Synthesis and Application of Highly Reactive Amino Linkers for Functional Oligonucleotides

Naoshi Kojima1, Yasuo Komatsu1

1 Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Sapporo, Japan
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 4.48
DOI:  10.1002/0471142700.nc0448s48
Online Posting Date:  March, 2012
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Oligonucleotides are functionalized by conjugation with a variety of molecules, and aliphatic amino linkers have been frequently used as a tether for their modifications. This unit describes the syntheses and applications of novel amino linkers having a carbamate structure. Two major chemical properties of the primary amine are induced by the neighboring effect of the carbamate group, which are found to be optimum in an aminoethyl carbamate structure. First, the hydrophobic monomethoxytrityl group can be rapidly removed from the aminoethyl carbamate under very mild acidic conditions, while the deprotection is not completed in standard aliphatic amines even under high acid concentration. This significant feature enables the convenient purification of amino‐modified oligonucleotides by using the hydrophobic interaction of the monomethoxytrityl group with a reverse‐phase resin. Second, the introduction of the carbamate linkage reduces the pKa value of the neighboring primary amine, resulting in an increase in the conjugation yields with various functional molecules, such as those having active esters. The novel amino linkers that have an aminoethyl carbamate linkage indicate potent activity and are applicable for the preparation of various functional oligonucleotides. Curr. Protoc. Nucleic Acid Chem. 48:4.48.1‐4.48.23. © 2012 by John Wiley & Sons, Inc.

Keywords: oligonucleotide; amino linker; carbamate; purification; modification; array; conjugation

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of ssR Linker Phosphoramidites
  • Basic Protocol 2: Synthesis and Purification of ssR‐Modified Oligonucleotides
  • Basic Protocol 3: Incorporation of Reporter Groups to Amino‐Modified Oligonucleotides
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of ssR Linker Phosphoramidites

  Materials
  • (S)‐(+)‐2,2‐Dimethyl‐1,3‐dioxolane‐4‐methanol, 98% ( S.1; Aldrich)
  • 1‐(Chloromethyl)naphthalene, 90% ( S.2; Aldrich)
  • Toluene, anhydrous, drying with 4Å molecular sieves
  • 1,4‐Dioxane, anhydrous, drying with 4Å molecular sieve
  • Potassium hydroxide (KOH)
  • Argon gas
  • Ethyl acetate (EtOAc)
  • Hexane
  • Brine (saturated aqueous sodium chloride; NaCl)
  • Sodium sulfate (Na 2SO 4), anhydrous
  • Acetic acid
  • Ethanol (EtOH)
  • Silica gels: Wakogel C‐200 (particle size 75 to 150 µm, Wako Pure Chemical Industries) or Silica Gel 60 (particle size 105 to 210 µm, Nacalai Tasque)
  • Pyridine, anhydrous, drying with 4Å molecular sieves
  • p‐Toluenesulfonyl chloride (p‐TsCl)
  • Saturated aqueous sodium hydrogencarbonate (NaHCO 3)
  • N,N‐Dimethylformamide (DMF), anhydrous, drying with 4 Å molecular sieves
  • Sodium azide (NaN 3)
  • Ammonium chloride (NH 4Cl)
  • Palladium‐activated carbon (Pd 10%), (Pd/C)
  • Hydrogen gas (H 2)
  • 4‐Methoxytrityl chloride (MMTCl)
  • Triethylamine (Et 3N)
  • (R)‐(–)‐Glycidyl methyl ether ( S.5; Wako Pure Chemical Industries)
  • (S)‐(+)‐1‐Amino‐2‐propanol, 98% ( S.6c; Aldrich)
  • 2‐Aminoethanol, 99% ( S.6d; Wako Pure Chemical Industries)
  • 1,1′‐Carbonyldiimidazole
  • 4‐Dimethylaminopyridine (DMAP)
  • 6‐Amino‐1‐hexanol
  • N,N‐Diisopropylethylamine (redistilled), 99.5% (Sigma‐Aldrich)
  • 2‐Cyanoethyl N,N‐diisopropylchlorophosphoramidite (Wako Pure Chemical Industries)
  • 3‐Amino‐1‐propanol, 98% ( S.10; Wako Pure Chemical Industries)
  • Chloroform (CHCl 3)
  • Dimethyl sulfoxide‐d 6 (DMSO‐d 6), 99.9% atom% D
  • Dichloromethane (CH 2Cl 2), anhydrous, drying with 4 Å molecular sieves
  • 50‐, 100‐, 200‐, 300‐, and 500‐mL round‐bottom flasks
  • Condenser
  • TLC, Merck silica gel 60F 254 precoated plates
  • 254‐nm UV lamp (for TLC)
  • Rotary evaporator equipped with a diaphragm pump
  • Glass column with a diameter of 2.0 cm, 3.5 cm, 4.0 cm, 4.5 cm, and 5.0 cm
  • Vacuum oil pump
  • Celite pad
  • Additional reagent and equipment for TLC ( appendix 3D) and column chromatography ( appendix 3E)

Basic Protocol 2: Synthesis and Purification of ssR‐Modified Oligonucleotides

  Materials
  • ssR Linker phosphoramidites ( S.9a‐d and S.13; see protocol 1)
  • Acetonitrile (CH 3CN), anhydrous, drying with 3 Å molecular sieves
  • Standard 2′‐deoxynucleoside 5′‐O‐(4,4′‐dimethoxytrityl) phosphoramidites (Glen Research):
    • N‐Benzoyl‐2′‐deoxyadenosine phosphoramidite
    • N‐Benzoyl‐2′‐deoxycytidine phosphoramidite or N‐Acetyl‐2′‐deoxycytidine phosphoramidite
    • N‐Isobutylyl‐2′‐deoxyguanosine phosphoramidite
    • Thymidine phosphoramidite
  • Argon gas
  • 28% Aq. ammonia
  • 2 M Triethylammonium acetate (TEAA), pH 7.0 (Glen Research)
  • Sterilized H 2O
  • Trifluoroacetic acid
  • Buffer A: 5% CH 3CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
  • Buffer B: 50% CH 3CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
  • Buffer C: 20% CH 3CN in H 2O (ion‐exchange HPLC)
  • Buffer D: 20% CH 3CN in 2 M ammonium formate (ion‐exchange HPLC)
  • DNA synthesizer
  • 4‐mL screw‐capped glass vial
  • 55°C incubator
  • Reverse‐phase open column (YMC C18, 500 mg)
  • Rotary evaporator equipped with a diaphragm pump
  • 0.45 µm disposable filter
  • 1.5‐mL microcentrifuge tubes
  • HPLC system with:
    • Column: 3.9 × 150 mm µ‐Bondasphere (Waters) or 4.6 × 250 mm TSK‐gel DEAE‐2SW (TOSOH)
    • Detector: 254 nm
  • Additional reagents and equipment for automated solid‐phase ONT synthesis ( appendix 3C) and purification of ONTs (units 10.1, 10.4, 10.5, 10.7& 3.NaN)

Basic Protocol 3: Incorporation of Reporter Groups to Amino‐Modified Oligonucleotides

  Materials
  • 5′‐amino‐modified ONT (X‐25: 5′‐X‐TCTTCCAAGCAATTCCAATGAAAGC, X = ssR, C6, C5; see protocol 2)
  • 1 M sodium phosphate buffer (pH 8)
  • Sterilized H 2O
  • Fluorescein isothiocyanate (FITC; Dojindo)
  • N,N‐Dimethylformamide (DMF), anhydrous, drying with 4 Å molecular sieves
  • Biotin succinimidyl ester (Biotin‐NHS) (Dojindo)
  • 2 M Triethylammonium acetate (TEAA), pH 7.0 (Glen Research)
  • Buffer A, C: 5% CH 3CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
  • Buffer B: 50% CH 3CN in 0.1 M TEAA, pH 7.0 (reverse‐phase HPLC)
  • Acetonitrile (CH 3CN), anhydrous, drying with 3 Å molecular sieves
  • Argon gas
  • Cholesteryl chloroformate
  • 4‐Dimethylaminopyridine (DMAP)
  • N,N‐Diisopropylethylamine (DIEA; redistilled), 99.5% (Sigma‐Aldrich)
  • Dichloromethane (CH 2Cl 2), anhydrous, drying with 4 Å molecular sieves
  • 28% Aq. ammonia
  • Buffer D: 100% CH 3CN
  • NAP10 column (Amersham Pharmacia)
  • HPLC system with:
    • Column: 3.9 × 150 mm µ‐Bondasphere (Waters)
    • Detector: 254 nm
  • 0.45‐µm Disposable filter
  • 1.5‐mL microcentrifuge tubes
  • DNA/RNA synthesizer
  • 4‐mL Screw‐capped glass vial
  • Rotary evaporator equipped with a diaphragm pump
  • Sintered glass funnel
  • Additional reagents and equipment for automated solid‐phase ONT synthesis ( appendix 3C), and purification of ONTs (units 10.1, 10.4, 10.5, 10.7& 3.NaN)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Agrawal, S., Christodoulou, C., and Gait, M.J. 1986. Efficient methods for attaching non‐radioactive labels to the 5′ end of synthetic oligodeoxyribonucleotides. Nucleic Acids Res. 14:6227‐6245.
   Beaucage, S.L. and Iyer, R.P. 1993. The functionalization of oligonucleotides via phosphoramidite derivatives. Tetrahedron 49:1925‐1963.
   Beier, M. and Hoheisel, J.D. 1999. Versatile derivatization of solid support media for covalent bonding on DNA‐microchips. Nucleic Acids Res. 27:1970‐1977.
   Epstein, J.R., Lee, M., and Walt, D.R. 2002. High‐density fiber‐optic genosensor microsphere array capable of zeptomole detection limits. Anal. Chem. 74:1836‐1840.
   Epstein, J.R., Ferguson, J.A., Lee, K.H., and Walt, D.R. 2003. Combinatorial decoding: An approach for universal DNA array fabrication. J. Am. Chem. Soc. 125:13753‐13759.
   Gryaznov, S.M. and Lloyd, D.H. 1993. Modulation of oligonucleotide duplex and triplex stability via hydrophobic interactions. Nucleic Acids Res. 21:5909‐5915.
   Kojima, N., Sugino, M., Mikami, A., Nonaka, K., Fujinawa, Y., Muto, I., Matsubara, K., Ohtsuka, E., and Komatsu, Y. 2006. Enhanced reactivity of amino‐modified oligonucleotides by insertion of aromatic residue. Bioorg. Med. Chem. Lett. 16:5118‐5121.
   Kojima, N., Takebayashi, T., Mikami, A., Ohtsuka, E., and Komatsu, Y. 2009a. Efficient synthesis of oligonucleotide conjugates on solid‐support using an (aminoethoxycarbonyl)aminohexyl group for 5′‐terminal modification. Bioorg. Med. Chem. Lett. 19:2144‐2147.
   Kojima, N., Takebayashi, T., Mikami, A., Ohtsuka, E., and Komatsu, Y. 2009b. Construction of highly reactive probes for abasic site detection by introduction of an aromatic and a guanidine residue into an aminooxy group. J. Am. Chem. Soc. 131:13208‐13209.
   Komatsu, Y., Kojima, N., Sugino, M., Mikami, A., Nonaka, K., Fujinawa, Y., Sugimoto, T., Sato, K., Matsubara, K., and Ohtsuka, E. 2008. Novel amino linkers enabling efficient labeling and convenient purification of amino‐modified oligonucleotides. Bioorg. Med. Chem. 16:941‐949.
   Kumar, R., El‐Sagheer, A., Tumpane, J., Lincoln, P., Wilhelmsson, L.M., and Brown, T. 2007. Template‐directed oligonucleotide strand ligation, covalent intramolecular DNA circularization and catenation using click chemistry. J. Am. Chem. Soc. 129:6859‐6864.
   Lee, L.G., Connell, C.R., and Bloch, W. 1993. Allelic discrimination by nick‐translation PCR with fluorogenic probes. Nucleic Acids Res. 21:3761‐3766.
   Ocampo, S.M., Albericio, F., Fernández, I., Vilaseca, M., and Eritja, R. 2005. A straightforward synthesis of 5′‐peptide oligonucleotide conjugates using N‐Fmoc‐protected amino acids. Org. Lett. 7:4349‐4352.
   Shelbourne, M., Chen, X., Brown, T., and El‐Sagheer, A.H. 2011. Fast copper‐free click DNA ligation by the ring‐strain promoted alkyne‐azide cycloaddition reaction. Chem. Commun. 47:6257‐6259.
   Sinha, N.D. and Cook, R.M. 1988. The preparation and application of functionalized synthetic oligonucleotides: III. Use of H‐phosphonate derivatives of protected amino‐hexanol and mercapto‐propanol or‐hexanol. Nucleic Acids Res. 16:2659‐2669.
   Smith, L.M., Fung, S., Hunkapiller, M.W., Hunkapilerand, T.J., and Hood, L.E. 1985. The synthesis of oligonucleotides containing an aliphatic amino group at the 5′ terminus: Synthesis of fluorescent DNA primers for use in DNA sequence analysis. Nucleic Acids Res. 13:2399‐2412.
   Tetzlaff, C.N., Schwope, I., Bleczinski, C.F., Steinberg, J.A., and Richert, C. 1998. A convenient synthesis of 5′‐amino‐5′‐deoxythymidine and preparation of peptide‐DNA hybrids. Tetrahedron Lett. 39:4215‐4218.
   Venkatesan, N. and Kin, B. H. 2006. Peptide conjugates of oligonucleotides: Synthesis and applications. Chem. Rev. 106:3712‐3761.
   Wachter, L., Jablonski, J.A., and Ramachandran, K.L. 1986. A simple and efficient procedure for the synthesis of 5′‐aminoalkyl oligodeoxynucleotides. Nucleic Acids Res. 14:7985‐7994.
   Weizmann, Y., Chenoweth, D.M., and Swager, T.M. 2011. DNA‐CNT nanowire networks for DNA detection. J. Am. Chem. Soc. 133:3238‐3241.
   Withey, G.D., Kim, J.H., and Xu, J. 2008. DNA‐programmable multiplexing for scalable, renewable redox protein bio‐nanoelectronics. Bioelectrochemistry 74:111‐117.
   Zammatteo, N., Jeanmart, L., Hamels, S., Courtois, S., Louette, P., Hevesi, L., and Remacle, J. 2000. Comparison between different strategies of covalent attachment of DNA to glass surfaces to build DNA microarrays. Anal. Biochem. 280:143‐150.
   Zaramella, S., Yeheskiely, E., and Strömberg, R. 2004. A method for solid‐phase synthesis of oligonucleotide 5′‐peptide‐conjugates using acid‐labile α‐amino protection. J. Am. Chem. Soc. 126:14029‐14035.
   Zatsepin, T.S., Stetsenko, D.A., Gait, M.J., and Oretskaya, T.S. 2005. Use of carbonyl group addition‐elimination reactions for synthesis of nucleic acid conjugates. Bioconjug. Chem. 16:471‐489.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library