Selection of Natural and Base‐Modified DNA Aptamers for a Camptothecin Derivative

Hiroto Fujita1, Masayasu Kuwahara1

1 Graduate School of Science and Technology, Gunma University, Kiryu, Gunma
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 9.10
DOI:  10.1002/cpnc.5
Online Posting Date:  June, 2016
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

Nucleic acid aptamers for small molecules are currently being developed and have a potential role in diverse applications including biosensing, diagnostics, and therapeutics involving low‐molecular‐weight biomarkers and drugs. To enhance and broaden their functions through chemical modification, systematic evolution of ligands by exponential enrichment (SELEX) selection has been attempted with modified DNA/RNA libraries. Recently, we demonstrated the superior efficacy of base modification for affinity enhancement and the usefulness of unnatural nucleic acid libraries for development of small‐molecule aptamers. In this unit, we describe construction of a modified DNA library that includes (E)‐5‐(2‐(N‐(2‐(N6‐adeninyl)ethyl))carbamylvinyl)uracil bases and acquisition of high‐affinity camptothecin‐binding DNA aptamers, in addition to those of the corresponding natural DNA library and aptamers, using the SELEX method. © 2016 by John Wiley & Sons, Inc.

Keywords: selex; nucleic acid aptamers; modified DNA; small molecules

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Introduction
  • Basic Protocol 1: SELEX Experiments: Initial DNA Pools for Libraries A and B
  • Basic Protocol 2: SELEX Experiments: Aptamer Selection
  • Basic Protocol 3: SELEX Experiments: Isolation and Sequencing of Selected Aptamers
  • Support Protocol 1: SELEX Experiments: Preparation of Affinity Gels
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: SELEX Experiments: Initial DNA Pools for Libraries A and B

  Materials
  • T_Af: 5′‐6‐FAM‐GGTCAGCACGCTCCGGACTT‐N 30‐GTGTCGCTGAGCCTGCCAAC‐3′ (Japan Bio Services; also see text above step 1)
  • 4 μM T_B: 5′‐ACACGGCTAGCACGGCGAAG‐N 30‐TGTCTGGCGTGCCTCTGGTG‐3′ (Japan Bio Services)
  • 20 μM P_B1f: 5′‐6‐FAM‐CACCAGAGGCACGCCAGACA‐3′ (Japan Bio Services)
  • 2 mM dNTP mix‐1: 2 mM dATP, dGTP, and dCTP (Roche)
  • 2 mM dUadTP (Fig. )
  • KOD Dash polymerase (Toyobo)
  • 10× KOD Dash polymerase reaction buffer (Toyobo)
  • Bromphenol blue (BPB) solution (see recipe)
  • Solution for 10% denaturing PAGE EDTA (see recipe; also see unit 10.4; Albright and Slatko, )
  • Solution for 10% denaturing PAGE (see recipe; also see unit 10.4; Albright and Slatko, )
  • 3 M sodium acetate (NaOAc)
  • Ethanol (EtOH; Wako)
  • 20 mM Tris buffer, pH 7.4 (see recipe for 500 mM Tris stock)
  • Tris‐borate (TB) buffer (see recipe)
  • 0.5‐ and 1.5‐mL PCR tubes (Eppendorf)
  • PCR thermal cycler (Techne)
  • Vacuum concentrator (Eyela)
  • Molecular Imager FX pro (Bio‐Rad laboratories
  • GeBAflex tube (MWCO 6 to 8 kDa; 500 μL; Scienova)
  • Millipore filter; 0.40 μm (Merck Millipore)
  • Vivaspin 500 ultrafiltration device (Sartorius)
  • Lyophilizer (Eyela)
  • Cooled microcentrifuge (Eppendorf)
  • Additional reagents and equipment for PCR (Kramer and Coen, ) and denaturing PAGE (unit 10.4; Albright and Slatko, )

Basic Protocol 2: SELEX Experiments: Aptamer Selection

  Materials
  • Affinity columns containing negative and positive selection gels ( protocol 4Support Protocol) connected in series
  • Library A ( protocol 1)
  • Library B ( protocol 1)
  • Buffers B1, B2, B3, and B4 (see reciperecieps)
  • 4 μM P_A1f: 5′‐6‐FAM‐GGTCAGCACGCTCCGGACTT‐3′ (Japan Bio Services)
  • 4 μM P_A2p: 5′‐phosphate‐GTTGGCAGGCTCAGCGACAC‐3′ (Japan Bio Services)
  • 4 μM P_B1p: 5′‐phosphate‐CACCAGAGGCACGCCAGACA‐3′ (Japan Bio Services)
  • 4 μM P_B1f: 5′‐6‐FAM ‐CACCAGAGGCACGCCAGACA‐3′ (Japan Bio Services)
  • 4 μM P_B2h: 5′‐HEX‐ACACGGCTAGCACGGCGAAG‐3′ (Japan Bio Services)
  • 2 mM dNTP mix‐1: 2 mM dATP, dGTP, and dCTP (Roche)
  • 2 mM dNTP mix‐2: 2 mM dATP, dGTP, dCTP, and TTP (Roche)
  • 2 mM dUadTP (Fig. )
  • KOD Dash polymerase (Toyobo)
  • 10× KOD Dash polymerase reaction buffer (Toyobo)
  • 3 M sodium acetate (NaOAc)
  • Ethanol (Wako)
  • 10 U/μL λ‐exonuclease (Wako)
  • 10× λ‐exonuclease reaction buffer (Wako)
  • Solution for 10% denaturing PAGE (see recipe; also see unit 10.4; Albright and Slatko, )
  • Shimazu HPLC system (also see unit 10.5; Sinha and Jun, )
  • 0.5‐ and 1.5 mL PCR tubes (Eppendorf)
  • PCR thermal cycler (Techne)
  • Vacuum concentrator (Eyela)
  • Cooled microcentrifuge (Eppendorf)
  • Additional reagents and equipment for HPLC (unit 10.5; Sinha and Jun, ), PCR (Kramer and Coen, ), and denaturing PAGE (unit 10.4; Albright and Slatko, )

Basic Protocol 3: SELEX Experiments: Isolation and Sequencing of Selected Aptamers

  Materials
  • Enriched pools solution ( protocol 2)
  • 4 μM P_A1: 5′‐GGTCAGCACGCTCCGGACTT‐3′ (Japan Bio Services)
  • 4 μM P_A2: 5′‐GTTGGCAGGCTCAGCGACAC‐3′ (Japan Bio Services)
  • 4 μM P_B1: 5′‐CACCAGAGGCACGCCAGACA‐3′ (Japan Bio Services)
  • 4 μM P_B2: 5′‐ACACGGCTAGCACGGCGAAG‐3′ (Japan Bio Services)
  • 2 mM dNTP mix‐2 (dATP, dGTP, dCTP, TTP; Toyobo)
  • KOD Dash polymerase (Toyobo)
  • 10× KOD Dash polymerase reaction buffer (Toyobo)
  • Bromphenol blue (BPB) solution (see recipe)
  • Solution for 10% denaturing PAGE EDTA (see recipe; also see unit 10.4; Albright and Slatko, )
  • SYBR Gold gel stain solution
  • Platinum Taq DNA polymerase (Invitrogen)
  • 10× Platinum Taq DNA polymerase buffer (Invitrogen)
  • pT7Blue T‐Vector (Novagen)
  • DNA Ligation Kit ver.1 (Takara) including:
    • Solution A
    • Solution B (T4 DNA ligase)
  • Competent high DH5α E. coli (Toyobo)
  • SOC medium (Toyobo)
  • 20 mg/mL Xgal (see recipe)
  • 2% (w/v) LB agar plate with 50 μg/mL ampicillin (see recipe)
  • PCR premix (see recipe)
  • 2× dye loading buffer (see recipe)
  • 2% (w/v) agarose gel (see recipe; also see Voytas, )
  • TBE buffer containing 3 mM EDTA (see recipe)
  • Ethidium bromide (EtBr) gel stain solution (see recipe)
  • 2% (w/v) LB medium with 50 μg/mL ampicillin (see recipe)
  • Plasmid Miniprep Kit (Cosmo Genetech) including:
    • Buffer S1 (for resuspending cells)
    • Buffer S2 (for bacteriolysis)
    • Buffer S3
    • Buffer PW
    • Buffer EB
    • RNase A solution
    • Spin columns
    • Collection tubes
  • 0.5‐ and 1.5‐mL PCR tubes (Eppendorf)
  • PCR thermal cycler (Techne)
  • 16°C water bath
  • 15‐mL centrifuge tubes (Orange Scientific)
  • Refrigerated centrifuge (Kubota)
  • Cooled microcentrifuge (Eppendorf)
  • UV spectrophotometer (Thermo Fisher Scientific)
  • Ethidium bromide (EtBr) gel stain solution
  • Molecular Imager FX pro (Bio‐Rad laboratories)
  • Additional reagents and equipment for PCR (Kramer and Coen, ), denaturing PAGE (unit 10.4; Albright and Slatko, ), and agarose gel electrophoresis (Voytas, )

Support Protocol 1: SELEX Experiments: Preparation of Affinity Gels

  Materials
  • 1 mM HCl (see recipe)
  • Buffers A1, A2, A3, and A4 (see recipe)
  • CPT1 (Fig. ; Imaizumi et al., )
  • HiTrap NHS‐activated HP column (7.0mm i.d., 25mm length; GE Healthcare)
  • Shimazu HPLC system (also see unit 10.5; Sinha and Jun, )
  • Additional reagents and equipment for HPLC (unit 10.5; Sinha and Jun, )
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

Videos

Literature Cited

Literature Cited
  Albright, L. M. and Slatko, B. E. 2000. Denaturing polyacrylamide gel electrophoresis. Curr. Protoc. Nucleic Acid Chem. 00:A.3B.1‐A.3B.5. doi: 10.1002/0471142700.nca03bs00.
  Bagalkot, V., Farokhzad, O.C., Langer, R., and Jon, S. 2006. An aptamer‐doxorubicin physical conjugate as a novel targeted drug‐delivery platform. Angew. Chem. Int. Ed. Engl. 45:8149‐8152. doi: 10.1002/anie.200602251.
  Banerjee, J. and Nilsen‐Hamilton, M. 2013. Aptamers: Multifunctional molecules for biomedical research. J. Mol. Med. (Berl.) 91:1333‐1342. doi: 10.1007/s00109‐013‐1085‐2.
  Cansiz, S., Zhang, L., Wu, C., Wu, Y., Teng, I.T., Hou, W., Wang, Y., Wan, S., Cai, R., Jin, C., Liu, Q., and Tan, W. 2015. DNA aptamer based nanodrugs: Molecular engineering for efficiency. Chem. Asian J. 10:2084‐2094. doi: 10.1002/asia.201500434.
  Ellington, A.D. and Szostak, J.W. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346:818‐822. doi: 10.1038/346818a0.
  Gold, L., Ayers, D., Bertino, J., Bock, C., Bock, A., Brody, E.N., Carter, J., Dalby, A.B., Eaton, B.E., Fitzwater, T., Flather, D., Forbes, A., Foreman, T., Fowler, C., Gawande, B., Goss, M., Gunn, M., Gupta, S., Halladay, D., Heil, J., Heilig, J., Hicke, B., Husar, G., Janjic, N., Jarvis, T., Jennings, S., Katilius, E., Keeney, T.R., Kim, N., Koch, T.H., Kraemer, S., Kroiss, L., Le, N., Levine, D., Lindsey, W., Lollo, B., Mayfield, W., Mehan, M., Mehler, R., Nelson, S.K., Nelson, M., Nieuwlandt, D., Nikrad, M., Ochsner, U., Ostroff, R.M., Otis, M., Parker, T., Pietrasiewicz, S., Resnicow, D.I., Rohloff, J., Sanders, G., Sattin, S., Schneider, D., Singer, B., Stanton, M., Sterkel, A., Stewart, A., Stratford, S., Vaught, J.D., Vrkljan, M., Walker, J.J., Watrobka, M., Waugh, S., Weiss, A., Wilcox, S.K., Wolfson, A., Wolk, S.K., Zhang, C., and Zichi, D. 2010. Aptamer‐based multiplexed proteomic technology for biomarker discovery. PLoS One 5:e15004.
  Imaizumi, Y., Kasahara, Y., Fujita, H., Kitadume, S., Ozaki, H., Endoh, T., Kuwahara, M., and Sugimoto, N. 2013. Efficacy of base‐modification on target binding of small molecule DNA aptamers. J. Am. Chem. Soc. 135:9412‐9419. doi: 10.1021/ja4012222.
  Kasahara, Y., Irisawa, Y., Fujita, H., Yahara, A., Ozaki, H., Obika, S., and Kuwahara, M. 2013. Capillary electrophoresis‐systematic evolution of ligands by exponential enrichment selection of base‐ and sugar‐modified DNA aptamers: Target binding dominated by 2′‐O,4′‐C‐methylene‐bridged/locked nucleic acid primer. Anal. Chem. 85:4961‐4967. doi: 10.1021/ac400058z.
  Keefe, A.D. and Cload, S.T. 2008. SELEX with modified nucleotides. Curr. Opin. Chem. Biol. 12:448‐456. doi: 10.1016/j.cbpa.2008.06.028.
  Kramer, M.F. and Coen, D.M. 2000. Enzymatic amplification of DNA by PCR: Standard procedures and optimization. Curr. Protoc. Mol. Biol. 52:15.1.1‐15.1.14. doi: 10.1002/0471142727.mb1501s56.
  Kuwahara, M., Takano, Y., Kasahara, Y., Nara, H., Ozaki, H., Sawai, H., Sugiyama, A., and Obika, S. 2010. Study on suitability of KOD DNA polymerase for enzymatic production of artificial nucleic acids using base/sugar modified nucleoside triphosphates. Molecules 15:8229. doi: 10.3390/molecules15118229.
  Kuwahara, M., Nagashima, J., Hasegawa, M., Tamura, T., Kitagata, R., Hanawa, K., Hososhima, S., Kasamatsu, T., Ozaki, H., and Sawai, H. 2006. Systematic characterization of 2'‐deoxynucleoside‐ 5'‐triphosphate analogs as substrates for DNA polymerases by polymerase chain reaction and kinetic studies on enzymatic production of modified DNA. Nucleic Acids Res. 34:5383‐5394. doi: 10.1093/nar/gkl637.
  McKeague, M. and Derosa, M.C. 2012. Challenges and opportunities for small molecule aptamer development. J. Nucleic Acids 2012:748913. doi: 10.1155/2012/748913.
  Shoji, A., Kuwahara, M., Ozaki, H., and Sawai, H. 2007. Modified DNA aptamer that binds the (R)‐isomer of a thalidomide derivative with high enantioselectivity. J. Am. Chem. Soc. 129:1456‐1464. doi: 10.1021/ja067098n.
  Sinha, N.D. and Jung, K.E. 2015. Analysis and purification of synthetic nucleic acids using HPLC. Curr. Protoc. Nucleic Acid Chem. 61:10.5.1‐10.5.39. doi: 10.1002/0471142700.nc1005s61.
  Smith, E.A., Thomas, W.D., Kiessling, L.L., and Corn, R.M. 2003. Surface plasmon resonance imaging studies of protein‐carbohydrate interactions. J. Am. Chem. Soc. 125:6140‐6148. doi: 10.1021/ja034165u.
  Stovall, G.M., Bedenbaugh, R.S., Singh, S., Meyer, A.J., Hatala, P.J., Ellington, A.D., and Hall, B. 2014. In vitro selection using modified or unnatural nucleotides. Curr. Protoc. Nucleic Acid Chem. 56:9.6.1‐9.6.33. doi: 10.1002/0471142700.nc0906s56.
  Tuerk, C. and Gold, L. 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505‐510. doi: 10.1126/science.2200121.
  Voytas, D. 2000. Agarose gel electrophoresis. Curr. Protoc. Mol. Biol. 51:2.5A.1‐2.5A.9.
  Wang, R.E., Zhang, Y., Cai, J., Cai, W., and Gao, T. 2011b. Aptamer‐based fluorescent biosensors. Curr. Med. Chem. 18:4175‐4184. doi: 10.2174/092986711797189637.
  Wang, K., You, M., Chen, Y., Han, D., Zhu, Z., Huang, J., Williams, K., Yang, C.J., and Tan, W. 2011a. Self‐assembly of a bifunctional DNA carrier for drug delivery. Angew. Chem. Int. Ed. Engl. 50:6098‐6101. doi: 10.1002/anie.201008053.
  Zhou, M.Y., Clark, S.E., and Gomez‐Sanchez, C.E. 1995. Universal cloning method by TA strategy. BioTechniques 19:34‐35.
  Zhu, G., Meng, L., Ye, M., Yang, L., Sefah, K., O'Donoghue, M.B., Chen, Y., Xiong, X., Huang, J., Song, E., and Tan, W. 2012. Self‐assembled aptamer‐based drug carriers for bispecific cytotoxicity to cancer cells. Chem. Asian J. 7:1630‐1636. doi: 10.1002/asia.201101060.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library