Analysis of mtDNA/nDNA Ratio in Mice

Pedro M. Quiros1, Aashima Goyal1, Pooja Jha1, Johan Auwerx1

1 Laboratory for Integrative and Systems Physiology, École Polytechnique Federale de Lausanne, Lausanne
Publication Name:  Current Protocols in Mouse Biology
Unit Number:   
DOI:  10.1002/cpmo.21
Online Posting Date:  March, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Mitochondrial DNA (mtDNA) lacks the protection provided by the nucleosomes in the nuclear DNA and does not have a DNA repair mechanism, making it highly susceptible to damage, which can lead to mtDNA depletion. mtDNA depletion compromises the efficient function of cells and tissues and thus impacts negatively on health. Here, we describe a brief and easy protocol to quantify mtDNA copy number by determining the mtDNA/nDNA ratio. The procedure has been validated using a cohort of young and aged mice. © 2017 by John Wiley & Sons, Inc.

Keywords: mtDNA; ND1; qPCR; 16SrRNA

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1:

  Materials
  • Mouse (take ∼10 to 30 mg liver or other tissue) or mouse cells growing in 6‐ or 12‐well plates
  • 1× phosphate‐buffered saline (PBS), pH 7.4 (Gibco, cat. no.10010‐015)
  • Lysis buffer (LB; see recipe)
  • 20 mg/ml proteinase K, recombinant, PCR‐grade (Sigma‐Aldrich, cat. no. 3115836001)
  • 5 mg/ml RNase A (ThermoFisher, cat. no. EN0531)
  • Optional: Ultrapure 25:24:1 (v/v/v) phenol:chloroform: isoamyl alcohol (ThermoFisher, cat. no. 15593031)
  • 7.5 M ammonium acetate solution (see recipe)
  • Isopropanol (Fisher Scientific, cat. no. P/7500/17)
  • 70% ethanol (Reactolab, cat. no. 96170)
  • TE buffer (see recipe)
  • 16S rRNA forward and reverse primers:
    • FWD: 5′‐CCGCAAGGGAAAGATGAAAGAC‐3′
    • REV: 5′‐TCGTTTGGTTTCGGGGTTTC‐3′
  • ND1 forward and reverse primers:
    • FWD: 5′‐CTAGCAGAAACAAACCGGGC‐3′
    • REV: 5′‐CCGGCTGCGTATTCTACGTT‐3′
  • HK2 forward and reverse primers:
    • FWD: 5′‐GCCAGCCTCTCCTGATTTTAGTGT‐3′
    • REV: 5′‐GGGAACACAAAAGACCTCTTCTGG‐3′
  • qPCR SYBR Green Mix (LightCycler® 480 SYBR Green I Master; Roche Life Science, cat. no. 4887352001)
  • 1.5‐ml and 2‐ml microcentrifuge tubes
  • 55ºC water bath
  • NanoDrop 2000 UV‐vis spectrophotometer
  • 15‐ml conical tubes (e.g., BD Falcon)
  • 384‐well microtiter plates
  • Plate seals (ThermalSeal RTS Sealing Films, Excel Scientific, cat. no. Z734438)
  • Centrifuge with plate adapter
  • Thermal cycler designed for qPCR (LightCycler® 480 Instrument II, Roche)
  • GraphPad Prism software
  • Additional reagents and equipment for anesthesia (Adams and Pacharinsak, ) and sacrifice (Donovan and Brown, ) of mice
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Abolhassani, N., Leon, J., Sheng, Z., Oka, S., Hamasaki, H., Iwaki, T., and Nakabeppu, Y. 2016. Molecular pathophysiology of impaired glucose metabolism, mitochondrial dysfunction, and oxidative DNA damage in Alzheimer's disease brain. Mech. Ageing Dev. pii:S0047‐6374(16)30072‐0. [Epub ahead of print].
  Adams, S. and Pacharinsak, C. 2015. Mouse anesthesia and analgesia. Curr. Protoc. Mouse Biol. 5:51‐63. doi: 10.1002/9780470942390.mo140179.
  Bogenhagen, D.F. 2012. Mitochondrial DNA nucleoid structure. Biochim. Biophys. Acta 2012:914‐920. doi: 10.1016/j.bbagrm.2011.11.005.
  Bratic, A. and Larsson, N.G. 2013. The role of mitochondria in aging. J. Clin. Invest. 123:951‐957. doi: 10.1172/JCI64125.
  Donovan, J. and Brown, P. 2006. Euthanasia. Curr. Protoc. Immunol. 73:1.8.1‐1.8.4. doi: 10.1002/0471142735.im0108s73.
  El‐Hattab, A.W. and Scaglia, F. 2013. Mitochondrial DNA depletion syndromes: Review and updates of genetic basis, manifestations, and therapeutic options. Neurotherapeutics 10:186‐198. doi: 10.1007/s13311‐013‐0177‐6.
  Gomez‐Cabrera, M.C., Sanchis‐Gomar, F., Garcia‐Valles, R., Pareja‐Galeano, H., Gambini, J., Borras, C., and Vina, J. 2012. Mitochondria as sources and targets of damage in cellular aging. Clin. Chem. Lab. Med. 50:1287‐1295. doi: 10.1515/cclm‐2011‐0795.
  He, L., Chinnery, P.F., Durham, S.E., Blakely, E.L., Wardell, T.M., Borthwick, G.M., Taylor, R.W., and Turnbull, D.M. 2002. Detection and quantification of mitochondrial DNA deletions in individual cells by real‐time PCR. Nucleic Acids Res. 30:e68. doi: 10.1093/nar/gnf067.
  Kazachkova, N., Raposo, M., Montiel, R., Cymbron, T., Bettencourt, C., Silva‐Fernandes, A., Silva, S., Maciel, P., and Lima, M. 2013. Patterns of mitochondrial DNA damage in blood and brain tissues of a transgenic mouse model of Machado‐Joseph disease. Neurodegener Dis. 11:206‐214. doi: 10.1159/000339207.
  Kennedy, S.R., Loeb, L.A., and Herr, A.J. 2012. Somatic mutations in aging, cancer and neurodegeneration. Mech. Ageing Dev. 133:118‐126. doi: 10.1016/j.mad.2011.10.009.
  Phillips, N.R., Sprouse, M.L., and Roby, R.K. 2014. Simultaneous quantification of mitochondrial DNA copy number and deletion ratio: A multiplex real‐time PCR assay. Sci. Rep. 4:3887. doi: 10.1038/srep03887.
  Quiros, P.M., Ramsay, A.J., Sala, D., Fernandez‐Vizarra, E., Rodriguez, F., Peinado, J.R., Fernandez‐Garcia, M.S., Vega, J.A., Enriquez, J.A., Zorzano, A., and Lopez‐Otin, C. 2012. Loss of mitochondrial protease OMA1 alters processing of the GTPase OPA1 and causes obesity and defective thermogenesis in mice. EMBO J. 31:2117‐2133. doi: 10.1038/emboj.2012.70.
  Ramos, A., Kazachkova, N., Silva, F., Maciel, P., Silva‐Fernandes, A., Duarte‐Silva, S., Santos, C., and Lima, M. 2015. Differential mtDNA damage patterns in a transgenic mouse model of Machado‐Joseph disease (MJD/SCA3). J. Mol. Neurosci. 55:449‐453. doi: 10.1007/s12031‐014‐0360‐1.
  Sepe, S., Milanese, C., Gabriels, S., Derks, K.W., Payan‐Gomez, C., van, I.W.F., Rijksen, Y.M., Nigg, A.L., Moreno, S., Cerri, S., Blandini, F., Hoeijmakers, J.H., and Mastroberardino, P.G. 2016. Inefficient DNA repair Is an aging‐related modifier of Parkinson's disease. Cell Rep. 15:1866‐1875. doi: 10.1016/j.celrep.2016.04.071.
  Tanhauser, S.M. and Laipis, P.J. 1995. Multiple deletions are detectable in mitochondrial DNA of aging mice. J. Biol. Chem. 270:24769‐24775. doi: 10.1074/jbc.270.42.24769.
  Trifunovic, A. and Larsson, N.G. 2008. Mitochondrial dysfunction as a cause of ageing. J. Intern. Med. 263:167‐178. doi: 10.1111/j.1365‐2796.2007.01905.x.
  Young, M.J. and Copeland, W.C. 2016. Human mitochondrial DNA replication machinery and disease. Curr. Opin. Genet. Dev. 38:52‐62. doi: 10.1016/j.gde.2016.03.005.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library