Determining Functional Aptamer‐Protein Interaction by Biolayer Interferometry

Xinhui Lou1, Martin Egli2, Xianbin Yang3

1 Department of Chemistry, Capital Normal University, Beijing, 2 Department of Biochemistry, Vanderbilt University, Nashville, Tennessee, 3 AM Biotechnologies, Houston, Texas
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 7.25
DOI:  10.1002/cpnc.18
Online Posting Date:  December, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Short single‐stranded nucleic acids called aptamers are widely being explored as recognition molecules of high affinity and specificity for binding a wide range of target molecules, particularly protein targets. In biolayer interferometry (BLI), a simple Dip‐and‐Read approach in which the aptamer‐coated biosensors are dipped into microplate wells is used to study the interactions between an aptamer and its target protein. Here we describe the protocol for the analysis of the interaction between a well‐characterized anti‐thrombin RNA aptamer with thrombin (Basic Protocol). We also report on the protocol for the affinity screening of a panel of anti‐thrombin RNA aptamers with a single phosphorodithioate (PS2) modification, whereby the position of the modification along the RNA backbone is varied systematically (Support Protocol). The PS2 modification uses two sulfur atoms to replace two non‐bridging oxygen atoms at an internucleotide phosphodiester backbone linkage. The PS2‐modified RNAs are nuclease resistant and several in vitro and in vivo assays have demonstrated their biological activity. For example, combining the PS2 with the 2′‐OMe modification affords increased loading of modified small interfering RNA (siRNA) duplexes into the RNA‐induced silencing complex (RISC) as well as enhanced gene‐silencing antitumor activity. © 2016 by John Wiley & Sons, Inc.

Keywords: aptamer; nucleic acid‐protein interactions; phosphorodithioate; biolayer interferometry; affinity

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Analysis of Functional Aptamer‐Protein Interactions
  • Support Protocol 1: Affinity Screening of a Large Number of Modified Aptamers
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Analysis of Functional Aptamer‐Protein Interactions

  Materials
  • Water, molecular biology grade (DNase, RNase, and Protease are not detectable; Phenix Research Products, cat. no. W‐8001‐1000)
  • 1× assay buffer (20 mM HEPES‐KOH, 125 mM NaCl, 2 mM CaCl 2, and 0.05% Tween 20, pH 7.4)
  • 10× PBS (Sigma‐Aldrich, cat. no. P5493‐1 liter)
  • Streptavidin (SA) Dip and Read biosensors (FortéBIO, a division of Pall Life Sciences, cat. no. 18‐5020)
  • Thrombin (Haematologic Technologies, cat. no. HCT‐BFPRCK)
  • Anti‐thrombin aptamer sequence: 5′‐biotinTEG‐GGGAACAAAGCUGAAGUACUUACCC‐3′ (all U and C are 2′‐F‐modified nucleosides, synthesized at AM Biotechnologies)
  • 96‐well black microtiter plate (only the black plate is suitable;
  • Greiner Bio One, cat. no. 655209)
  • Disposable reagent reservoirs (Vistalab Technologies, cat. no. 3054‐1002)
  • 50 to 300 μL BioPette Plus Autoclavable Multichannel pipets, 8 channels (Labnet, manufacturer number P4808‐300 and P4808‐10)
  • Octet RED96 system with Data Acquisition and Analysis software (see Fig.  ; FortéBIO, a division of Pall Life Sciences)

Support Protocol 1: Affinity Screening of a Large Number of Modified Aptamers

  Additional Materials (also see protocol 1Basic Protocol)
  • 20 PS2‐anti‐thrombin aptamers (shown in Table 7.25.3; synthesized and characterized at AM Biotechnologies)
Table 7.5.3   Additional Materials (also see protocol 1Basic Protocol)Anti‐Thrombin Aptamer Sequences with PS2 Modification Positions

Number PS2‐modified aptamer sequences with 5′‐BiotinTEG
1 5′‐GGGAACAAAGCUGAAGUACUUACCC‐3′
2 5′‐G PS2GGAACAAAGCUGAAGUACUUACCCT‐3′
3 5′‐GG PS2GAACAAAGCUGAAGUACUUACCCT‐3′
4 5′‐GGG PS2AACAAAGCUGAAGUACUUACCCT‐3′
5 5′‐GGGA PS2ACAAAGCUGAAGUACUUACCCT‐3′
6 5′‐GGGAA PS2CAAAGCUGAAGUACUUACCCT‐3′
7 5′‐GGGAAC PS2AAAGCUGAAGUACUUACCCT‐3′
8 5′‐GGGAACA PS2AAGCUGAAGUACUUACCCT‐3′
9 5′‐GGGAACAA PS2AGCUGAAGUACUUACCCT‐3′
10 5′‐GGGAACAAA PS2GCUGAAGUACUUACCCT‐3′
11 5′‐GGGAACAAAG PS2CUGAAGUACUUACCCT‐3′
12 5′‐GGGAACAAAGC PS2UGAAGUACUUACCCT‐3′
13 5′‐GGGAACAAAGCU PS2GAAGUACUUACCCT‐3′
14 5′‐GGGAACAAAGCUG PS2AAGUACUUACCCT‐3′
15 5′‐GGGAACAAAGCUGA PS2AGUACUUACCCT‐3′
16 5′‐GGGAACAAAGCUGAA PS2GUACUUACCCT‐3′
17 5′‐GGGAACAAAGCUGAAG PS2UACUUACCCT‐3′
18 5′‐GGGAACAAAGCUGAAGU PS2ACUUACCCT‐3′
19 5′‐GGGAACAAAGCUGAAGUA PS2CUUACCCT‐3′
20 5′‐GGGAACAAAGCUGAAGUAC PS2UUACCCT‐3′

GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
   Abeydeera, N.D., Egli, M., Cox, N., Mercier, K., Conde, J.N., Pallan, P.S., Mizurini, D.M., Sierant, M., Hibti, F.E., Hassell, T., Wang, T., Liu, F.W., Liu, H.M., Martinez, C., Sood, A.K., Lybrand, T.P., Frydman, C., Monteiro, R.Q., Gomer, R.H., Nawrot, B., and Yang, X. 2016. Evoking picomolar binding in RNA by a single phosphorodithioate linkage. Nucleic Acids Res. 44:8052‐8064. doi: 10.1093/nar/gkw725.
  Ceglarek, J.A. and Revzin, A. 1989. Studies of DNA‐protein interactions by gel electrophoresis. Electrophoresis 10:360‐365. doi: 10.1002/elps.1150100514.
  Concepcion, J., Witte, K., Wartchow, C., Choo, S., Yao, D., Persson, H., Wei, J., Li, P., Heidecker, B., Ma, W., Varma, R., Zhao, L.S., Perillat, D., Carricato, G., Recknor, M., Du, K., Ho, H., Ellis, T., Gamez, J., Howes, M., Phi‐Wilson, J., Lockard, S., Zuk, R., and Tan, H. 2009. Label‐free detection of biomolecular interactions using BioLayer interferometry for kinetic characterization. Comb. Chem. High Throughput Screen 12:791‐800. doi: 10.2174/138620709789104915.
  Cooper, M.A. and Whalen, C. 2005. Profiling molecular interactions using label‐free acoustic screening. Drug Discov. Today Technol. 2:241‐245. doi: 10.1016/j.ddtec.2005.08.014.
  Draper, D.E. 1999. Themes in RNA‐protein recognition. J. Mol. Biol. 293:255‐270. doi: 10.1006/jmbi.1999.2991.
  Ellington, A.D. and Szostak, J.W. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346:818‐822. doi: 10.1038/346818a0.
  Fried, M.G. 1989. Measurement of protein‐DNA interaction parameters by electrophoresis mobility shift assay. Electrophoresis 10:366‐376. doi: 10.1002/elps.1150100515.
  Godber, B., Thompson, K.S., Rehak, M., Uludag, Y., Kelling, S., Sleptsov, A., Frogley, M., Wiehler, K., Whalen, C., and Cooper, M.A. 2005. Direct quantification of analyte concentration by resonant acoustic profiling. Clin. Chem. 51:1962‐1972. doi: 10.1373/clinchem.2005.053249.
  Gosai, S.J., Foley, S.W., Wang, D., Silverman, I.M., Selamoglu, N., Nelson, A.D., Beilstein, M.A., Daldal, F., Deal, R.B., and Gregory, B.D. 2015. Global analysis of the RNA‐protein interaction and RNA secondary structure landscapes of the Arabidopsis nucleus. Mol. Cell 57:376‐388. doi: 10.1016/j.molcel.2014.12.004.
  Guille, M.J. and Kneale, G.G. 1997. Methods for the analysis of DNA‐protein interactions. Mol. Biotechnol. 8:35‐52. doi: 10.1007/BF02762338.
  Jankowsky, E. and Harris, M.E. 2015. Specificity and nonspecificity in RNA‐protein interactions. Nat. Rev. Mol. Cell. Biol. 16:533‐544. doi: 10.1038/nrm4032.
  Keefe, A.D., Pai, S., and Ellington, A. 2010. Aptamers as therapeutics. Nat. Rev. 9:537‐550. doi: 10.1038/nrd3141.
  Long, S.B., Long, M.B., White, R.R., and Sullenger, B.A. 2008. Crystal structure of an RNA aptamer bound to thrombin. RNA 14:2504‐2512. doi: 10.1261/rna.1239308.
  Marshall, W.S. and Caruthers, M.H. 1993. Phosphorodithioate DNA as a potential therapeutic drug. Science 259:1564‐1570. doi: 10.1126/science.7681216.
  McDonnell, J.M. 2001. Surface plasmon resonance: Towards an understanding of the mechanisms of biological molecular recognition. Curr. Opin. Chem. Biol. 5:572‐577. doi: 10.1016/S1367‐5931(00)00251‐9.
  Murphy, K., Shimamura, T., and Bejcek, B.E. 2001. Use of fluorescently labeled DNA and a scanner for electrophoretic mobility shift assays. BioTechniques 30:504‐506, 508.
  Osborne, S.E. and Ellington, A.D. 1997. Nucleic acid selection and the challenge of combinatorial chemistry. Chem. Rev. 97:349‐370. doi: 10.1021/cr960009c.
  Pallan, P., Yang, X., Sierant, M., Abeydeera, N., Hassell, T., Martinez, C., Janicka, M., Nawrot, B., and Egli, M. 2014. Crystal structure, stability and Ago2 affinity of phosphorodithioate‐modified RNAs. RSC Adv. 4:64901‐64904. doi: 10.1039/C4RA10986D.
  Tonkinson, J.L., Guvakova, M., Khaled, Z., Lee, J., Yakubov, L., Marshall, W.S., Caruthers, M.H., and Stein, C.A. 1994. Cellular pharmacology and protein binding of phosphoromonothioate and phosphorodithioate oligodeoxynucleotides: A comparative study. Antisense Res. Dev. 4:269‐278. doi: 10.1089/ard.1994.4.269.
  Tuerk, C. and Gold, L. 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505‐510. doi: 10.1126/science.2200121.
  Varani, G. 1997. RNA‐protein intermolecular recognition. Acc. Chem. Res. 30:189‐195. doi: 10.1021/ar960035x.
  Volk, D.E., Yang, X., Fennewald, S.M., King, D.J., Bassett, S.E., Venkitachalam, S., Herzog, N., Luxon, B.A., and Gorenstein, D.G. 2002. Solution structure and design of dithiophosphate backbone aptamers targeting transcription factor NF‐κB. Bioorg. Chem. 30:396‐419. doi: 10.1016/S0045‐2068(02)00510‐2.
  White, R., Rusconi, C., Scardino, E., Wolberg, A., Lawson, J., Hoffman, M., and Sullenger, B. 2001. Generation of species cross‐reactive aptamers using “toggle” SELEX. Mol. Ther. 4:567‐573. doi: 10.1006/mthe.2001.0495.
  Woodbury, C.P., Jr. and von Hippel, P.H. 1983. On the determination of deoxyribonucleic acid‐protein interaction parameters using the nitrocellulose filter‐binding assay. Biochemistry 22:4730‐4737. doi: 10.1021/bi00289a018.
  Wu, S.Y., Yang, X., Gharpure, K.M., Hatakeyama, H., Egli, M., McGuire, M.H., Nagaraja, A.S., Miyake, T.M., Rupaimoole, R., Pecot, C.V., Taylor, M., Pradeep, S., Sierant, M., Rodriguez‐Aguayo, C., Choi, H.J., Previs, R.A., Armaiz‐Pena, G.N., Huang, L., Martinez, C., Hassell, T., Ivan, C., Sehgal, V., Singhania, R., Han, H.D., Su, C., Kim, J.H., Dalton, H.J., Kovvali, C., Keyomarsi, K., McMillan, N.A., Overwijk, W.W., Liu, J., Lee, J.S., Baggerly, K.A., Lopez‐Berestein, G., Ram, P.T., Nawrot, B., and Sood, A.K. 2014. 2′‐OMe‐phosphorodithioate‐modified siRNAs show increased loading into the RISC complex and enhanced anti‐tumour activity. Nat. Commun. 5:3459. doi: 10.1038/ncomms4459.
  Yang, X. and Mierzejewski, E. 2010. Synthesis of nucleoside and oligonucleoside dithiophosphates. New J. Chem. 34:805‐819. doi: 10.1039/b9nj00618d.
  Yang, X., Fennewald, S., Luxon, B.A., Aronson, J., Herzog, N.K., and Gorenstein, D.G. 1999. Aptamers containing thymidine 3′‐O‐phosphorodithioates: Synthesis and binding to nuclear factor‐κB. Bioorg. Med. Chem. Lett. 9:3357‐3362. doi: 10.1016/S0960‐894X(99)00600‐9.
  Yang, X., Li, N., and Gorenstein, D.G. 2011. Strategies for the discovery of therapeutic aptamers. Expert Opin. Drug Discov. 6:75‐87. doi: 10.1517/17460441.2011.537321.
  Yang, X., Sierant, M., Janicka, M., Peczek, L., Martinez, C., Hassell, T., Li, N., Li, X., Wang, T., and Nawrot, B. 2012. Gene silencing activity of siRNA molecules containing phosphorodithioate substitutions. ACS Chem. Biol. 7:1214‐1220. doi: 10.1021/cb300078e.
  Zandarashvili, L., Nguyen, D., Anderson, K.M., White, M.A., Gorenstein, D.G., and Iwahara, J. 2015. Entropic enhancement of protein‐DNA affinity by oxygen‐to‐sulfur substitution in DNA phosphate. Biophys. J. 109:1026‐1037. doi: 10.1016/j.bpj.2015.07.032.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library