An In Vitro Selection Protocol for Threose Nucleic Acid (TNA) Using DNA Display

Matthew R. Dunn1, John C. Chaput1

1 The Biodesign Institute at Arizona State University, Tempe, Arizona
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 9.8
DOI:  10.1002/0471142700.nc0908s57
Online Posting Date:  June, 2014
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Threose nucleic acid (TNA) is an unnatural genetic polymer composed of repeating threofuranosyl sugars linked by 2′ and 3′ phosphodiester bonds. TNA is capable of forming antiparallel Watson‐Crick duplex structures in a self‐pairing mode, and can also cross‐pair opposite complementary strands of DNA and RNA. The solution NMR structure of a self‐complementary TNA duplex reveals that TNA adopts an A‐form helical structure, which explains its ability to exchange genetic information with natural genetic polymers. In a recent advance, a TNA aptamer was evolved from a pool of random sequences using an engineered polymerase that can copy DNA sequences into TNA. This unit details the steps required to evolve functional TNA molecules in the laboratory using a method called DNA display. Using this approach, TNA molecules are physically linked to their encoding double‐stranded DNA template. By linking TNA phenotype with DNA genotype, one can select for TNA molecules with a desired function and recover their encoding genetic information by PCR amplification. Each round of selection requires ∼3 days to complete and multiple rounds of selection and amplification are required to generate functional TNA molecules. Curr. Protoc. Nucleic Acid Chem. 57:9.8.1‐9.8.19. © 2014 by John Wiley & Sons, Inc.

Keywords: threose nucleic acid (TNA); oligonucleotide; in vitro selection; DNA display; aptamer

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: Generation of the DNA Hairpin Library
  • Basic Protocol 2: Purification of the DNA Hairpin Library
  • Basic Protocol 3: Generation of the TNA Library Using DNA Display
  • Basic Protocol 4: Selection of an Anti‐Thrombin TNA Aptamer by Capillary Electrophoresis
  • Basic Protocol 5: Generation of Enriched DNA Pool
  • Basic Protocol 6: Generation of Single‐Stranded Hairpin Templates for a New Selection Round
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Generation of the DNA Hairpin Library

  Materials
  • DNA hairpin: 5′/Phos/actacgtacccacaacctcggccgtaccacggtacgtagtgacactcgtatgcagtagcc 3′
  • 10× T4 DNA ligase buffer
  • Library: 5′ TGTCTACACGCAAGCTTACA‐N 50‐GGCTACTGCATACGAGTGTC 3′
  • 100,000 U/μL T4 DNA ligase (NEB)
  • 1.5‐mL microcentrifuge tube (Eppendorf)
  • 16° and 90°C heating blocks

Basic Protocol 2: Purification of the DNA Hairpin Library

  Materials
  • Acrylamide concentrate (see recipe, also available from National Diagnostics)
  • Acrylamide diluent (see recipe, also available from National Diagnostics)
  • 10× TBE buffer (see recipe)
  • 10% (w/v) ammonium persulfate (APS, EMD Biosciences)
  • N,N,N,N′,tetraethylmethylenediamine (TEMED, Pierce)
  • Hairpin template reaction product (see protocol 1)
  • Urea (Sigma)
  • PAGE running dye (see recipe)
  • 3 M sodium acetate, pH 5.2 (NaOAc, Sigma)
  • Absolute ethanol (Sigma)
  • 70% ethanol, −20°C
  • Gel plates (19.7 × 16– and 19.7 × 18.5–cm)
  • Spacers (1.5‐mm thick)
  • Comb (2‐well with two marker lanes)
  • 100‐mL beaker
  • Magnetic stir bar and stir plate
  • PAGE electrophoresis apparatus
  • 50‐mL plastic syringe
  • Power supply
  • 90°C heating block
  • Plastic transfer pipets (pulled capillary)
  • Spatula
  • Plastic wrap
  • UV‐active thin‐layer chromatography (TLC) plate
  • Handheld UV lamp (254‐nm)
  • Black permanent marker
  • Razor blade or scalpel
  • Electroelution apparatus and cassettes
  • Electroelution membranes
  • 1.5‐mL microcentrifuge tubes (Eppendorf)
  • Vortex
  • Refrigerated microcentrifuge
  • Spectrophotometer

Basic Protocol 3: Generation of the TNA Library Using DNA Display

  Materials
  • 10× Thermopol buffer (NEB)
  • DNA hairpin library
  • 10 mM MnCl 2 (Sigma)
  • 2 U/μL Therminator DNA polymerase (NEB)
  • 200 μM (each) tNTPs
  • 25:24:1 (v/v/v) phenol/chloroform/isoamyl alcohol saturated with 10 mM Tris·Cl, pH 8.0 and 1 mM EDTA
  • 100 μM strand displacement DNA primer: 5′FAM‐AAG GCT ACT GCA TAC GAG TGT CAC TAC GTA CCG TGG TAC GGC CGA GGT TG 3′
  • 5 mM (each) dNTPs
  • 1.5‐mL microcentrifuge tubes (Eppendorf)
  • Thermal cycler
  • PCR tubes
  • Vortexer
  • Microcentrifuge
  • NAP‐5 columns (GE Healthcare)
  • Lyophilizer
  • Spectrophotometer

Basic Protocol 4: Selection of an Anti‐Thrombin TNA Aptamer by Capillary Electrophoresis

  Materials
  • TNA‐DNA fusion molecules (see protocol 3)
  • 10 μM human α‐thrombin (Hematologic Technologies Inc.)
  • 10× thrombin selection buffer (see recipe)
  • 1% polyvinylpyrrolidine (PVP, Sigma)
  • 200‐μL PCR tubes (Eppendorf)
  • 2‐mL Glass vials (Beckman Coulter)
  • Glass capillary (0.1‐mm i.d.; 60‐cm total length)
  • Heating loop
  • Beckman ProteomeLab PA 800 protein characterization system (or another suitable system with appropriate fluorescence equipment; excitation, 488 nm; emission, 520 nm)

Basic Protocol 5: Generation of Enriched DNA Pool

  Materials
  • 10× Thermopol buffer
  • 5 mM (each) dNTPs
  • Biotinylated regeneration primer: 5′/5Biosg/GGCTACTGCATACGAGTGTCACTACGTACCGTGGTACGGCCGAGGTTGTG 3′
  • PBS1: 5′ TGTCTACACGCAAGCTTACA 3′
  • Recovered selection output
  • 2 U/μL Taq DNA polymerase
  • 6× agarose loading dye
  • Ultrapure agarose powder
  • 0.5× TBE buffer (see recipe)
  • 10 mg/mL ethidium bromide
  • 100‐bp DNA ladder
  • PCR purification kit (Qiagen)
  • 200‐μL PCR tubes
  • Thermal cycler
  • 500‐mL flask
  • Gel casting tray and comb
  • Agarose gel electrophoresis apparatus
  • Power supply
  • UV imaging source
  • Spectrophotometer

Basic Protocol 6: Generation of Single‐Stranded Hairpin Templates for a New Selection Round

  Materials
  • Biotinylated DNA (see protocol 5)
  • Streptavidin‐agarose resin (Pierce)
  • Streptavidin binding buffer (see recipe)
  • 100 mM NaOH
  • 100 mM HCl
  • 3 M sodium acetate, pH 5.2 (NaOAc, Sigma)
  • 5 mg/mL glycogen (Pierce)
  • Absolute ethanol (Sigma)
  • 70% ethanol, −20°C
  • Small chromatography column (BioRad)
  • Rotator
  • 1.5‐mL microcentrifuge tubes (Eppendorf)
  • Vortexer
  • Refrigerated microcentrifuge
  • Spectrophotometer
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Bradley, H., Micheletti, J.M., Satya, P., Ogle, K., Pollard, J., and Ellington, A.D. 2000. Design, synthesis, and amplification of DNA pools for in vitro selection. Curr. Protoc. Nucleic Acid Chem. 39:9.2.1‐9.2.28.
  Ebert, M.‐O., Mang, C., Krishnamurthy, R., Eschenmoser, A., and Jaun, B. 2008. Structure of TNA‐TNA complex in solution: NMR study of the octamer duplex derived from α‐(L)‐threofuranosyl‐(3′–2′)‐CGAATTCG. J. Am. Chem. Soc. 130:15105‐15115.
  Engelhart, A.E. and Hud, N.V. 2010. Primitive genetic polymers. Cold Spring Harb. Perspect. Biol. 2:1‐21.
  Gold, L., Polisky, B., Uhlenbeck, O., and Yarus, M. 1995. Diversity of oligonucleotide functions. Annu. Rev. Biochem. 64:763‐797.
  Ichida, J.K., Zou, K., Horhota, A., Yu, B., McLaughlin, L.W., and Szostak, J.W. 2005a. An in vitro selection system for TNA. J. Am. Chem. Soc. 127:2802‐2803.
  Ichida, J.K., Horhota, A., Zou, K., McLaughlin, L.W., and Szostak, J.W. 2005b. High fidelity TNA synthesis by Therminator polymerase. Nucleic Acids Res. 33:5219‐5225.
  Joyce, G.F. 1994. In vitro evolution of nucleic acids. Curr. Opin. Struct. Biol. 4:331‐336.
  Joyce, G.F. 2012. Bit by bit: The Darwinian basis of life. PLoS Biol. 10:e1001323.
  Mendonsa, S.D. and Bowser, M.T. 2004. In vitro evolution of functional DNA using capillary electrophoresis. J. Am. Chem. Soc. 126:20‐21.
  Ni, X., Castanares, M., Mukherjee, A., and Lupold, S.E. 2012. Nucleic acid aptamers: Clinical applications and promising new horizons. Curr. Med. Chem. 18:4206‐4214.
  Pallan, P.S., Wilds, C.J., Wawrzak, Z., Krishnamurthy, R., Eschenmoser, A., and Egli, M. 2003. Why does TNA cross‐pair more strongly with RNA than with DNA? An answer from X‐ray analysis. Angew. Chemie. 42:5893‐5895.
  Pinheiro, V.B., Taylor, A.I., Cozens, C., Abramov, M., Renders, M., Zhang, S., Chaput, J.C., Wengel, J., Peak‐Chew, S.‐Y., McLaughlin, S.H., Herdewijn, P., and Holliger, P. 2012. Synthetic genetic polymers capable of heredity and evolution. Science 16:245‐252.
  Sambrook, J. and Russell, D.W. 2001. Isolation of DNA fragments from polyacrylamide gels by the crush and soak method. In Molecular Cloning. (N. Irwin and K.A. Janssen, eds.) pp. 551‐554. Cold Spring Harbor Laboratory Press. Cold Spring Harbor, New York.
  Schöning, K.‐U., Scholz, P., Guntha, S., Wu, X., Krishnamurthy, R., and Eschenmoser, A. 2000. Chemical etiology of nucleic acid structure: The α‐threofuranosyl‐(3′→2′) oligonucleotide system. Science 290:1347‐1351.
  Schöning, K.U., Scholz, P., Wu, X., Guntha, S., Delgado, G., Krishnamurthy, R., and Eschenmoser, A. 2002. The α‐L‐threofuranosyl‐(3′‐>2′)‐oligonucleotide system (′TNA'): Synthesis and pairing properties. Helv. Chim. Acta. 85:4111‐4153.
  Yu, H., Zhang, S., and Chaput, J.C. 2012. Darwinian evolution of an alternative genetic system provides support for TNA as an RNA progenitor. Nat. Chem. 4:183‐187.
  Yu, H., Zhang, S., Dunn, M.R., and Chaput, J.C. 2013. An efficient and faithful in vitro replication system for threose nucleic acid. J. Am. Chem. Soc. 135:3583‐3591.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library