
  • LB plates containing 100 μg/ml ampicillin
  • HiSpeed Plasmid Midi kit (Qiagen)
  • Phusion High‐Fidelity DNA Polymerase and Phusion HF Buffer (NEB, cat. no. M0530S)
  • 0.2‐ml PCR tubes
  • Thermal cycler
  • Vacuum concentrator
  • Additional reagents and equipment for E.coli transformation, colony‐PCR and Sanger Sequencing (see protocol 2)

Basic Protocol 4: Optimized P. sojae Transformation

  Materials
  • Phytophthora sojae race 2 (P6497)
  • V8 liquid and solid medium (see recipe)
  • Nutrient pea broth and agar medium (see recipe)
  • Sterile deionized water
  • 0.8 M mannitol (Sigma, cat. no. M1902), sterilize using a 0.45‐mm filter
  • Enzyme solution (see recipe)
  • W5 solution (see recipe)
  • Ice
  • MMG solution (see recipe)
  • PEG4000 (Fluka, cat. no. 81240)
  • Midiprep of sgRNA expression plasmid (pYF2.3G‐Ribo‐sgRNA, for two‐plasmid system; see protocol 2)
  • Maxiprep of Cas9 expression plasmid (pYF2‐hSpCas9, for two‐plasmid system; see protocol 2) or
  • Midiprep of “all‐in‐one” Cas9‐sgRNA expression plasmid (pYF515, for single‐plasmid system; see protocol 2)
  • Midiprep of homologous donor plasmid (see protocol 3)
  • Regeneration medium (see recipe)
  • Ampicillin (Sigma)
  • G418 (Geneticin, AG Scientific)
  • PEG‐calcium transformation solution (see recipe)
  • #3 Cork borer (6‐mm diameter) or scalpels
  • 250‐ml Erlenmeyer flasks with cotton stoppers
  • Cotton stoppers
  • Aluminum foil
  • 25°C incubator
  • Miracloth (EMD Millipore, cat. no. 475855‐1R)
  • 25‐mm deep petri dishes
  • Two stainless steel laboratory spatulas
  • Rotary shaker
  • Light microscope (inverted format is more convenient)
  • 70‐μm Falcon nylon mesh cell strainer (BD Biosciences, cat. no. 08‐771‐2)
  • Beckman Coulter benchtop centrifuge with swing buckets
  • 50‐ml Falcon tubes
  • 1.5‐ml microcentrifuge tubes
  • 90‐mm × 15‐mm petri dishes
  • Benchtop centrifuge
  • Hot bead sterilizers or bunsen burner (used for sterilization of the scalpels)
  • 3‐ml plastic transfer pipets

Basic Protocol 5: Screening for P. sojae HDR‐Mediated Mutants

  Materials
  • P. sojae transformants growing on nutrient pea agar ( protocol 4, step 28b)
  • V8 liquid medium (see recipe)
  • G418 (Geneticin, AG Scientific)
  • Phusion High‐Fidelity DNA polymerase and Phusion HF Buffer (NEB, cat. no. M0530S)
  • PCR purification kit (Qiagen)
  • 12‐well tissue culture plates
  • 25°C and 14°C incubators
  • Fluorescence microscope
  • Thermal cycler
  • Parafilm
  • Hemacytometer
  • Additional reagents and equipment for obtaining P. sojae gDNA by miniprep (see the Support*Protocol)

Support Protocol 1: Small Scale Extraction of P. sojae Genomic DNA (P. sojae gDNA Miniprep)

  Materials
  • Regenerated P. sojae hyphae mixture (e.g. from protocol 4, step 22) or P. sojae individual transformants growing in V8 liquid medium (e.g. from protocol 5, step 1)
  • Acid‐treated 0.5‐mm glass beads (Sigma)
  • P. sojae lysis buffer (see recipe)
  • 10 mg/ml RNase A, from bovine pancreas (Sigma, cat. no. R4875)
  • Ice
  • Liquid nitrogen
  • Phenol‐chloroform‐isoamyl alcohol (25:24:1, saturated with 10 mM Tris·Cl, pH 8.0, 1 mM EDTA; Sigma, Cat. no. P3803)
  • Isopropanol
  • 70% (v/v) ethanol
  • Sterile deionized water
  • 2‐ and 1.5‐ml microcentrifuge tubes
  • Benchtop centrifuge
  • Vortex mixer
  • Sterile 200‐µl tips or toothpicks
  • Kimwipes
  • Pellet pestle (disposable polypropylene pestles)
  • 37°C incubator
  • Refrigerated benchtop centrifuge
  • Vacuum concentrator
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Ah‐Fong, A.M., Bormann‐Chung, C.A., and Judelson, H.S. 2008. Optimization of transgene‐mediated silencing in Phytophthora infestans and its association with small‐interfering RNAs. Fungal Genet. Biol. 45:1197‐1205. doi: 10.1016/j.fgb.2008.05.009.
  Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A., and Zhang, F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science 339:819‐823. doi: 10.1126/science.1231143.
  Deveau, H., Garneau, J.E., and Moineau, S. 2010. CRISPR/Cas system and its role in phage‐bacteria interactions. Annu. Rev. Microbiol. 64:475‐493. doi: 10.1146/annurev.micro.112408.134123.
  Doench, J.G., Hartenian, E., Graham, D.B., Tothova, Z., Hegde, M., Smith, I., Sullender, M., Ebert, B.L., Xavier, R.J., and Root, D.E. 2014. Rational design of highly active sgRNAs for CRISPR‐Cas9‐mediated gene inactivation. Nat. Biotechnol. 32:1262‐1267. doi: 10.1038/nbt.3026.
  Dou, D., Kale, S.D., Wang, X., Chen, Y., Wang, Q., Wang, X., Jiang, R.H., Arredondo, F.D., Anderson, R.G., Thakur, P.B., McDowell, J.M., Wang, Y., and Tyler, B.M. 2008. Conserved C‐terminal motifs required for avirulence and suppression of cell death by Phytophthora sojae effector Avr1b. Plant Cell 20:1118‐1133. doi: 10.1105/tpc.107.057067.
  Elbing, K. and Brent, R. 2002. Media preparation and bacteriological tools. Curr. Protoc. Mol. Biol. 1.1.1‐1.1.7. doi:10.1002/0471142727.mb0101s59.
  Erwin, D.C. and Ribeiro, O.K. 1996. Phytophthora diseases worldwide. American Phytopathological Society Press, St. Paul, M. N.
  Fang, Y. and Tyler, B.M. 2016. Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR/Cas9. Mol. Plant Pathol. 17:127‐139. doi: 10.1111/mpp.12318.
  Förster, H., Coffey, M.D., Elwood, H., and Sogin, M.L. 1990. Sequence analysis of the small subunit ribosomal RNAs of three zoosporic fungi and implications for fungal evolution. Mycologia 82:306‐312. doi: 10.2307/3759901.
  Gao, Y. and Zhao, Y. 2014. Self‐processing of ribozyme‐flanked RNAs into guide RNAs in vitro and in vivo for CRISPR‐mediated genome editing. J. Integr. Plant Biol. 56:343‐349. doi: 10.1111/jipb.12152.
  Garneau, J.E., Dupuis, M.E., Villion, M., Romero, D.A., Barrangou, R., Boyaval, P., Fremaux, C., Horvath, P., Magadan, A.H., and Moineau, S. 2010. The CRISPR/Cas bacterial immune system cleaves bacteriophage and plasmid DNA. Nature 468:67‐71. doi: 10.1038/nature09523.
  Horvath, P. and Barrangou, R. 2010. CRISPR/Cas, the immune system of bacteria and archaea. Science 327:167‐170. doi: 10.1126/science.1179555.
  Hsu, P.D., Lander, E.S., and Zhang, F. 2014. Development and applications of CRISPR‐Cas9 for genome engineering. Cell 157:1262‐1278. doi: 10.1016/j.cell.2014.05.010.
  Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., and Zhang, F. 2013. DNA targeting specificity of RNA‐guided Cas9 nucleases. Nat. Biotechnol. 31:827‐832. doi: 10.1038/nbt.2647.
  Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J.A., and Charpentier, E. 2012. A programmable dual‐RNA‐guided DNA endonuclease in adaptive bacterial immunity. Science 337:816‐821. doi: 10.1126/science.1225829.
  Judelson, H.S. 1997. The Genetics and Biology of Phytophthora infestans: Modern approaches to a historical challenge. Fungal Genet. Biol. 22:65‐76. doi: 10.1006/fgbi.1997.1006.
  Judelson, H.S. and Blanco, F.A. 2005. The spores of Phytophthora: Weapons of the plant destroyer. Nat. Rev. Microbiol. 3:47‐58. doi: 10.1038/nrmicro1064.
  Judelson, H.S., Tyler, B.M., and Michelmore, R.W. 1991. Transformation of the oomycete pathogen, Phytophthora infestans. Mol. Plant Microbe. Interact. 4:602‐607. doi: 10.1094/MPMI‐4‐602.
  Judelson, H.S., Coffey, M.D., Arredondo, F.R., and Tyler, B.M. 1993a. Transformation of the oomycete pathogen Phytophthora‐Megasperma F‐Sp Glycinea occurs by DNA integration into single or multiple chromosomes. Curr. Genet. 23:211‐218. doi: 10.1007/BF00351498.
  Judelson, H.S., Dudler, R., Pieterse, C.J., Unkles, S.E., and Michelmore, R.W. 1993b. Expression and antisense inhibition of transgenes in Phytophthora infestans is modulated by choice of promoter and position effects. Gene 133:63‐69. doi: 10.1016/0378‐1119(93)90225‐R.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Lamour, K.H., Finley, L., Hurtado‐Gonzales, O., Gobena, D., Tierney, M., and Meijer, H.J. 2006. Targeted gene mutation in Phytophthora spp. Mol. Plant Microbe. Interact. 19:1359‐1367. doi: 10.1094/MPMI‐19‐1359.
  Mali, P., Yang, L., Esvelt, K.M., Aach, J., Guell, M., DiCarlo, J.E., Norville, J.E., and Church, G.M. 2013. RNA‐guided human genome engineering via Cas9. Science 339:823‐826. doi: 10.1126/science.1232033.
  Mcleod, A., Fry, B.A., Zuluaga, A.P., Myers, K.L., and Fry, W.E. 2008. Toward improvements of oomycete transformation protocols. J. Eukaryot. Microbiol. 55:103‐109. doi: 10.1111/j.1550‐7408.2008.00304.x.
  Miller, J.C., Tan, S., Qiao, G., Barlow, K.A., Wang, J., Xia, D.F., Meng, X., Paschon, D.E., Leung, E., Hinkley, S.J., Dulay, G.P., Hua, K.L., Ankoudinova, I., Cost, G.J., Urnov, F.D., Zhang, H.S., Holmes, M.C., Zhang, L., Gregory, P.D., and Rebar, E.J. 2011. A TALE nuclease architecture for efficient genome editing. Nat. Biotechnol. 29:143‐148. doi: 10.1038/nbt.1755.
  Pattanayak, V., Lin, S., Guilinger, J.P., Ma, E., Doudna, J.A., and Liu, D.R. 2013. High‐throughput profiling of off‐target DNA cleavage reveals RNA‐programmed Cas9 nuclease specificity. Nat. Biotechnol. 31:839‐843. doi: 10.1038/nbt.2673.
  Peng, D. and Tarleton, R. 2015. EuPaGDT: A web tool tailored to design CRISPR guide RNAs for eukaryotic pathogens. Microbial. Genomics 1. doi: 10.1099/mgen.0.000033.
  Seidman, C.E., Struhl, K., Sheen, J., and Jessen, T. 1997. Introduction of plasmid DNA into cells. Curr. Protoc. Mol. Biol. 1.8.1‐1.8.10.
  Stajich, J.E., Harris, T., Brunk, B.P., Brestelli, J., Fischer, S., Harb, O.S., Kissinger, J.C., Li, W., Nayak, V., and Pinney, D.F. 2011. FungiDB: An integrated functional genomics database for fungi. Nucleic Acids Res. gkr918.
  Tyler, B.M. 2001. Genetics and genomics of the oomycete–host interface. Trends Genet. 17:611‐614. doi: 10.1016/S0168‐9525(01)02517‐3.
  Tyler, B.M. 2007. Phytophthora sojae: Root rot pathogen of soybean and model oomycete. Mol. Plant Pathol. 8:1‐8. doi: 10.1111/j.1364‐3703.2006.00373.x.
  Tyler, B.M. and Gijzen, M. 2014. The Phytophthora sojae genome sequence: Foundation for a revolution. In Genomics of Plant‐Associated Fungi and Oomycetes: Dicot Pathogens pp. 133‐157. Springer.
  Wang, Q., Han, C., Ferreira, A.O., Yu, X., Ye, W., Tripathy, S., Kale, S.D., Gu, B., Sheng, Y., Sui, Y., Wang, X., Zhang, Z., Cheng, B., Dong, S., Shan, W., Zheng, X., Dou, D., Tyler, B.M., and Wang, Y. 2011. Transcriptional programming and functional interactions within the Phytophthora sojae RXLR effector repertoire. Plant Cell 23:2064‐2086. doi: 10.1105/tpc.111.086082.
  Whisson, S.C., Avrova, A.O., Van West, P., and Jones, J.T. 2005. A method for double‐stranded RNA‐mediated transient gene silencing in Phytophthora infestans. Mol. Plant Pathol. 6:153‐163. doi: 10.1111/j.1364‐3703.2005.00272.x.
  Wu, X., Scott, D.A., Kriz, A.J., Chiu, A.C., Hsu, P.D., Dadon, D.B., Cheng, A.W., Trevino, A.E., Konermann, S., and Chen, S. 2014. Genome‐wide binding of the CRISPR endonuclease Cas9 in mammalian cells. Nat. Biotechnol. 32:670‐676. doi: 10.1038/nbt.2889.
  Wyvekens, N., Tsai, S.Q., and Joung, J.K. 2015. Genome editing in human cells using CRISPR/Cas nucleases. Curr. Protoc. Mol. Biol. 31.33.31‐31.33.18. doi: 10.1002/0471142727.mb3103s112.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library