An Amphipathic trans‐Acting Phosphorothioate DNA Element Delivers Uncharged PNA and PMO Nucleic Acid Sequences in Mammalian Cells

Harsh V. Jain1, Serge L. Beaucage1

1 Laboratory of Biological Chemistry, Food and Drug Administration, Silver Spring, Maryland
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 4.69
DOI:  10.1002/0471142700.nc0469s64
Online Posting Date:  March, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

An innovative approach to the delivery of uncharged peptide nucleic acids (PNAs) and phosphorodiamidate morpholino (PMO) oligomers in mammalian cells is described and consists of extending the sequence of those oligomers with a short PNA‐polyA or PMO‐polyA tail. Recognition of the polyA‐tailed PNA or PMO oligomers by an amphipathic trans‐acting polythymidylic thiophosphate triester element (dTtaPS) results in efficient internalization of those oligomers in several cell lines. The authors’ findings indicate that cellular uptake of the oligomers occurs through an energy‐dependent mechanism and macropinocytosis appears to be the predominant endocytic pathway used for internalization. The functionality of the internalized oligomers is demonstrated by alternate splicing of the pre‐mRNA encoding luciferase in HeLa pLuc 705 cells. Amphipathic phosphorothioate DNA elements may represent a unique class of cellular transporters for robust delivery of uncharged nucleic acid sequences in live mammalian cells. © 2016 by John Wiley & Sons, Inc.

Keywords: PNA oligomers; PMO oligomers; nucleic acid–based drug delivery; cellular internalization; alternate splicing of luciferase pre‐mRNA

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Preparation of Deoxyribonucleoside Phosphoramidites (4 and 5)
  • Support Protocol 1: Preparation of N,N,N′,N′‐Tetraisopropylphosphordiamidites (2 and 3)
  • Basic Protocol 2: Solid‐Phase Synthesis of trans‐Acting Polythymidylic Thiophosphate Triester Element dTtaPS (6)
  • Support Protocol 2: Formation of Complexes Between dTtaPS and PNA or PMO Oligomers
  • Basic Protocol 3: dTtaPS‐Mediated Cellular Internalization of PNA or PMO Oligomers in Live Mammalian Cells
  • Basic Protocol 4: Luciferase Assay for Determining the Bioactivity of PNA and PMO Oligomers in HeLa pLUC 705 Cells
  • Alternate Protocol 1: Luciferase PRE‐mRNA Splice Correction Assay for Determining the Bioactivity of PNA and PMO Oligomers in HeLa pLUC 705 Cells
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Preparation of Deoxyribonucleoside Phosphoramidites (4 and 5)

  Materials
  • N,N,N′,N′‐Tetraisopropyl‐O‐[3‐(N,N‐dimethylamino)prop‐1‐yl]phosphordiamidite (2; see protocol 2) or N,N,N′,N′‐tetraisopropyl‐O‐(octan‐1‐yl)phosphordiamidite (3; see protocol 2)
  • Argon or nitrogen source
  • Anhydrous acetonitrile (MeCN, Glen Research)
  • 5′‐O‐(4,4′‐Dimethoxytrityl)‐2′‐deoxythymidine (1; ChemGenes Corporation)
  • 0.45 M 1H‐tetrazole in MeCN (Glen Research)
  • Triethylamine (Aldrich)
  • Hexane (Fisher)
  • Dichloromethane (CH 2Cl 2; Fisher)
  • Silica gel (60‐Å, 230 to 400 mesh; EMD)
  • Anhydrous benzene (Aldrich)
  • Dry ice/acetone bath
  • 50‐, 100‐, and 250‐mL round‐bottom flasks
  • Magnetic stirrer and stir bars
  • Rubber septa for 14/20‐ and 24/40‐glass joints
  • 1‐, 3‐ and 10‐mL Luer‐tipped glass syringes
  • 5‐mm NMR tubes
  • NMR spectrometer (Bruker)
  • Rotary evaporator equipped with dry ice condenser and connected to oil pump
  • 2.5 × 20–cm disposable Flex chromatography columns (Kontes)
  • 2.5 × 7.5–cm EMD TLC plates pre‐coated with a 250‐μm layer of silica gel 60 F 254
  • Hand‐held UV 254 lamp (UVP)
  • Lyophilizer

Support Protocol 1: Preparation of N,N,N′,N′‐Tetraisopropylphosphordiamidites (2 and 3)

  Additional Materials (also see protocol 1)
  • bis(N,N‐Diisopropylamino)chlorophosphine (Aldrich)
  • 3‐(N,N‐Dimethylamino)propan‐1‐ol (Aldrich) or 1‐octanol (Aldrich)
  • 1‐mL syringes
  • Pasteur pipets
  • Vacuum desiccator
  • High‐vacuum oil pump
  • Büchner funnel setup with vacuum source

Basic Protocol 2: Solid‐Phase Synthesis of trans‐Acting Polythymidylic Thiophosphate Triester Element dTtaPS (6)

  Materials
  • Reagents for automated solid‐phase oligonucleotide synthesis (Glen Research):
    • 5′‐O‐(4,4′‐Dimethoxytrityl)‐3′‐O‐[(N,N‐diisopropylamino)(3‐[N,N‐dimethylamino]prop‐1‐yl)oxy]phosphinyl‐2′‐deoxythymidine (4, see protocol 2)
    • 5′‐O‐(4,4′‐Dimethoxytrityl)‐3′‐O‐[(N,N‐diisopropylamino)(octan‐1‐yl)oxy]phosphinyl‐2′‐deoxythymidine (5, see protocol 2)
    • Succinylated long chain alkylamine controlled‐pore glass support loaded with 0.2 μmol 5′‐O‐(4,4′‐dimethoxytrityl)‐2′‐deoxythymidine
    • Deblocking solution: trichloroacetic acid (TCA) in dichloromethane (CH 2Cl 2)
    • Activator solution: 1H‐tetrazole in acetonitrile
    • Cap A solution: acetic anhydride in THF/pyridine
    • Cap B solution: 1‐methylimidazole in THF
    • Sulfuration solution: 0.05 M 3‐(dimethylaminomethylidene)amino‐3H‐1,2,4‐dithiazole‐3‐thione in (2:3 v/v) pyridine/MeCN
  • Methylamine gas cylinder (Aldrich)
  • Triethylamine (Aldrich)
  • Anhydrous acetonitrile (Glen Research)
  • DNA/RNA synthesizer (e.g., 394 DNA/RNA synthesizer, Applied Biosystems)
  • Stainless‐steel pressure vessel equipped with a valve system (Parr Instrument)
  • High‐vacuum oil pump
  • 1‐mL glass syringe
  • 1.5‐mL microcentrifuge tubes
  • UV/vis spectrophotometer (Agilent Technologies)
  • 25‐cm × 4.6‐mm, 300‐Å Jupiter C‐4 HPLC column (5 μm; Phenomenex)
  • HPLC instrument (Agilent Technologies)

Support Protocol 2: Formation of Complexes Between dTtaPS and PNA or PMO Oligomers

  Additional Materials (also see protocol 3)
  • OptiMEM (Life Technologies)
  • PNA oligomers 7 to 15 (PNA Bio, Inc.) and PMO oligomers 16 to 21 (GeneTools, LLC)
  • dTtaPS (6, see protocol 3)
  • 1.5‐mL microcentrifuge tubes
  • Pipettor (Corning)
  • 37°C water bath (Thermo Scientific)

Basic Protocol 3: dTtaPS‐Mediated Cellular Internalization of PNA or PMO Oligomers in Live Mammalian Cells

  Materials
  • Live mammalian cells:
    • HEK293 cells (ATCC CRL‐1573)
    • HeLa cells (ATCC CCL‐2)
    • HeLa pLuc 705 cells (donated by Professor Rudolph Juliano, University of North Carolina‐Chapel Hill School of Medicine, )
    • MCF7 cells (ATCC HTB‐22)
    • SK‐N‐SH cells (ATCC HTB‐11)
  • Fetal bovine serum (FBS, Life Technologies)
  • Dulbecco's minimum essential medium (DMEM) supplemented with 10% (and 20%) heat‐inactivated fetal bovine serum (10% FBS‐DMEM and 20% FBS‐DMEM) (see recipe)
  • 0.25% Trypsin (MediaTech)
  • Dulbecco's phosphate‐buffered saline, pH 7.4, supplemented with 2% fetal bovine serum (Life Technologies), ice cold
  • 0.4% Trypan blue (MediaTech)
  • Monensin (Sigma)
  • 100× L‐glutamine (Life Technologies)
  • 100× penicillin‐streptomycin (Life Technologies)
  • 100 mM sodium pyruvate (Life Technologies)
  • 50 mg/mL hygromycin B (Life Technologies)
  • 75‐cm2 flask (Corning)
  • 37°C, 5% CO 2 humidified incubator (Thermo Scientific)
  • Cellometer Auto T4 Cell Viability Counter (Nexcelom)
  • Flat‐bottom, 96‐well tissue‐culture plates (BD‐Falcon)
  • Vacuum aspirator
  • FACS tubes (Falcon)
  • 1.5‐mL microcentrifuge tubes
  • FACScan flow cytometer (Becton Dickinson)

Basic Protocol 4: Luciferase Assay for Determining the Bioactivity of PNA and PMO Oligomers in HeLa pLUC 705 Cells

  Materials
  • HeLa pLuc 705 cells (donated by Professor Rudolph Juliano, Uiversity of North Carolina, Chapel Hill)
  • Fetal bovine serum (FBS, Life Technologies)
  • DMEM (Life Technologies)
  • Serum‐free medium (OptiMEM, Life Technologies)
  • 2× stock solution of each of the dTtaPS/PNA oligomer 10, 11, or 12 complexes and each of the dTtaPS/PMO oligomer 19, 20, or 21 complexes (see protocol 4)
  • 2× Pierce luciferase cell lysis buffer (ThermoFisher)
  • Bright‐Glow reagent (Promega)
  • Pierce Coomassie (Bradford) protein assay kit (ThermoFisher)
  • Black 96‐well plate (Corning)
  • Vacuum aspirator
  • 1.5‐mL microcentrifuge tubes
  • 37°C, 5% CO 2 humidified incubator (Thermo Scientific)
  • Mechanical shaker
  • White 96‐well plate (Corning)
  • Luminescence microplate reader (FilterMax F3 Multi‐Mode microplate reader, Molecular Devices)

Alternate Protocol 1: Luciferase PRE‐mRNA Splice Correction Assay for Determining the Bioactivity of PNA and PMO Oligomers in HeLa pLUC 705 Cells

  Additional Materials (also see protocol 6)
  • HeLa pLuc 705 cell lysates (see protocol 6)
  • 2× stock solutions of dTtaPS/PNA oligomer 10 complexes and dTtaPS/PMO oligomer 19 complexes (see protocol 4)
  • TRIzol (Life Technologies)
  • High‐capacity cDNA reverse transcription kit (Applied Biosystems, cat. no. 4368813)
  • Power SYBR Green PCR Master Mix (Thermo Fisher)
  • Forward and reverse primers 5′‐TTGATATGTGGATTTCGAGTCGTC and 5′‐TGTCAATCAGAGTGCTTTTGGCG, respectively (Integrated DNA Technologies)
  • 1× phosphate buffered saline, pH 7.4 (PBS, MediaTech)
  • DEPC‐treated water (Invitrogen)
  • 5× nucleic acid sample buffer (Bio‐Rad)
  • 3% agarose gels stained with ethidium bromide (Bio‐Rad)
  • 10× TBE buffer, pH 8.3 (Bio‐Rad)
  • 20‐bp molecular ladder (Bio‐Rad)
  • 0.2‐mL 8‐strip PCR tubes (Eppendorf)
  • 1.5‐mL microcentrifuge tubes
  • PCR thermal cycler (e.g., GeneAmp PCR System 9700, Applied Biosystems)
  • DNA Sub Cell electrophoresis horizontal gel chamber (Bio‐Rad)
  • Power supply (Pharmacia)
  • GE ImageQuant LAS 4000 scanner (GE Healthcare)
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Aartsma‐Rus, A. and Van Ommen, G.J.B. 2007. Antisense‐mediated exon skipping: A versatile tool with therapeutic and research applications. RNA 13:1609–1624. doi: 10.1261/rna.653607.
  Abes, S., Moulton, H.M., Clair, P., Prevot, P., Youngblood, D.S., Wu, R.P., Iversen, P.L., and Lebleu, B. 2006. Vectorization of morpholino oligomers by the (R‐Ahx‐R)4 peptide allows efficient splicing correction in the absence of endosomolytic agents. J. Control. Release 116:304–313. doi: 10.1016/j.jconrel.2006.09.011.
  Abes, S., Turner, J.J., Ivanova, G.D., Owen, D., Williams, D., Arzumanov, A., Clair, P., Gait, M.J., and Lebleu, B. 2007. Efficient splicing correction by PNA conjugation to an R6‐Penetratin delivery peptide. Nucleic Acids Res. 35:4495–4502. doi: 10.1093/nar/gkm418.
  Bendifallah, N., Rasmussen, F.W., Zachar, V., Ebbesen, P., Nielsen, P.E., and Koppelhus, U. 2006. Evaluation of cell‐penetrating peptides (CPPs) as vehicles for intracellular delivery of antisense peptide nucleic acid (PNA). Bioconjugate Chem. 17:750–758. doi: 10.1021/bc050283q.
  Cirak, S., Arechavala‐Gomeza, V., Guglieri, M., Feng, L., Torelli, S., Anthony, K., Abbs, S., Garralda, M.A., Bourke, J., Wells, D.J., Dickson, G., Wood, M.J.A., Wilton, S.D., Straub, V., Kole, R., Shrewsbury, S.B., Sewry, C., Morgan, J.E., Bushby, K., and Muntoni, F. 2011. Exon skipping and dystrophin restoration in patients with Duchenne muscular dystrophy after systemic phosphorodiamidate morpholino oligomer treatment: An open‐label, phase 2, dose‐escalation study. Lancet 378:595–605. doi: 10.1016/S0140‐6736(11)60756‐3.
  Ellington, A. and Pollard, J.D. Jr. 2000. Introduction to the synthesis and purification of oligonucleotides. In Current Protocols in Nucleic Acid Chemistry, Vol. I (S.L. Beaucage, D.E. Bergstrom, G.D. Glick, and R.A. Jones, eds.) pp. A.3C.1–A.3C.22. John Wiley & Sons, Inc., Hoboken.
  Fletcher, S., Honeyman, K., Fall, A.M., Harding, P.L., Johnsen, R.D., and Wilton, S.D. 2006. Dystrophin expression in the mdx mouse after localised and systemic administration of a morpholino antisense oligonucleotide. J. Gene. Med. 8:207–216. doi: 10.1002/jgm.838.
  Harding, P.L., Fall, A.M., Honeyman, K., Fletcher, S., and Wilton, S.D. 2007. The influence of antisense oligonucleotide length on dystrophin exon skipping. Mol. Ther. 15:157–166. doi: 10.1038/sj.mt.6300006.
  Ivanova, G.D., Arzumanov, A., Abes, R., Yin, H., Wood, M.J.A., Lebleu, B., and Gait, M.J. 2008. Improved cell‐penetrating peptide‐PNA conjugates for splicing redirection in HeLa cells and exon skipping in mdx mouse muscle. Nucleic Acids Res. 36:6418–6428. doi: 10.1093/nar/gkn671.
  Iyer, R.P., Phillips, L.R., Egan, W., Regan, J.B., and Beaucage, S.L. 1990. The automated synthesis of sulfur‐containing oligodeoxyribonucleotides using 3H‐1,2‐benzodithiol‐3‐one 1,1‐dioxide as a sulfur‐transfer reagent. J. Org. Chem. 55:4693–4699. doi: 10.1021/jo00302a039.
  Jain, H.V., Verthelyi, D., and Beaucage, S.L. 2015. Amphipathic trans‐acting phosphorothioate DNA elements mediate the delivery of uncharged nucleic acid sequences in mammalian cells. RSC Adv. 5:65245–65254. doi: 10.1039/C5RA12038A.
  Jain, H.V., Takeda, K., Tami, C., Verthelyi, D., and Beaucage, S.L. 2013. Assessment of the cellular internalization of thermolytic phosphorothioate DNA oligonucleotide prodrugs. Bioorg. Med. Chem. 21:6224–6232. doi: 10.1016/j.bmc.2013.04.071.
  Järver, P., O'Donovan, L., and Gait, M.J. 2014. A chemical view of oligonucleotides for exon skipping and related drug applications. Nucleic Acid Ther. 24:37–47. doi: 10.1089/nat.2013.0454.
  Kang, S‐H., Cho, M‐J., and Kole, R. 1998. Up‐regulation of luciferase gene expression with antisense oligonucleotides: Implications and applications in functional assay development. Biochemistry 37:6235–6239.
  Khalil, I.A., Kogure, K., Akita, H., and Harashima, H. 2006. Uptake pathways and subsequent intracellular trafficking in nonviral gene delivery. Pharmacol. Rev. 58:32–45. doi: 10.1124/pr.58.1.8.
  Lu, Q.L., Mann, C.J., Lou, F., Bou‐Gharios, G., Morris, G.E., Xue, S.A., Fletcher, S., Partridge, T.A., and Wilton, S.D. 2003. Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat. Med. 9:1009–1014. doi: 10.1038/nm897.
  Lu, Q.L., Rabinowitz, A., Chen, Y.C., Yokota, T., Yin, H., Alter, J., Jadoon, A., Bou‐Gharios, G., and Partridge, T. 2005. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body‐wide skeletal muscles. Proc. Natl. Acad. Sci. U.S.A. 102:198–203. doi: 10.1073/pnas.0406700102.
  Mann, C.J., Honeyman, K., McClorey, G., Fletcher, S., and Wilton, S.D. 2002. Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J. Gene Med. 4:644–654. doi: 10.1002/jgm.295.
  Maslov, M.A., Kabilova, T.O., Petukhov, I.A., Morozova, N.G., Serebrennikova, G.A., Vlassov, V.V., and Zenkova, M.A. 2012. Novel cholesterol spermine conjugates provide efficient cellular delivery of plasmid DNA and small interfering RNA. J. Control. Release 160:182–193. doi: 10.1016/j.jconrel.2011.11.023.
  Moulton, H.M. and Moulton, J.D. 2010. Morpholinos and their peptide conjugates: Therapeutic promise and challenge for Duchenne muscular dystrophy. Biochim. Biophys. Acta 1798:2296–2303. doi: 10.1016/j.bbamem.2010.02.012.
  Moulton, H.M., Hase, M.C., Smith, K.M., and Iversen, P.L. 2003. HIV Tat peptide enhances cellular delivery of antisense morpholino oligomers. Antisense Nucleic Acid Drug Dev. 13:31–43. doi: 10.1089/108729003764097322.
  Moulton, H.M., Nelson, M.H., Hatlevig, S.A., Reddy, M.T., and Iversen, P.L. 2004. Cellular uptake of antisense morpholino oligomers conjugated to arginine‐rich peptides. Bioconjugate Chem. 15:290–299. doi: 10.1021/bc034221g.
  Moulton, J.D. and Jiang, S. 2009. Gene knockdowns in adult animals: PPMOs and vivo‐morpholinos. Molecules 14:1304–1323. doi: 10.3390/molecules14031304.
  O'Donovan, L., Okamoto, I., Arzumanov, A.A., Williams, D.L., Deuss, P., and Gait, M.J. 2015. Parallel synthesis of cell‐penetrating peptide conjugates of PMO toward exon skipping enhancement in Duchenne muscular dystrophy. Nucleic Acid Ther. 25:1–10. doi: 10.1089/nat.2014.0512.
  Pan, Q., Shai1, O., Lee, L.J., Frey, B.J., and Blencowe, B.J. 2008. Deep surveying of alternative splicing complexity in the human transcriptome by high‐throughput sequencing. Nat. Genet. 40:1413–1415. doi: 10.1038/ng.259.
  Prater, C.E. and Miller, P.S. 2004. 3'‐Methylphosphonate‐modified oligo‐2'‐O‐methylribonucleotides and their Tat peptide conjugates: Uptake and stability in mouse fibroblasts in culture. Bioconjugate Chem. 15:498–507. doi: 10.1021/bc049977+.
  Shiraishi, T. and Nielsen, P.E. 2011. Peptide nucleic acid (PNA) cell penetrating peptide (CPP) conjugates as carriers for cellular delivery of antisense oligomers. Artificial DNA: PNA & XNA 2:90–99. doi: 10.4161/adna.2.3.
  Shiraishi, T., Pankratova, S., and Nielsen, P.E. 2005. Calcium ions effectively enhance the effect of antisense peptide nucleic acids conjugated to cationic Tat and oligoarginine peptides. Chem. Biol. 12:923–929. doi: 10.1016/j.chembiol.2005.06.009.
  Tung, C.‐H. and Stein, S. 2000 Preparation and applications of peptide‐oligonucleotide conjugates. Bioconjugate Chem. 11:605–618. doi: 10.1021/bc0000334.
  Yin, H., Lu, Q., and Wood, M. 2008. Effective exon skipping and restoration of dystrophin expression by peptide nucleic acid antisense oligonucleotides in mdx mice. Mol. Ther. 16:38–45. doi: 10.1038/sj.mt.6300329.
  Zatsepin, T.S., Turner, J.J., Oretskaya, T.S., and Gait, M.J. 2005. Conjugates of oligonucleotides and analogues with cell penetrating peptides as gene silencing agents. Curr. Pharm. Des. 11:3639–3654. doi: 10.2174/138161205774580769.
  Zhi, D., Zhang, S., Wang, B., Zhao, Y., Yang, B., and Yu, S. 2010. Transfection efficiency of cationic lipids with different hydrophobic domains in gene delivery. Bioconjugate Chem. 21:563–577. doi: 10.1021/bc900393r.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library