Generating and Analyzing Germ‐Free Mice

Carina Arvidsson1, Anna Hallén1, Fredrik Bäckhed1

1 Department of Molecular and Clinical Medicine, Sahlgrenska Center for Cardiovascular and Metabolic Research/Wallenberg Laboratory, University of Gothenburg, Gothenburg, Sweden
Publication Name:  Current Protocols in Mouse Biology
Unit Number:   
DOI:  10.1002/9780470942390.mo120064
Online Posting Date:  December, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The normal gut microbiota has evoked many investigators' interest over the years and the pioneering work of James Reyniers in the 1920s generated the first germ‐free guinea pigs. Comparing the physiology between germ‐free and conventionally raised animals has provided invaluable insights on how the gut microbiota affect host biology. Today we know that the gut microbiota modulate the immune system, epithelial cell proliferation, intestinal angiogenesis, hormone production, energy absorption, and behavior. Furthermore, recent data have demonstrated that obesity is associated with an altered gut microbiota, and a direct role for the microbiota in disease development was demonstrated by the use of germ‐free mice. Here we are presenting protocols for maintaining and generating germ‐free mice. Curr. Protoc. Mouse Biol. 2:307‐316 © 2012 by John Wiley & Sons, Inc.

Keywords: gut microbiota; gnotobiotic mouse models; hysterectomy

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Maintaining Germ‐Free Mice: Practical Considerations for Housing and Equipment Sterility
  • Basic Protocol 2: Assessing Germ‐Free Status by Fecal Bacteria Analysis
  • Alternate Protocol 1: Assessing Germ‐Free Status by Molecular Methods
  • Basic Protocol 3: Rederivation of Mice
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Maintaining Germ‐Free Mice: Practical Considerations for Housing and Equipment Sterility

  Materials
  • Clidox (sterilization agent)
  • Autoclavable Mouse Breeder Diet (Labdiets, cat. no. 5021)
  • Tap water
  • Bedding
  • Isolator including:
    • Isolator port
    • 12‐in. × 12‐in. × 18‐in. long transfer sleeve with two 1‐in. nipples (Class Biological Clean, cat. no. 2312180)
    • Stoppers for 1‐in. nipples
    • Blowers
  • Large tweezers
  • Shelving systems
  • Small paper autoclavable bags
  • 12‐in × 24‐in. Sterilizing cylinder (Class Biological Clean; see Fig. B)
  • Sterilization darts (Steris)
  • Mylar film
  • 3 M Scotch Brand Yellow Vinyl Tape
  • Mylar tape (Class Biological Clean)
  • Autoclave
  • Small trolley or equivalent

Basic Protocol 2: Assessing Germ‐Free Status by Fecal Bacteria Analysis

  Materials
  • Fecal pellets
  • Brain Heart broth or Sabouraud broth (for culture of possible fungi contaminations; e.g., Sigma) or nutrient broth (e.g., Sigma)
  • Microcentrifuge tubes
  • 14‐ml culture tubes
  • Anaerobic jar
  • Anaerocult A system (Merck)
  • 37°C incubator

Alternate Protocol 1: Assessing Germ‐Free Status by Molecular Methods

  Materials
  • Fecal pellets
  • NucleoSpin Soil kit for genomic DNA isolation (MACHEREY‐NAGEL) including:
    • Nucleospin Soil Bead tube
    • Lysis buffer SL2
    • Enhancer solution SX
    • Precipitation buffer SL3
    • Binding buffer SB
    • NucleoSpin Inhibitor Removal Column (red ring)
    • 2‐ml collection tubes
    • NucleoSpin Soil Column (green ring)
    • Washing buffer SW1
    • Washing buffer SW2
    • Elution buffer SE
  • Ice
  • Accuprime DNA Taq polymerase (Invitrogen)
  • Buffer I (provided with Taq polymerase)
  • Molecular biology‐grade water
  • Forward primer (8F; AGAGTTTGATCCTGGCTCAG)
  • Reverse primer (338R; TGCTGCCTCCCGTAGGAGT)
  • 1% agarose gel
  • Autoclaved microcentrifuge tubes
  • −20°C freezer
  • FastPrep:24 beadbeater (MP Biomedicals)
  • Vortex mixer
  • Centrifuge
  • 4°C incubator
  • PCR machine

Basic Protocol 3: Rederivation of Mice

  Materials
  • Germ‐free mice [Swiss Webster from Taconic or Charles River (C3H)]
  • Autoclaved water
  • Sterilization solution (1% chlorine)
  • Rederivation isolator with a small dunk tank (Class Biological Clean)
  • Sharp scissors
  • Tweezers
  • Cotton swabs (Q‐tips)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Bäckhed, F., Ley, R.E., Sonnenburg, J.L., Peterson, D.A., and Gordon, J.I. 2005. Host‐bacterial mutualism in the human intestine. Science 307:1915‐1920.
   Fossum, T.W. 2012. Small Animal Surgery, 4th ed. Elsevier Press, St. Louis, Mo.
   Smith, K., McCoy, K.D., and Macpherson, A.J. 2007. Use of axenic animals in studying the adaptation of mammals to their commensal intestinal microbiota. Semin. Immunol. 19:59‐69.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library