Lentiviral Vector Mediated Transgenesis

Isabelle Barde1, Sonia Verp1, Sandra Offner1, Didier Trono1

1 School of Life Sciences and “Frontiers in Genetics” National Program, Ecole Polytechnique Fédérale de Lausanne (EPFL), Lausanne, Switzerland
Publication Name:  Current Protocols in Mouse Biology
Unit Number:   
DOI:  10.1002/9780470942390.mo100169
Online Posting Date:  March, 2011
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The genetic manipulation of rodents through the generation of fully transgenic animals or via the modification of selective cells or organs is a procedure of paramount importance for biomedical research, either to address fundamental questions or to develop preclinical models of human diseases. Lentiviral vectors occupy the front stage in this scene, as they can mediate the integration and stable expression of transgenes both in vitro and in vivo. Widely used to modify a variety of cells, including re‐implantable somatic and embryonic stem cells, lentiviral vectors can also be directly administered in vivo, for instance in the brain. However, perhaps their most spectacular research application is in the generation of transgenic animals. Compared with the three‐decade‐old DNA pronuclear injection technique, lentivector‐mediated transgenesis is simple, cheap, and highly efficient. Furthermore, it can take full advantage of the great diversity of lentiviral vectors developed for other applications, and thus allows for ubiquitous or tissue‐specific or constitutive or externally controllable transgene expression, as well as RNAi‐mediated gene knockdown. Curr. Protoc. Mouse Biol. 1:169‐184. © 2011 by John Wiley & Sons, Inc.

Keywords: lentiviral vector; transgenesis; transgenic animals

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Mouse hybrid strain B6D2F1 derived from C57BL/6JxDBA2J (females and males purchased at 5 and 8 weeks of age, respectively from Charles River Laboratories)
  • Pregnant mare serum (PMS; see recipe)
  • Human chorionic gonadotropin (HCG; see recipe)
  • Egg medium (see recipe)
  • Embryo‐tested mineral oil, sterile filtered, (Sigma, cat. no. M5310)
  • 70% ethanol
  • Hyaluronidase (H‐3506 Sigma)
  • NMRI female 7 weeks old minimum (Charles River Laboratories)
  • Vasectomized males NMRI, 2 to 10 months old (Charles River Laboratories)
  • Lentiviral vector (see Barde et al., )
  • Ketarum (see recipe)
  • Artificial tears: Viscotears (Novartis Pharma Schweiz AG, Bern, Switzerland)
  • Phosphate‐buffered saline (PBS)
  • Heparin‐Na 25000 IE/5 ml (Braun, 3511014; http://www.bbraunusa.com/)
  • Histopaque‐1083 (Sigma, cat. no. H8889)
  • PBS containing 1% (v/v) fetal bovine serum (FBS)
  • DNAeasy Genomic DNA Extraction Kit (Qiagen, cat. no. 69509)
  • pTitin (available from Addgene, http://www.addgene.org), a pRRL vector in which the target sequence of the Titin primers used for normalization has been cloned (this plasmid allows one to perform a standard curve)
  • Kit for preparing qPCR master mix (TaqMan universal PCR master mix, no AmpErase UNG; Applied Biosystems, cat. no. 4324020, including 2× reaction buffer)
  • Primers and probe for Gag, WPRE, and Titin detection (see Table 10.1.6900)
  • U‐100 insulin syringe, 29‐G, 0.33 mm × 12.7 mm, Microfine (Becton Dickinson)
  • Petri dishes (3 cm, sterile)
  • Surgical draping
  • Surgical instruments
  • Understage illumination stereomicroscope (Leica, MZ7.5)
  • Mouth pipet aspirator tube assemblies for calibrated microcapillary pipets (Sigma, cat. no. A5177‐5EA)
  • Capillaries for mouth pipet (Drummond microdispenser; 2‐000‐050; Milian)
  • Capillary for injection micropipet: borosilicate standard wall with filament,1.2 mm O.D., 0.69 mm I.D., 100 mm length, (Harvard Apparatus, cat. no. 300044)
  • Puller for preparing injection micropipet (INJECT+MATIC, http://www.injectmatic.com/)
  • Sterile holding pipet vacutips (Vaudaux‐Eppendorf, 5175 108.000)
  • Sequencing tip microloader (Vaudaux‐Eppendorf, 5242 956)
  • Inverted microscope (Leica AS TP) with TransferMan NK2 micromanipulators (Eppendorf) and microinjector (INJECT+MATIC, http://www.injectmatic.com/)
  • Hypodermic needles, microlance, 30‐G, ½‐in.
  • Heating pad 5 × 12.5 cm (40‐90‐2‐07 FHC)
  • Suture clips
  • MicroAmp 96‐well optical reaction plate (Applied Biosystems)
  • Optical adhesive Film (Applied Biosystems)
  • Centrifuge with microtiter plate carrier
  • Real‐time PCR machine (e.g., 7900HT Sequence Detector, Applied Biosystems)
  • Computer running SDS7900HT software (Applied Biosystems) and Microsoft Excel
  • Additional reagents and equipment for sacrifice of mice (Donovan and Brown, ), flow cytometry (Robinson et al., ), and quantitative real‐time PCR (qPCR; Fraga et al., )
    Table 0.1.1   Materials   Primers and Probes for the Genotyping of Transgenic Animals Obtained by Lentiviral Vector–Mediated Transgenesis a   Primers and Probes for the Genotyping of Transgenic Animals Obtained by Lentiviral Vector–Mediated Transgenesis

    Sequence detected Primer/probe name Primer/probe sequence Probe fluorophores
    Gag Gag_Forward GGAGCTAGAACGATTCGCAGTTA
    Gag_Reverse GGTGTAGCTGTCCCAGTATTTGTC
    Gag_probe ACAGCCTTCTGATGTTTCTAACAGGCCAGG FAM‐BHQ
    WPRE WPRE_forward GGCACTGACAATTCCGTGGT
    WPRE_reverse AGGGACGTAGCAGAAGGACG
    WPRE_probe ACGTCCTTTCCATGGCTGCTCGC FAM‐BHQ
    Titin Titin_forward AAAACGAGCAGTGACGTGAGC
    Titin_reverse TTCAGTCATGCTGCTAGCGC
    Titin_probe TGCACGGAAGCGTCTCGTCTCAGTC FAM‐BHQ

     aGag oligos are used for amplification of HIV‐1 derived vector sequences and are specific for the 5′ end of the gag gene. This sequence is present in all HIV‐1‐derived vectors, as it is part of the extended packaging signal. WPRE oligos amplify the WPRE sequence present in almost all later‐generation LV vectors (see Commentary). Titin oligos are used to normalize for the amount of genomic DNA and are specific for the mouse titin gene. Stocks of probes and primers usually come lyophilized and are diluted to 10 µM in water.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Barde, I., Salmon, P., and Trono, D. 2010. Production and titration of lentiviral vectors. Curr. Protoc. Neurosci. 53:4.21.1‐4.21.23.
   Donovan, J. and Brown, P. 2006. Euthanasia. Curr. Protoc. Immunol. 73:1.8.1‐1.8.4.
   Fraga D., Meulia T, and Fenster S. 2008 Real‐time PCR. Curr. Protoc. Essential Lab. Tech. 00:10.3.1‐10.3.34
   Gordon, J.W., Scangos, G.A., Plotkin, D.J., Barbosa, J.A., and Ruddle, F.H. 1980. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc. Natl. Acad. Sci. U.S.A. 77:7380‐7384.
   Jahner, D. and Jaenisch, R. 1985. Retrovirus‐induced de novo methylation of flanking host sequences correlates with gene inactivity. Nature 315:594‐597.
   Jahner, D., Stuhlmann, H., Stewart, C.L., Harbers, K., Löhler, J., Simon, I., and Jaenisch, R. 1982. De novo methylation and expression of retroviral genomes during mouse embryogenesis. Nature 298:623‐628.
   Lois, C., Hong, E.J., Pease, S., Brown, E.J., and Baltimore, D. 2002. Germline transmission and tissue‐specific expression of transgenes delivered by lentiviral vectors. Science 295:868‐872.
   Naldini, L., Blömer, U., Gallay, P., Ory, D., Mulligan, R., Gage, F.H., Verma, I.M., and Trono, D. 1996. In vivo gene delivery and stable transduction of nondividing cells by a lentiviral vector. Science 272:263‐267.
   Okada, Y., Ueshin, Y., Isotani, A., Saito‐Fujita, T., Nakashima, H., Kimura, K., Mizoguchi, A., Oh‐Hora, M., Mori, Y., Ogata, M., Oshima, R.G., Okabe, M., and Ikawa, M. 2007. Complementation of placental defects and embryonic lethality by trophoblast‐specific lentiviral gene transfer. Nat. Biotechnol. 25:233‐237.
   Robinson, J.P., Darzynkiewicz, Z., Hoffman, R., Nolan, J.P., Orfao, A., Rabinovitch, P.S., and Watkins, S. (eds.) 2010. Current Protocols in Cytometry. John Wiley & Sons, Hoboken, N.J.
   Sauvain, M.O., Dorr, A.P., Stevenson, B., Quazzola, A., Naef, F., Wiznerowicz, M., Schütz, F., Jongeneel, V., Duboule, D., Spitz, F., and Trono, D. 2008. Genotypic features of lentivirus transgenic mice. J. Virol. 82:7111‐7119.
   Szulc, J., Wiznerowicz, M., Sauvain, M.O., Trono, D., and Aebischer, P. 2006. A versatile tool for conditional gene expression and knockdown. Nat. Methods 3:109‐116.
   Tiscornia, G., Singer, O., Ikawa, M., and Verma, I.M. 2003. A general method for gene knockdown in mice by using lentiviral vectors expressing small interfering RNA. Proc. Natl. Acad. Sci. U.S.A. 100:1844‐1848.
   WHO. 2004. Laboratory Biosafety Manual, 3rd ed. World Health Organization, Geneva.
   Wolf, D. and Goff, S.P. 2007. TRIM28 mediates primer binding site‐targeted silencing of murine leukemia virus in embryonic cells. Cell 131:46‐57.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library