Tissue‐Specific Regulation of Oncogene Expression Using Cre‐Inducible ROSA26 Knock‐In Transgenic Mice

Brandi L. Carofino1, Monica J. Justice2

1 Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas, 2 Genetics and Genome Biology, The Hospital for Sick Children, Toronto, Ontario
Publication Name:  Current Protocols in Mouse Biology
Unit Number:   
DOI:  10.1002/9780470942390.mo140150
Online Posting Date:  June, 2015
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Cre‐inducible mouse models are often utilized for the spatial and temporal expression of oncogenes. With the wide number of Cre recombinase lines available, inducible transgenesis represents a tractable approach to achieve discrete oncogene expression. Here, we describe a protocol for targeting Cre‐inducible genes to the ubiquitously expressed ROSA26 locus. Gene targeting provides several advantages over standard transgenic techniques, including a known site of integration and previously characterized pattern of expression. Historically, an inherent instability of ROSA26 targeting vectors has hampered the efficiency of developing ROSA26 knock‐in lines. In this protocol, we provide individual steps for utilizing Gateway recombination for cloning as well as detailed instructions for screening targeted ES cell clones. By following this protocol, one can achieve germline transmission of a ROSA26 knock‐in line within several months. © 2015 by John Wiley & Sons, Inc.

Keywords: ROSA26; oncogene; Cre‐inducible; Gateway; In‐Fusion; Southern blotting; JM8A3 ES cells

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Design and Cloning of ROSA26 Targeting Vectors
  • Basic Protocol 2: Screening for Successful Targeting of the ROSA26 Locus
  • Reagents and Solutions
  • Commentary
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Design and Cloning of ROSA26 Targeting Vectors

  Materials
  • Gateway pENTR vector (Life Technologies)
  • One Shot ccdB Survival 2 T1R Competent Cells (Life Technologies, cat. no. A10460)
  • Construct containing gene of interest
  • AmpliTaq Gold 360 Master Mix (Life Technologies, cat. no. 4398881)
  • Appropriate restriction enzymes
  • 1% TBE agarose gel with 0.5 μg/ml ethidium bromide (also see Voytas, )
  • QIAquick Gel Extraction Kit (Qiagen, cat. no. 28704)
  • In‐Fusion HD Cloning Plus Kit (Clontech, cat. no. 638909)
  • pRosa26‐DEST vector (Addgene, plasmid 21189)
  • LB broth (see recipe)
  • Ampicillin
  • Gateway LR Clonase II Enzyme Mix (Life Technologies, cat. no. 11791‐100)
  • TE buffer: 10 mM Tris·Cl, pH 8.0/1 mM EDTA
  • SURE2 Supercompetent Cells (Agilent Technologies, cat. no. 200152)
  • LB agar plates: prepare LB broth (see recipe) containing 15 g/liter agar
  • EndoFree Plasmid Maxi Kit (Qiagen, cat. no. 12362)
  • 0.7% TBE agarose gel with 0.5 μg/ml ethidium bromide (also see Voytas, )
  • 0.5 M disodium EDTA, pH 8.0
  • Phenol:chloroform:isoamyl alcohol (25:24:1)
  • Chloroform
  • 3 M sodium acetate, pH 5.2
  • 70% and 100% ethanol
  • 37°C shaking bacterial incubator
  • Spectrophotometer
  • 30°C shaking bacterial incubator
  • Additional reagents and equipment for PCR (Kramer and Coen, ), agarose gel electrophoresis (Voytas, ), determining DNA concentration by spectrophotometry (Gallagher, ), and DNA minipreps (Engebrecht et al., ) or maxipreps (Heilig et al., )

Basic Protocol 2: Screening for Successful Targeting of the ROSA26 Locus

  Materials
  • ROSA26‐targeted ES cell clones, grown to confluency in 96‐well plate
  • Phosphate‐buffered saline (PBS; Life Technologies, cat. no. 10010‐023)
  • 70% ethanol
  • Nuclease‐free H 2O
  • Apex Hot Start 2× Master Mix, Blue (Genesee Scientific, cat. no. 42‐148)
  • Oligonucleotide primers (Table 14.1.5000)
  • 1% and 0.8% TBE agarose gels with 0.5 μg/ml ethidium bromide (Voytas, )
  • Southern restriction enzyme cocktail (see recipe)
  • 6× DNA loading dye (see recipe)
  • Denaturing solution (see recipe)
  • Neutralizing solution (see recipe)
  • TrackIt λ DNA/Hind III fragments (Life Technologies, cat. no. 10488‐064)
  • 10× and 2× SSC (see recipe for 20×)
  • 0.1× SSC (see recipe for 20×)/1% (w/v) SDS
  • Church‐Gilbert hybridization solution (see recipe)
  • Oligonucleotide probes (see Critical Parameters)
  • AmpliTaq Gold 360 Master Mix (Life Technologies, cat. no. 4398881)
  • QIAquick PCR Purification Kit (Qiagen, cat. no. 28104)
  • Prime‐It II Random Primer Labeling Kit (Agilent Technologies, cat. no. 300385)
  • [α‐32P]dATP
  • Sonicated salmon sperm DNA (Life Technologies, cat. no. 15632‐011)
  • 55°C incubator
  • Humidified chamber (sealed plastic container containing moistened paper towels)
  • Spectrophotometer
  • Camera
  • Fluorescent ruler
  • Cross‐linking apparatus (e.g., Stratagene UV Stratalinker 2400)
  • UV light box
  • Non‐reactive glass dish (9 × 13–in. for a large gel)
  • Orbital shaker
  • Nylon membrane, Hybond XL (GE Healthcare cat. no. RPN303S)
  • Upward capillary transfer apparatus (see Brown, , and description under step 17)
  • Whatman 3MM filter paper
  • Hybridization tubes
  • 65°C hybridization oven
  • Illustra ProbeQuant G50 Micro Columns (GE Healthcare, cat. no. 28‐9034‐08)
  • Geiger counter
  • Plastic sheet protectors
  • Film cassette with intensifying screens or phosphor imager
  • Autoradiography film
  • Aluminum foil
  • Film developer
  • Additional reagents and equipment for determining DNA concentration by spectrophotometry (Gallagher, ), PCR (Kramer and Coen, ), and agarose gel electrophoresis (Voytas, )
Table 4.1.1   MaterialsPrimer List for ROSA26 PCR and Southern Blotting

Primer Sequence (5′‐3′)
ROSA26 PCR screen forward GGCGGACTGGCGGGACTA
ROSA26 PCR screen reverse GGGACAGGATAAGTATGACATCATCAAGG
ROSA26 5′ Southern probe F GGCTCCTCAGAGAGCCTC
ROSA26 5′ Southern probe R CCGGCTGTCTCACAGAAC
ROSA26 3′ Southern probe F ACTTCCCACAGATTTTCGGTT
ROSA26 3′ Southern probe R TCTCAAGCAGGAGAGTATAAAACTC

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Abe, T., Kiyonari, H., Shioi, G., Inoue, K.‐I., Nakao, K., Aizawa, S., and Fujimori, T. 2011. Establishment of conditional reporter mouse lines at ROSA26 locus for live cell imaging. Genesis 49:579‐590.
  Bäckman, C.M., Zhang, Y., Malik, N., Shan, L., Hoffer, B.J., Westphal, H., and Tomac, A.C. 2009. Generalized tetracycline induced Cre recombinase expression through the ROSA26 locus of recombinant mice. J. Neurosci. Methods 176:16‐23.
  Bernard, P. and Couturier, M. 1992. Cell killing by the F plasmid CcdB protein involves poisoning of DNA‐topoisomerase II complexes. J. Mol. Biol. 226:735‐745.
  Bernard, P., Kézdy, K.E., Van Melderen, L., Steyaert, J., Wyns, L., Pato, M.L., Higgins, P.N., and Couturier, M. 1993. The F plasmid CcdB protein induces efficient ATP‐dependent DNA cleavage by gyrase. J. Mol. Biol. 234:534‐541.
  Bhatia, M., Elefanty, A.G., Fisher, S.J., Patient, R., Schlaeger, T., and Snyder, E.Y. (eds.) 2015. Current Protocols in Stem Cell Biology. John Wiley & Sons, Inc., Hoboken, N.J.
  Blake, J.A., Bult, C.J., Eppig, J.T., Kadin, J.A., Richardson, J.E., and Mouse Genome Database Group. 2014. The mouse genome database: Integration of and access to knowledge about the laboratory mouse. Nucleic Acids Res. 42:D810‐D817.
  Brown, T. 2001. Southern blotting. Curr. Protoc. Immunol. 6:10.6.1‐10.6.13.
  Carofino, B.L., Ayanga, B., and Justice, M.J. 2013. A mouse model for inducible overexpression of Prdm14 results in rapid‐onset and highly penetrant T‐cell acute lymphoblastic leukemia (T‐ALL). Dis. Model. Mech. 6:1494‐1506.
  Casola, S. 2010. Mouse models for miRNA expression: The ROSA26 locus. Methods Mol. Biol. 667:145‐163.
  Engebrecht, J., Brent, R. and Kaderbhai, M.A. 1991. Minipreps of plasmid DNA. Curr. Protoc. Mol. Biol. 15:1.6.1‐1.6.10.
  Frese, K.K. and Tuveson, D.A. 2007. Maximizing mouse cancer models. Nat. Rev. Cancer 7:654‐658.
  Friedrich, G. and Soriano, P. 1991. Promoter traps in embryonic stem cells: A genetic screen to identify and mutate developmental genes in mice. Genes Dev. 5:1513‐1523.
  Gallagher, S.R. 2011. Quantitation of DNA and RNA with absorption and fluorescence spectroscopy. Curr. Protoc. Mol. Biol. 93:A.3D.1‐A.3D.14.
  Heilig, J., Elbing, K.L., and Brent, R. 1998. Large‐scale preparation of plasmid DNA. Curr. Protoc. Mol. Biol. 41:1.7.1‐1.7.16.
  Hasegawa, Y., Daitoku, Y., Sekiguchi, K., Tanimoto, Y., Mizuno‐Iijima, S., Mizuno, S., Kajiwara, N., Ema, M., Miwa, Y., Mekada, K., Yoshiki, A., Takahashi, S., Sugiyama, F., and Yagami, K. 2013. Novel ROSA26 Cre‐reporter knock‐in C57BL/6N mice exhibiting green emission before and red emission after Cre‐mediated recombination. Exp. Anim. 62:295‐304.
  Hohenstein, P., Slight, J., Ozdemir, D., Burn, S., Berry, R., and Hastie, N. 2008. High‐efficiency Rosa26 knock‐in vector construction for Cre‐regulated overexpression and RNAi. PathoGenetics 1:3.
  Imayoshi, I., Hirano, K., Sakamoto, M., Miyoshi, G., Imura, T., Kitano, S., Miyachi, H., and Kageyama, R. 2012. A multifunctional teal‐fluorescent Rosa26 reporter mouse line for Cre‐ and Flp‐mediated recombination. Neurosci. Res. 73:85‐91.
  Jullien, N., Goddard, I., Selmi‐Ruby, S., Fina, J.‐L., Cremer, H., and Herman, J.‐P. 2008. Use of ERT2‐iCre‐ERT2 for conditional transgenesis. Genesis 46:193‐199.
  Kleinhammer, A., Wurst, W., and Kühn, R. 2013. Target validation in mice by constitutive and conditional RNAi. Methods Mol. Biol. 986:307‐323.
  Kramer, M.F. and Coen, D.M. 2001. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 56:15.1.1‐15.1.14.
  Luche, H., Weber, O., Nageswara Rao, T., Blum, C., and Fehling, H.J. 2007. Faithful activation of an extra‐bright red fluorescent protein in “knock‐in” Cre‐reporter mice ideally suited for lineage tracing studies. Eur. J. Immunol. 37:43‐53.
  Mao, X., Fujiwara, Y., and Orkin, S.H. 1999. Improved reporter strain for monitoring Cre recombinase‐mediated DNA excisions in mice. Proc. Natl. Acad. Sci. U.S.A. 96:5037‐5042.
  Mao, X., Fujiwara, Y., Chapdelaine, A., Yang, H., and Orkin, S.H. 2001. Activation of EGFP expression by Cre‐mediated excision in a new ROSA26 reporter mouse strain. Blood 97:324‐326.
  Muzumdar, M.D., Tasic, B., Miyamichi, K., Li, L., and Luo, L. 2007. A global double‐fluorescent Cre reporter mouse. Genesis 45:593‐605.
  Nagy, A., Mar, L., and Watts, G. 2009. Creation and use of a cre recombinase transgenic database. Methods Mol. Biol. 530:365‐378.
  Pettitt, S.J., Liang, Q., Rairdan, X.Y., Moran, J.L., Prosser, H.M., Beier, D.R., Lloyd, K.C., Bradley, A., and Skarnes, W.C. 2009. Agouti C57BL/6N embryonic stem cells for mouse genetic resources. Nat. Methods 6:493‐495.
  Safran, M., Kim, W.Y., Kung, A.L., Horner, J.W., DePinho, R.A., and Kaelin, W.G. 2003. Mouse reporter strain for noninvasive bioluminescent imaging of cells that have undergone Cre‐mediated recombination. Mol. Imaging 2:297‐302.
  Shioi, G., Kiyonari, H., Abe, T., Nakao, K., Fujimori, T., Jang, C.‐W., Huang, C.‐C., Akiyama, H., Behringer, R.R., and Aizawa, S. 2011. A mouse reporter line to conditionally mark nuclei and cell membranes for in vivo live‐imaging. Genesis 49:570‐578.
  Soriano, P. 1999. Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat. Genet. 21:70‐71.
  Srinivas, S., Watanabe, T., Lin, C.‐S., William, C.M., Tanabe, Y., Jessell, T.M., and Costantini, F. 2001. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus. BMC Dev. Biol. 1:4.
  Sukup‐Jackson, M.R., Kiraly, O., Kay, J.E., Na, L., Rowland, E.A., Winther, K.E., Chow, D.N., Kimoto, T., Matsuguchi, T., Jonnalagadda, V.S., Maklakova, V.I., Singh, V.R., Wadduwage, D.N., Rajapakse, J., So, P.T.C., Collier, L.S., and Engelward, B.P., 2014. Rosa26‐GFP direct repeat (RaDR‐GFP) mice reveal tissue‐ and age‐dependence of homologous recombination in mammals in vivo. PLoS Genet. 10:e1004299.
  Tompers, D.M. and Labosky, P.A. 2004. Electroporation of murine embryonic stem cells: A step‐by‐step guide. Stem Cells 22:243‐249.
  Ueda, J., Maehara, K., Mashiko, D., Ichinose, T., Yao, T., Hori, M., Sato, Y., Kimura, H., Ohkawa, Y., and Yamagata, K. 2014. Heterochromatin dynamics during the differentiation process revealed by the DNA methylation reporter mouse, MethylRO. Stem Cell Rep. 2:910‐924.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Yamamoto, M., Shook, N.A., Kanisicak, O., Yamamoto, S., Wosczyna, M.N., Camp, J.R., and Goldhamer, D.J. 2009. A multifunctional reporter mouse line for Cre‐ and FLP‐dependent lineage analysis. Genesis 47:107‐114.
  Zambrowicz, B.P., Imamoto, A., Fiering, S., Herzenberg, L.A., Kerr, W.G., and Soriano, P. 1997. Disruption of overlapping transcripts in the ROSA beta geo 26 gene trap strain leads to widespread expression of beta‐galactosidase in mouse embryos and hematopoietic cells. Proc. Natl. Acad. Sci. U.S.A. 94:3789‐3794.
Internet Resources
  http://tools.lifetechnologies.com/content/sfs/manuals/pentrdualselectionvectors_man.pdf
  Selection guide and manual for choosing Gateway pENTR vectors.
  http://bioinfo.clontech.com/infusion/convertPcrPrimersInit.do
  Tool for converting PCR primers into In‐Fusion primers.
  http://www.informatics.jax.org/searchtool/Search.do?query="gt%28rosa%2926sor"
  Listing of gene‐trapped ROSA26 alleles.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library