Chemical Synthesis of RNA Sequences with 2′‐O‐[(Triisopropylsilyl)oxy]methyl‐protected Ribonucleoside Phosphoramidites

Stefan Pitsch1, Patrick A. Weiss2

1 Institut de Chimie Organique, EPFL, Lausanne, null, 2 Xeragon AG, Zürich, null
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 3.8
DOI:  10.1002/0471142700.nc0308s07
Online Posting Date:  February, 2002
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

The [(triisopropylsilyl)oxy]methyl (TOM) group is a useful protecting group for the 2¢-OH of ribonucleosides to be used for oligoribonucleotide synthesis by the phosphoramidite method. It is completely stable to all reaction conditions applied during assembly and the first deprotection step. It does not interfere with the coupling reaction and leads to very good coupling yields under DNA-coupling conditions. The final cleavage occurs quantitatively without concomitant destruction of the RNA product. This unit describes the synthesis of TOM-phosphoramidites from 2¢-O-TOM-5¢-O-dimethoxytrityl-N-acetyl ribonucleosides, oligoribonucleotide assembly on an automated DNA synthesizer, and subsequent deprotection. Preparation of the TOM-protected ribonucleosides is presented elsewhere in the series.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Unit Introduction
  • Basic Protocol 1: Preparation of 2¢-O-TOM-Protected Phosphoramidites
  • Basic Protocol 2: Assembly of 2¢-O-TOM-Protected Phosphoramidites on DNA Synthesizers
  • Basic Protocol 3: Deprotection of RNA Sequences Assembled from 2¢-O-TOM-Protected Phosphoramidites
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of 2¢-O-TOM-Protected Phosphoramidites

 Materials
  • Nitrogen or argon gas source
  • N-Acetyl-5¢-O-(4,4¢-dimethoxytrityl)-2¢-O-[(triisopropylsilyl)oxy]methyl ribonucleosides (unit 2.9):
  •     N6-Ac-5¢-O-DMTr-2¢-O-TOM-adenosine (S.1a)
  •     N2-Ac-5¢-O-DMTr-2¢-O-TOM-guanosine (S.1b)
  •     N4-Ac-5¢-O-DMTr-2¢-O-TOM-cytidine (S.1c)
  •     5¢-O-DMTr-2¢-O-TOM-uridine (S.1d)
  • Dichloromethane
  • N-Ethyl-N,N-diisopropylamine
  • 2-Cyanoethyl-N,N-diisopropylchlorophosphoramidite (Aldrich)
  • Ethyl acetate
  • Hexane
  • Methanol
  • Anisaldehyde reagent (see recipe)
  • Silica gel (230 to 400 mesh, Fluka or Merck)
  • Sand
  • 250-mL one-neck flask equipped with a stir bar
  • Rubber septum
  • Balloon
  • 50-µL syringe
  • TLC plates (Merck silica gel 60, 4 × 10–cm)
  • 254-nm UV lamp
  • 5-cm-diameter chromatography column
  • Rotary evaporator with a vacuum pump or water aspirator
  • Additional reagents and equipment for thin-layer chromatography (TLC; appendix 3D) and column chromatography (appendix 3E)

Basic Protocol 2: Assembly of 2¢-O-TOM-Protected Phosphoramidites on DNA Synthesizers

 Materials
  • 2¢-O-TOM-phosphoramidites (0.1 M in acetonitrile; Glen Research; see Basic Protocol 1)
  • Activator: 0.25 M 5-ethylthio-1H-tetrazole (SET, Glen Research) in acetonitrile
  • Argon source
  • Dry acetonitrile (<30 ppm water)
  • 4A molecular sieves (optional)
  • Detritylation solution (see recipe)
  • Oxidation solution (see recipe)
  • Capping solutions A and B (see recipe recipe)
  • 1,2-Dichloroethane (reagent grade)
  • Solid support, e.g., long-chain alkylamine controlled-pore glass (CPG) supports (500 or 1000 Å) for RNA synthesis derivatized with 5¢-O-4,4¢-dimethoxytrityl- ated ribonucleosides (Glen Research)
  • Vials and bottles for attachment of the phosphoramidites and reagents to the synthesizer
  • Automated DNA synthesizer (e.g., GeneAssembler; Amersham Pharmacia Biotech)
  • Synthesis column for 1-µmol or 10-µmol synthesis
  • Additional reagents and equipment for automated DNA synthesis (appendix 3C)

Basic Protocol 3: Deprotection of RNA Sequences Assembled from 2¢-O-TOM-Protected Phosphoramidites

 Materials
  • TOM-protected oligoribonucleotide attached to solid support (see Basic Protocol 2), in synthesis cartridge
  • 12 M aqueous methylamine
  • 8 M methylamine in ethanol (Fluka)
  • 50% and 100% (v/v) ethanol
  • 1 M tetra-n-butylammonium fluoride trihydrate (TBAF×3H2O; Fluka) in tetrahydrofuran (THF)
  • N-Methylpyrrolidone (NMP) or dimethylformamide (DMF; optional)
  • 1 M Tris×Cl, pH 7.4, RNase free, sterile (Fluka, for molecular biology)
  • 3 M sodium acetate (appendix 2A)
  • 1.5-, 2-, and 5-mL twist-top vials
  • 35°C incubator or heating block
  • Speedvac evaporator
  • NAP-10 columns (Amersham Pharmacia Biotech)
  • Additional reagents and equipment for oligoribonucleotide purification by HPLC (unit 10.5) or polyacrylamide gel electrophoresis (PAGE; unit 10.4)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •  FigureFigure 3.8.1 Preparation of the four 2¢-O-TOM-protected ribonucleoside phosphoramidites S.2a-S.2d. DMTr, 4,4¢-dimethoxytrityl; i-Pr2NEt, N-ethyl-N,N-diisopropylamine; i-Pr2NP(Cl)OCH2CH2CN, 2-cyanoethyl-N,N-diisopropylchlorophosphoramidite.
  •  FigureFigure 3.8.2 One coupling cycle—including detritylation, coupling, capping, and oxidation—required for the attachment of one nucleotide to the growing oligonucleotide chain. Additionally, after the last coupling cycle, the terminal dimethoxytrityl group is removed from the immobilized oligonucleotide. B, any N-protected nucleobase; Bz, benzoyl; CPG, controlled-pore glass; DMTr, 4,4¢-dimethoxytrityl; TOM, [(triisopropylsilyl)oxy]methyl.
  •  FigureFigure 3.8.3 Two-step deprotection of oligoribonucleotide sequences assembled from TOM-phosphoramidites. B, any nucleobase; BAc, any N-acetylated nucleobase; CPG, controlled-pore glass; TBAF, tetra-n-butylammonium fluoride; TOM, [(triisopropylsilyl)oxy]methyl.
  •  FigureFigure 3.8.4 Capillary gel electrophoresis analysis of the 34-mer RNA sequence r(GGCGACCCUGAUGAGGCCGAAAGGCCGAAACCGU) prepared at the 10-µmol scale according to Basic Protocols 2 and 3; (A) crude product; (B) product after HPLC purification. Chromatography performed with BioFocus 3000 (Bio-Rad), coated BioCap XL-column 75 µm × 40 cm, “run-buffer” containing 6 M urea, elution with 15 kV at 40°C, detection at 260 nm.
  •  FigureFigure 3.8.5 Polyacrylamide gel electrophoresis (PAGE) of five crude RNA sequences (sequence length indicated) prepared at the 1-µmol scale according to Basic Protocols 2 and 3. PAGE-conditions: 15% (w/v) acrylamide (29:1 acrylamide/bisacrylamide), 0.75 × 100 mm, 90 mM Tris-borate, pH 8.3, 7 M urea, 2 mM EDTA, elution at 200 V, stained with ethidium bromide.

Videos

Literature Cited

Literature Cited
    Beaucage, S.L. and Caruthers, M.H. 1996. The chemical synthesis of DNA/RNA. In Bioorganic Chemistry: Nucleic Acids (S.M. Hecht, ed.) pp. 36-74. Oxford University Press, Oxford.
    Griffin, B.E. and Reese, C.B. 1964. Oligoribonucleotide synthesis via 2¢,5¢-protected ribonucleoside derivatives. Tetrahedron Lett. 5:2925-2931.
    Hogrefe, R.I., McCaffrey, A.P., Borozdine, L.U., McCampbell, E.S., and Vaghefi, M.M. 1993. Effect of excess water on the desilylation of oligoribonucleotides using tetrabutylammonium fluoride. Nucl. Acids Res. 21:4739-4741.
    Ogilvie, K.K., Sadana, K.L., Thompson, E.A., Quilliam, M.A., and Westmore, J.B. 1974. The use of silyl protecting groups in protecting the hydroxyl functions of ribonucleosides. Tetrahedron Lett. 15:2861-2863.
    Ohtsuka, E., Tanaka, S., and Ikehara, M. 1974. Ribooligonucleotide synthesis using a photosensitive o-nitrobenzyl protection at the 2¢-hydroxyl group. Nucl. Acids Res. 1:1351-1357.
    Pitsch, S. 1997. An efficient synthesis of enantiomeric oligoribonucleotides from D-glucose. Helv. Chim. Acta 80:2286-2314.
    Pitsch, S., Weiss, P.A., Wu, X., Ackermann, D., and Honegger, T. 1999a. Fast and reliable automated synthesis of RNA and partially 2¢-O-protected precursors (‘caged RNA’) based on two novel, orthogonal 2¢-O-protecting groups. Helv. Chim. Acta 82:1753-1761.
    Pitsch, S., Weiss, P.A., and Jenny, L. Nov. 1999b. Ribonucleoside-derivative and method for preparing the same. US Patent 5,986,084.
    Pitsch, S., Weiss, P.A., Jenny, L., Stutz, A., and Wu, X. 2001. Reliable chemical synthesis of oligoribonucleotides (RNA) with 2¢-O-[(triisopropylsilyl)oxy]methyl (2¢-O-TOM) protected phosphoramidites. Helv. Chim. Acta In press.
    Reese, C.B., Rao, M.V., Serafinowska, H.T., Thompson, E.A., and Yu, P.S. 1991. Studies in the solid phase synthesis of oligo- and poly-ribonucleotides. Nucleosides Nucleotides 10:81-97.
    Scaringe, S.A., Wincott, F.E., and Caruthers, M.H. 1998. Novel RNA synthesis method using 5¢-O-silyl-2¢-O-orthoester protecting groups. J. Am. Chem. Soc. 120:11820-11821.
    Schwartz, M.E., Breaker, R.R., Asteriadis, G.T., deBear, J.S., and Gough, G.R. 1992. Rapid synthesis of oligoribonucleotides using 2¢-O-(ortho-nitrobenzyloxymethyl)-protec ted monomers. Bioorg. Med. Chem. Lett. 2:1019-1024.
    Usman, N., Pon, R.T., and Ogilvie, K.K. 1985. Preparation of ribonucleoside 3¢-O-phosphoramidites and their application to the automated solid-phase synthesis of oligonucleotides. Tetrahedron Lett. 26:4567-4570.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library