Analysis and Purification of Synthetic Nucleic Acids Using HPLC

Alex Andrus1, Robert G. Kuimelis2

1 PE Applied Biosystems, Foster City, California, 2 Phylos, Inc., Lexington, Massachusetts
Publication Name:  Current Protocols in Nucleic Acid Chemistry
Unit Number:  Unit 10.5
DOI:  10.1002/0471142700.nc1005s01
Online Posting Date:  May, 2001
GO TO THE FULL TEXT: PDF or HTML at Wiley Online Library

Abstract

HPLC is a powerful and popular method for analyzing and purifying biomolecules. Reversed‐phase HPLC allows a high‐capacity method for purification, and uses volatile buffer systems that simplify product recovery. Anion‐exchange HPLC provides better resolution and a more predictable elution pattern. This unit presents protocols that are optimized for HPLC of oligonucleotides. Because of the resolution limits of both reversed‐phase and anion‐exchange HPLC, it can be used for oligonucleotides of up to ˜50 nt in length.

     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Table of Contents

  • Basic Protocol 1: Reversed‐Phase Chromatography
  • Alternate Protocol 1: Anion‐Exchange HPLC
  • Support Protocol 1: Post‐HPLC Detritylation and Product Isolation
  • Reagents and Solutions
  • Commentary
  • Literature Cited
  • Figures
  • Tables
     
 
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Materials

Basic Protocol 1: Reversed‐Phase Chromatography

  Materials
  • Oligonucleotide sample
  • Triethylamine
  • 0.1 M triethylammonium acetate, pH 7 (TEAA; PE Applied Biosystems) for dissolving sample
  • Mobile phase solution A: 0.1 M TEAA, pH 7.0
  • Mobile phase solution B: acetonitrile
  • HPLC instrumentation, capable of both analysis and purification up to about several milligrams oligonucleotide per injection with the following features and specifications:
  •  Injector: autosampler (preferred) or manual syringe
  •  Pumping system: ternary (preferred) or binary, 0.1–5 mL/min
  •  Detector: UV/fluorescence (preferred) or UV/VIS variable between 190 to 600 nm
  •  Data: integrating data system (preferred) or chart recorder
  •  Gradient system: displays and stores for redisplay and reformatting (preferred) or programmable
  •  Column: 4.6 × 220‐mm Aquapore RP‐300 (Applied Biosystems) or Spheri‐5 RP‐18 (Applied Biosystems)
  •  Fraction collector

Alternate Protocol 1: Anion‐Exchange HPLC

  • Mobile phase solutions A and B for anion exchange (see recipe)
  • Aquapore AX‐300 (PE Applied Biosystems) or DNAPac Pa‐100 (Dionex) column

Support Protocol 1: Post‐HPLC Detritylation and Product Isolation

  Materials
  • Purified oligonucleotide
  • 80% acetic acid
  • 3 M sodium acetate
  • Absolute ethanol or 2‐propanol
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library

Figures

  •   FigureFigure 10.5.1 Chromatogram of reversed‐phase analysis of tritylated 18‐nt oligodeoxyribonucleotide, 5′‐DMTr‐TCACAGTCTGATCTCGAT‐3′, using an Aquapore RP‐300 column.
  •   FigureFigure 10.5.2 Chromatogram of reversed‐phase analysis of detritylated 20‐nt oligodeoxyribonucleotide, 5′‐CGAGTACTCCAA AACTAATC‐3′, using an Aquapore RP‐300 column.
  •   FigureFigure 10.5.3 Chromatogram of anion‐exchange analysis of 29‐nt oligodeoxyribonucleotide, 5′‐CCATGAAGCTTTGACCATGAAAATGGAGA‐3′, using a DNAPac PA‐100 column.
  •   FigureFigure 10.5.4 Chromatogram of reversed‐phase analysis of oligodeoxyribonucleotide 5′‐biotin‐TCACAGTCTGATCTCGAT‐3′, using an Aquapore RP‐300 C‐8 column.
  •   FigureFigure 10.5.5 Chromatogram of reversed‐phase analysis of 5′‐HEX‐ACATCTCCCCTACCGCTATA‐3′, using an Aquapore RP‐300 C‐8 column.
  •   FigureFigure 10.5.6 Chromatogram of reversed‐phase preparative purification of 100 OD units crude tritylated 22‐nt oligodeoxyribonucleotide, 5′‐DMTr‐GAATCACAGTCTGATCTCGATT‐3′, using an Aquapore RP‐300, 10 × 250–mm, 20 µm particle diameter (ABI), a flow rate of 4.5 mL/min, and detection at 290nm.

Videos

Literature Cited

Literature Cited
   Alul, R. 1993. Chemical synthesis of DNA and 2DNA analogs. In DNA Probes, 2nd ed. G. Keller and M. Manak, eds.) pp. 39‐136. Stockton Press, New York.
   Andrus, A. 1992. Evaluating and Isolating Synthetic Oligodeoxynucleotides. Applied Biosystems, Foster City, Calif. Available upon request.
   Andrus, A. 1995. Chemical methods for 5′ non‐isotopic labelling of PCR probes and primers. In PCR II: A Practical Approach M. McPherson, B. Hames, and G. Taylor, eds. pp. 39‐54. Oxford University press, Oxford.
   Andrus, A. and Bloch, W. 1998. HPLC of oligonucleotides and polynucleotides. In HPLC of Macromolecules: A Practical Approach R.W.A. Oliver, ed.) pp. 141‐70. Oxford University Press, Oxford.
   Applied Biosystems. 1995. Improved 1‐µmol RNA synthesis, analysis and purification. User Bulletin No. 91.
   Ausserer, W. and Biros, M. 1995. High‐resolution analysis and purification of synthetic oligonucleotides with strong anion‐exchange HPLC. Biotechniques 19:136‐39.
   Bergot, B.J. and Egan, W. 1992. Separation of synthetic phosphorothioate oligodeoxynucleotides from their oxygenated (phosphodiester) defect species by strong‐anion‐exchange high‐performance liquid chromatography. J. Chromatogr. 599:35‐42.
   Drager, R.R. and Regnier, F.E. 1985. High‐performance anion‐exchange chromatography of oligonucleotides. Anal. Biochem. 45:47‐56.
   Germann, M.W., Pon, R.T., and van de Sande, H. 1987. A general method for the purification of synthetic oligodeoxyribonucleotides containing strong secondary structure by reversed‐phase high‐performance liquid chromatography on PRP‐1 resin. Anal. Biochem. 165:399‐405.
   Goodchild, J. 1990. Conjugates of oligonucleotides and modified oligonucleotides: A review of their synthesis and properties. Bioconjugate Chem. 1:165‐187.
   Huang, G. and Krugh, T.R. 1990. Large‐scale purification of synthetic oligonucleotides and carcinogen‐modified oligodeoxynucleotides on a reverse‐phase (PRP‐1) column. Anal. Biochem. 190:21‐25.
   Huber, C.G., Oefner, P.J., and Bonn, G.K. 1993. High‐resolution liquid chromatography of oligonucleotides on nonporous alkylated styrene‐divinylbenzene copolymers. Anal. Biochem. 212:351‐358.
   Huber, C., Stimpf, E., Oefner, P., and Bonn, G. 1996. A comparison of micropellicular anion‐exchange and reversed‐phase stationary phases for HPLC analysis of oligonucleotides. LC/GC 14:114‐127.
   Ikuta, S., Chattopadhyaya, R., and Dickerson, R.E. 1984. Reverse‐phase polystyrene column for purification and analysis of DNA oligomers. Anal. Chem. 56:2253‐2256.
   Kang, C., Zhang, X., Ratliff, R., Moyzis, R., and Rich, A. 1992. Crystal structure of four‐stranded Oxytricha telomeric DNA. Nature 1:356:126.
   Krstulovic, A. 1987. Nucleic acids and related compounds. In Handbook of Chromatography, 1, Parts A and B G. Zweig and J. Sherma, ed. pp. 161‐169; 35‐64. CRC Press, Boca Raton, Fla.
   Maisano, F., Parente, D., Velati Bellini, A., Carrera, P., Zamai, M., and Grandi, G. 1989. A rapid and efficient method for the purification of synthetic oligonucleotides by high performance anion‐exchange chromatography in volatile buffer. Biochromatography 4:279‐281.
   Newton, P. 1990. Complex biological matrices: Column capacity and separation strategy. LC/GC 8:116‐122.
   Noller, H.F. 1984. Structure of ribosomal RNA. Annu. Rev. Biochem. 53:119‐162.
   Oefner, P., and Bonn, G. 1994. High‐resolution liquid chromatography of nucleic acids. Am. Lab. June:28‐28.
   Oefner, P.J., Huber, C.G., Umlauft, F., Berti, G.N., Stimpfl, E., and Bonn, G.K. 1994. High‐resolution liquid chromatography of fluorescent dye‐labeled nucleic acids. Anal. Biochem. 223:239‐46.
   Pingoud, A., Fliess, A., and Pingoud, V. 1988. HPLC of oligonucleotides. In HPLC of Macromolecules R.W.A. Oliver, ed. pp. 183 IRL Press, New York.
   Sproat, B., Colonna, F., Mullah, B., Tsou, D., Andrus, A., Hampel, A., and Vinayak, R. 1995. An efficient method for the isolation and purification of oligoribonucleotides. Nucleosides Nucleotides 14:255‐273.
   Symons, R.H. 1992. Small catalytic RNAs. Ann Rev. Biochem. 61:641‐671.
   Theisen, P., McCollum, C., and Andrus, A. 1992. Fluorescent dye phosphoramidite labelling of oligonucleotides . Nucl. Acid Symp. Ser. No. 27, 27:99‐100.
   Warren, W.J. and Vella, G. 1993. Analysis and purification of synthetic oligonucleotides by high‐performance liquid chromatography. In Protocols for Oligonucleotide Conjugates S. Agrawal, ed. pp. 233‐64. Humana Press, Totowa, N.J.
   Wang, K.Y., McCurdy, S., Shea, R.G., Swaminathan, S., and Bocton, P.H. 1993. A DNA aptamer which binds to and inhibits thrombin exhibits a new structural motif for DNA. Biochemistry 32:1899‐1904.
   Zon, G. 1990. Purification of synthetic oligodeoxyribonucleotides. In High Performance Liquid Chromatography in Biotechnology W.S. Hancock, ed. pp. 301. John Wiley & Sons, New York.
   Zon, G. 1993. Oligonucleoside phosphorothioates In Protocols for Oligonucleotides and Analogs S. Agrawal, ed. pp. 165‐189. Humana Press, Totowa, N.J.
GO TO THE FULL PROTOCOL:
PDF or HTML at Wiley Online Library