Engineered Polymerases with Altered Substrate Specificity: Expression and Purification

Ali Nikoomanzar1, Matthew R. Dunn1, John C. Chaput1

1 Department of Pharmaceutical Sciences. University of California, Irvine, California
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 4.75
DOI:  10.1002/cpnc.33
Online Posting Date:  June, 2017
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Polymerase engineering is making it possible to synthesize xeno‐nucleic acid polymers (XNAs) with diverse backbone structures and chemical functionality. The ability to copy genetic information back and forth between DNA and XNA has led to a new field of science known as synthetic genetics, which aims to study the genetic concepts of heredity and evolution in artificial genetic polymers. Since many of the polymerases needed to synthesize XNA polymers are not available commercially, researchers must express and purify these enzymes as recombinant proteins from E. coli. This unit details the steps needed to express, purify, and evaluate the activity of engineered polymerases with altered substrate recognition properties. The protocol requires 6 days to complete and will produce ∼20 mg of pure, nuclease‐free polymerase per liter of E. coli bacterial culture. © 2017 by John Wiley & Sons, Inc.

Keywords: aptamer; polymerase; protein expression and purification; xeno‐nucleic acid (XNA)

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Strategic Planning
  • Basic Protocol 1: Polymerase Expression in E. coli
  • Basic Protocol 2: Polymerase Purification and Testing
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Polymerase Expression in E. coli

  Materials
  • 70% ethanol
  • 1.5% LB‐ampicillin (100 μg/mL) agar plate (see recipe)
  • 100 mg/mL ampicillin (see recipe)
  • Polymerase expressing E. coli cells (glycerol stock)
  • Luria‐Bertani (LB) medium (see recipe)
  • 1 M IPTG (see recipe)
  • Lysozyme (0.1 mg/mL), optional
  • Cell resuspension buffer (see recipe)
  • 10% (v/v) polyethyleneimine (PEI) (see recipe)
  • Ammonium sulfate powder (Sigma)
  • Bunsen burner
  • Inoculating loops
  • Permanent marker
  • 15º and 37ºC incubators (with and without shaking)
  • 500‐mL and 2‐L baffled flasks, sterile
  • Aluminum foil
  • UV cuvettes
  • UV spectrophotometer
  • Refrigerated centrifuge and rotors JLA 9.1 and JA 25.50 (Beckman)
  • 1‐L centrifuge jars
  • 10‐ and 50‐mL disposable pipets
  • 40‐mL centrifuge tubes
  • Sonicator
  • 80ºC water bath or hot plate

Basic Protocol 2: Polymerase Purification and Testing

  Materials
  • Nickel buffer A (see recipe)
  • Nickel buffer B (see recipe)
  • 20% ethanol
  • Recombinant polymerase protein pellet (see protocol 1)
  • 4× Nu‐PAGE loading buffer
  • Mini‐PROTEAN TGX Stain‐Free gel
  • 1× TGS running buffer (see recipe)
  • Unstained protein ladder (ThermoFisher)
  • Nickel elution diluton buffer (see recipe)
  • Heparin buffer A (see recipe)
  • Heparin buffer B (see recipe)
  • Nuclease‐free water
  • 10× ThermoPol buffer (NEB)
  • IR800 PBS8 primer (Integrated DNA Technologies): 5′‐/5IRD800//iSp18/GTCCCCTTGGGGATACCACC
  • L11 Library (Integrated DNA Technologies):
  • 5′–GGATCGTCAGTGCATTGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTGGTATCCCCAAGGGGAC – 3′ (N = A:T:C:G = 1:1:0.3:0.3)
  • 1 mM each tNTP mix (tATP, tTTP, tCTP, tGTP)
  • Polymerase dilution buffer (see recipe)
  • Polymerase
  • 10 mM MnCl 2 (see recipe)
  • Stop buffer (see recipe)
  • 20% Urea‐PAGE solution (see recipe)
  • 10% (w/v) ammonium persulfate (APS, see recipe)
  • N,N,N,N′,Tetraethylmethylenediamine (TEMED, Pierce)
  • Acrylamide concentrate (see recipe, also available from National Diagnostics)
  • Acrylamide diluent (see recipe, also available from National Diagnostics)
  • 10× TBE buffer (see recipe)
  • Absolute ethanol (Sigma)
  • 70% ethanol, −20°C
  • Manganese hexahydrate (Sigma)
  • 0.1 M NaOH
  • 5 mL HisTrap HP Resin (GE Healthcare)
  • 40‐mL centrifuge tubes
  • Refrigerated centrifuge
  • 50‐mL conical tubes
  • 5‐mL Nickel HP columns (GE)
  • FPLC system (AKTA)
  • Superloop (size varies)
  • Fraction collector (AKTA)
  • 1.5‐mL microcentrifuge tubes (Eppendorf)
  • 75º and 90ºC heating blocks
  • Electrophoresis apparatus (BioRad)
  • Power supply
  • Geldoc (BioRad)
  • 5‐mL Heparin HP resin columns (GE Healthcare)
  • Spectrophotometer (Nanodrop)
  • 200‐μL PCR tubes
  • Thermal cycler
  • Gel plates (19.7 × 16– and 19.7 × 18.5–cm)
  • Spacers (1.5‐mm thick)
  • Comb (20‐well)
  • 50‐mL beaker
  • Magnetic stir bar and stir plate
  • PAGE electrophoresis apparatus
  • 50‐mL plastic syringe
  • Vortex
  • Refrigerated microcentrifuge
  • LICOR Odyssey cLX imager
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Alves, F. B., Cozens, C., Holliger, P., & Destefano, J. J. (2015). Selection of 2′‐deoxy‐2′‐fluoroarabinonucleotide (FANA) aptamers that bind HIV‐1 reverse transcriptase with picomolar affinity. Nucleic Acids Research, 43, 9587–9599. doi: 10.1093/nar/gkv1057.
  Anosova, I., Kowal, E. A., Dunn, M. R., Chaput, J. C., Van Horn, W. D., & Egli, M. (2016). The structural diversity of artificial genetic polymers. Nucleic Acids Research, 44, 1007–1021. doi: 10.1093/nar/gkv1472.
  Chen, T. & Romesberg, F. E. (2014). Directed polymerase evolution. FEBS Lett, 588, 219–229. doi: 10.1016/j.febslet.2013.10.040.
  Culbertson, M. C., Temburnikar, K., Sau, S. P., Liao, J. Y., Bala, S., & Chaput, J. C. (2016). Evaluating TNA stability under simulated physiological conditions. Bioorganic & Medicinal Chemistry Letters, 26, 2418–2421. doi: 10.1016/j.bmcl.2016.03.118.
  Dunn, M. R., & Chaput, J. C. (2016). Reverse transcription of threose nucleic acid by a naturally occurring DNA polymerase. Chembiochem, 17, 1804–1808. doi: 10.1002/cbic.201600338.
  Ellefson, J. W., Gollihar, J., Shroff, R., Shivram, H., Iyer, V. R., & Ellington, A. D. (2016). Synthetic evolutionary origin of a proofreading reverse transcriptase. Science, 352, 390–393. doi: 10.1126/science.aaf5409.
  Ghadessy, F. J., Ong, J. L., & Holliger, P. (2001). Directed evolution of polymerase function by compartmentalized self‐replication. Proceedings of the National Academy of Sciences of the United States of America, 10, 4552–4557. doi: 10.1073/pnas.071052198.
  Gopal, G. J., & Kumar, A. (2013). Strategies for the production of recombinant protein in Escherichia coli. The Protein Journal, 32, 419–425. doi:10.1007/s10930‐013‐9502‐5.
  Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S., & Hirao, I. (2013). Generation of high‐affinity DNA aptamers using an expanded genetic alphabet. Nature Biotechnology, 31, 453–457. doi: 10.1038/nbt.2556.
  Larsen, A. C., Dunn, M. R., Hatch, A., Sujay, S. P., Youngbull, C., & Chaput, J. C. (2016). A general strategy for expanding polymerase function by droplet microfluidics. Nature Communications, 7, 11235. doi: 10.1038/ncomms11235.
  Pinheiro, V. B., Arangundy‐Franklin, S., & Holliger, P. (2014). Compartmentalized self‐tagging for in vitro‐directed evolution of XNA polymerases. Current Protocols in Nucleic Acid Chemistry, 57, 9.9.1–18. doi: 10.1002/0471142700.nc0909s57.
  Pinheiro, V. B., Taylor, A. I., Cozens, C., Abramov, M., Renders, M., Zhang, S., … Holliger, P. (2012). Synthetic genetic polymers capable of heredity and evolution. Science, 336, 341–344. doi: 10.1126/science.
  Taylor, A. I., Beuron, F., Peak‐Chew, S. Y., Morris, E. P., Herdewijn, P., & Holliger, P. (2016). Nanostructures from synthetic genetic polymers. Chembiochem, 17, 1107–1110. doi: 10.1002/cbic.201600136.
  Tingjian, C., Narupat, H., Zhixia, L., Ramkrishna, A., Shujian, S. T., & Romesberg, F. E. (2016). Evolution of thermophilic DNA polymerases for the recognition and amplification of C2′‐modified DNA. Nature Chemical, 8, 556–562. doi: 10.1038/nchem.2493.
  Yu, H., Zhang S., & Chaput, J. C. (2012) Darwinian evolution of an alternative genetic system provides support for TNA as an RNA progenitor. Nature Chemical, 4, 183–187. doi: 10.1038/nchem.1241.
  Zhang, S., McCullum, E., & Chaput, J. C. (2008). Synthesis of two mirror image 4‐helix junctions derived from glycerol nucleic acid. Journal of the American Chemical Society, 130, 5846–5847. doi: 10.1021/ja800079j.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library