Phenotypic Analysis of BAT versus WAT Differentiation

Matthias Rosenwald1, Aliki Perdikari1, Elisabeth Weber1, Christian Wolfrum1

1 Institute of Food, Nutrition, and Health, ETH Zurich, Schwerzenbach, Switzerland
Publication Name:  Current Protocols in Mouse Biology
Unit Number:   
DOI:  10.1002/9780470942390.mo130167
Online Posting Date:  December, 2013
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The Western world is in the midst of an epidemic of obesity, which is the cause of severe clinical complications such as type 2 diabetes, hypertension, and cardiovascular disease. Obesity develops when energy intake chronically exceeds energy expenditure; thus, either reducing the energy intake and/or increasing the energy expenditure has been used in the treatment and prevention of obesity. On a cellular level, energy storage is mediated by white adipocyte tissue (WAT). In contrast, brown adipose tissue (BAT) contributes to body temperature and metabolic homeostasis by metabolizing lipids and glucose. Adipose tissue is a notoriously difficult tissue to work with, due to the high content of triglycerides and the fragility of the cells. In this unit, several approaches to analysis of BAT and WAT are described that overcome these limitations. Curr. Protoc. Mouse Biol. 3:205‐216 © 2013 by John Wiley & Sons, Inc.

Keywords: white adipose tissue; brown adipose tissue; adipogenesis; adipocytes; FACS; cryosectioning

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Fluorescent‐Activated Cell Sorting (FACS) of Mature Adipocytes
  • Basic Protocol 2: qPCR Analysis of Brown Versus White Adipose Tissue
  • Basic Protocol 3: Cryosectioning and Staining of Brown and White Adipose Tissue
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Fluorescent‐Activated Cell Sorting (FACS) of Mature Adipocytes

  Materials
  • Collagenase buffer (see recipe)
  • Collagenase type II (Clostridium histolyticum; Sigma, cat. no. C6885‐1g)
  • Phosphate‐buffered saline (PBS)
  • Transgenic mouse with endogenous fluorescence in adipocytes (see for details)
  • Dulbecco's modified Eagle medium (DMEM) supplemented with 10% FBS and 1× penicillin/streptomycin (all ingredients from Life Technologies)
  • FACS buffer (see recipe), cold
  • 1 mg/ml 7‐aminoactinomycin D (7‐AAD; Sigma, cat. no. A9400‐1mg)
  • RNA lysis buffer (from MultiMACS cDNA Synthesis Kit; Miltenyi Biotec, cat. no. 130‐094‐410)
  • 60‐mm cell culture plate
  • Dissection tools
  • Shaker
  • 15‐ and 50‐ml conical polypropylene tubes (e.g., BD Falcon)
  • Centrifuge
  • 100‐µm sieve (CellTrics from Partec)
  • FACS tubes
  • FACS instrument (e.g., Aria III High Speed Sorter; BD Bioscience)

Basic Protocol 2: qPCR Analysis of Brown Versus White Adipose Tissue

  Materials
  • Adipose tissue samples (WAT and/or BAT)
  • RNA purification kit or supplies (appropriate with respect to handling lipid‐laden samples; e.g., RNeasy Plus Micro Kit, Qiagen, cat. no. 74034; RNeasy Lipid Tissue Mini Kit, Qiagen, cat. no. 75842)
  • cDNA reverse transcription kit (High Capacity cDNA Reverse Transcription Kit; Applied Biosystems, cat. no. 4368813)
  • Primer pairs for designated housekeeping (see below) and target genes (Table 13.1.6700)
  • Tissue homogenizer
  • Thermal cycler
  • Plates/wells and sealant for thermal cycler
Table 3.1.1   MaterialsPrimer Sequences for qRT‐PCR Reactions

Target gene Forward primer Reverse primer
36B4 GCCGTGATGCCCAGGGAAGA CATCTGCTTGGAGCCCACGTT
Cidea ACTTCCTCGGCTGTCTCAATGTCA TCAGCAGATTCCTTAACACGGCCT
Cox7a1 CAGCGTCATGGTCAGTCTGT AGAAAACCGTGTGGCAGAGA
Fabp4 ACAAGCTGGTGGTGGAATGTG CCTTTGGCTCATGCCCTTT
Lep CAGGATCAATGACATTTCACACA GCTGGTGAGGACCTGTTGAT
Pparg AGGCGAGGGCGATCTTGACAG AATTCGGATGGCCACCTCTTTG
Retn CTGTCCAGTCTATCCTTGCACAC CAGAAGGCACAGCAGTCTTGA
TFIIB a TGGAGATTTGTCCACCATGA GAATTGCCAAACTCATCAAAACT
Ucp1 GGGCATTCAGAGGCAAATCAGCTT ACACTGCCACACCTCCAGTCATTA

 aWalden et al. ( ).

Basic Protocol 3: Cryosectioning and Staining of Brown and White Adipose Tissue

  Materials
  • Fixation solution (see recipe)
  • Transgenic mouse with endogenous fluorescence in adipocytes (see for details)
  • Phosphate‐buffered saline (PBS)
  • Cryopreservation solution (see recipe)
  • Dry ice
  • OCT medium (Tissue‐Tek from Sakura)
  • Permeabilization solution (see recipe)
  • 0.05% (w/v) Triton X‐100 in PBS
  • Primary antibody solution (see recipe)
  • Secondary antibody solution (see recipe)
  • Vectashield HardSet (Vector Labs)
  • DAPI
  • Clear nail polish
  • Embedding cassettes
  • Aluminum foil
  • Plastic bags or boxes for storage
  • Cryotome with fresh cutting blades
  • SuperFrost Plus slides
  • Coverslips
  • Inverted laser‐scanning confocal microscope (Rajwa, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Cinti, S. 2005. The adipose organ. Prostaglandins Leukot. Essent. Fatty Acids 73:9‐15.
  Jaradat, S.A., Ko, M.S., and Grossman, L.I. 1998. Tissue‐specific expression and mapping of the Cox7ah gene in mouse. Genomics 49:363‐370.
  MacDougald, O.A., Hwang, C.S., Fan, H., and Lane, M.D. 1995. Regulated expression of the obese gene product (leptin) in white adipose tissue and 3T3‐L1 adipocytes. Proc. Natl. Acad. Sci. U.S.A. 92:9034‐9037.
  Nedergaard, J., Bengtsson, T., and Cannon, B. 2011. New powers of brown fat: Fighting the metabolic syndrome. Cell Metab. 13:238‐240.
  Petrovic, N., Walden, T.B., Shabalina, I.G., Timmons, J.A., Cannon, B., and Nedergaard, J. 2010. Chronic peroxisome proliferator‐activated receptor gamma (PPARgamma) activation of epididymally derived white adipocyte cultures reveals a population of thermogenically competent, UCP1‐containing adipocytes molecularly distinct from classic brown adipocytes. J. Biol. Chem. 285:7153‐7164.
  Rajwa, B. 2005. Modern confocal microscopy. Curr. Protoc. Cytom. 31:12.3.1‐12.3.12.
  Rosenwald, M., Perdikari, A., Rulicke, T., and Wolfrum, C. 2013. Bi‐directional interconversion of brite and white adipocytes. Nat. Cell. Biol. 15:659‐667.
  Steppan, C.M., Bailey, S.T., Bhat, S., Brown, E.J., Banerjee, R.R., Wright, C.M., Patel, H.R., Ahima, R.S., and Lazar, M.A. 2001. The hormone resistin links obesity to diabetes. Nature 409:307‐312.
  Tseng, Y.H., Cypess, A.M., and Kahn, C.R. 2010. Cellular bioenergetics as a target for obesity therapy. Nat. Rev. Drug Discov. 9:465‐482.
  Walden, T.B., Hansen, I.R., Timmons, J.A., Cannon, B., and Nedergaard, J., 2012. Recruited vs. nonrecruited molecular signatures of brown, “brite,” and white adipose tissues. Am. J. Physiol. Endocrinol. Metab. 302:E19‐E31.
  Wu, J., Bostrom, P., Sparks, L.M., Ye, L., Choi, J.H., Giang, A.H., Khandekar, M., Virtanen, K.A., Nuutila, P., Schaart, G., Huang, K., Tu, H., van Marken Lichtenbelt, W.D., Hoeks, J., Enerback, S., Schrauwen, P., and Spiegelman, B.M. 2012. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell 150:366‐376.
  Young, P., Arch, J.R., and Ashwell, M. 1984. Brown adipose tissue in the parametrial fat pad of the mouse. FEBS Lett. 167:10‐14.
  Zhou, Z., Yon Toh, S., Chen, Z., Guo, K., Ng, C.P., Ponniah, S., Lin, S.C., Hong, W., and Li, P. 2003. Cidea‐deficient mice have lean phenotype and are resistant to obesity. Nat. Genet. 35:49‐56.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library